Negative Regulation of Cell Fate Specification by the lin-15 Locus During Vulval Induction in Caenorhabditis elegans Citation Gonzalez-Serricchio, Aidyl Sofia (2000) Negative Regulation of Cell Fate Specification by the lin-15 Locus During Vulval Induction in Caenorhabditis elegans. Dissertation (Ph.D.), California Institute of Technology. doi:10.7907/ppq9-ps50. https://resolver.caltech.edu/CaltechTHESIS:07022021-160304976 Abstract We have visualized extrachromosomal arrays by targeting the green fluorescent protein (GFP) to a specific DNA sequence ( lac operator) incorporated into Caenorhabditis elegans ' transgenes. This system can be used to determine polyploidy and to investigate chromosome segregation. This technique also allows rapid, accurate determination of spontaneous loss of an array, thereby allowing high-resolution mosaic analysis. We carried out genetic mosaic analysis on lin-3 (epidermal growth factor) using the GFP-Lacl + lacO method. This methodology confirmed lin-3 's site of action for vulval induction is at the anchor cell. This result also proved this technique works. We used both the GFP-Lacl + lacO 256 system as well as the ncl-1 gene as genetic mosaic markers to determine the site of action of lin-15A and lin-15B . Both markers indicate that lin-15A gene function is required within the vulval precursor cells (VPCs) to prevent an excessive number of VPCs from generating vulval progeny. The mosaic expression pattern for lin-15B is broad therefore, proven difficult to pinpoint a site of action. The products of the lin-15 gene were first defined genetically as negative regulators of the vulval induction pathway. It encodes two novel hydrophilic proteins, LIN-15A and LIN-15B. According to antibody stainings and GFP expression patterns, both proteins are nuclear and present in almost all the cells. lin-15 is part of the synthetic multivulva (synMuv) set of genes which are comprised of two classes, A and B. Mutation of both an A and a B gene is required to obtain a multivulva (Muv) phenotype. Further characterization of the lin-15 locus reveals an effect on fertility. Item Type: Thesis (Dissertation (Ph.D.)) Subject Keywords: Biology; Genetics Degree Grantor: California Institute of Technology Division: Biology Major Option: Biology Thesis Availability: Public (worldwide access) Research Advisor(s): Sternberg, Paul W. Thesis Committee: Sternberg, Paul W. (chair) Zinn, Kai George Meyerowitz, Elliot M. Hay, Bruce A. Lester, Henry A. Defense Date: 17 May 2000 Non-Caltech Author Email: aidylsofia (AT) gmail.com Record Number: CaltechTHESIS:07022021-160304976 Persistent URL: https://resolver.caltech.edu/CaltechTHESIS:07022021-160304976 DOI: 10.7907/ppq9-ps50 Default Usage Policy: No commercial reproduction, distribution, display or performance rights in this work are provided. ID Code: 14292 Collection: CaltechTHESIS Deposited By: Benjamin Perez Deposited On: 02 Jul 2021 16:48 Last Modified: 06 Aug 2021 18:57 Thesis Files PDF - Final Version See Usage Policy. 44MB Repository Staff Only: item control page

Negative regulation of cell fate specification by the lin-15 locus during vulva induction in Caenorhabditis elegans Thesis by Aidyl S. Gonzalez-Serricchio Advisor Paul W. Sternberg In Partial Fulfillment of the Requirements For the Degree of Doctor of Philosophy California Institute of Technology Pasadena, California 2000 (Defended May 17, 2000) 11 ©2000 Aidyl S. Gonzalez-Serricchio All Rights Reserved 111 I dedicate my thesis to my husband and son, Fred and Joey Serricchio. They made me laugh and feel I could do anything I put my mind to. IV Acknowledgments First, I would like to thank my advisor, Paul Sternberg, for showing me the humor, beauty and the power C.elegans has in science and my research. I would also thank my thesis committee, Kai Zinn, Elliot Meyerowitz, Bruce Hay and Henry Lester, for their guidance through my work as well as interesting committee meetings. I am very grateful for the invaluable scientific discussions with every member in the Sternberg lab. I learned how to be constructively critical and fascinated with scientific research from the post-Docs in the lab, Wange, Byung, Lisa, Bhagwati, Rene, Dave, Carol and Nadeem. Everyday in my graduate career was kept fresh and exciting, which I truly appreciate, due to my fellow graduate student and technicians in the lab such as Keith, Martha, Yen, Demo, Yvonne, Minqin, Shahla and Wen, to name a few. The incredible belief and support I received from Keith Brown and Sharon Slavin has been invaluable to me. Without their support and meaningful discussions, I would not be receiving my Ph.D. this year. Last but not least, I would like to thank my parents and my parents-in-law. First my parents, Felipe and Lydia Gonzalez, for working so hard that they sweated blood in order to keep my brother, sister, and me in private school. My parents kept us safe from the surrounding danger and showed us that hope, love and perseverance can get you out of the worst of situations. As for my mother and father-in-law, Fred and Lesley Serricchio, I feel so much love, belief and respect from them that I weep with joy that I have them in my life, especially as my parents. V Abstract We have visualized extrachromosomal arrays by targeting the green fluorescent protein (GFP) to a specific DNA sequence (lac operator) incorporated into Caenorhabditis elegans' transgenes. This system can be used to determine polyploidy and to investigate chromosome segregation. This technique also allows rapid, accurate determination of spontaneous loss of an array, thereby allowing high-resolution mosaic analysis. We carried out genetic mosaic analysis on lin-3 (epidermal growth factor) using the GFP-Lacl + lacO method. This methodology confirmed !in-J' s site of action for vulval induction is at the anchor cell. This result also proved this technique works. We used both the GFP-LacI + lacO256 system as well as the ncl-1 gene as genetic mosaic markers to determine the site of action of lin-l 5A and lin-l 5B. Both markers indicate that lin-l 5A gene function is required within the vulval precursor cells (VPCs) to prevent an excessive number of VPCs from generating vulval progeny. The mosaic expression pattern for lin-l 5B is broad therefore, proven difficult to pinpoint a site of action. The products of the lin-15 gene were first defined genetically as negative regulators of the vulval induction pathway. It encodes two novel hydrophilic proteins, LIN-15A and LIN-15B. According to antibody stainings and GFP expression patterns, both proteins are nuclear and present in almost all the cells. lin-15 is part of the synthetic multi vulva (synMuv) set of genes which are comprised of two classes, A and B. Mutation of both an A and a B gene is required to obtain a multivulva (Muv) phenotype. Further characterization of the lin-15 locus reveals an effect on fertility. Vl Table of Contents Acknowledgments 1v Abstract v Chapter I : The power of genetics A-1 Defining the phenomenology A-2 Caenorhabditis elegans: A model system for genetics A-2 Deciphering functional pathways by genetics A-3 Positive and negative regulators during vulval induction A- 7 Mosaic analysis A-10 Chapter 2: Visualization of C. elegans extrachromosomal arrays by GFP: B-1 A single cell marker for mosaic analysis and its use demonstrating lin-3 functions in anchor cell Abstract B-2 Introduction B-2 Materials and methods B-5 Results B-8 Visualization of chromosomes B-8 GFP-Lacl + lacO as a single cell marker B-10 Polyploidy B-11 GFP-LacI + lacO as a mosaic marker B-12 Discussion B-13 Vll Visualization of arrays B-13 Single cell marker B-14 Site of action of lin-3 B-15 Acknowledgments B-16 Tables and Figures Figure 1 B-18 Figure 2 B-20 Figure 3 B-21 Figure 4 B-23 Figure 5 B-25 Figure 6 B-27 Table 1 B-28 Table 2 B-29 Table 3 B-30 Chapter 3: Mosaic analysis of the lin-15 gene function in vulval induction Abstract C-2 Introduction C-2 Materials and methods C-6 Results C-11 lin-15 :: GFP reporter is expressed broadly C-11 vm lin- l 5A mosaics C-11 lin-l 5B mosaics C-12 Molecular determination of lin-l 5A lesions C-13 lin- l 5A localize expression to tissues in hermaphrodites C-14 Discussion C-15 Site of action of lin-l 5A C-15 Synthetic multivulva genes C-16 Figures and Tables Figure 1 C-19 Figure 2 C-20 Figure 3 C-22 Figure 4 C-24 Figure 5 C-25 Figure 6 C-28 Figure 7 C-30 Table 1 C-31 Table 2 C-32 Appendix 1: let-23 site of action determined by GFP: :Lael+ lacO C-33 Abstract C-34 Introduction C-34 Materials and methods C-35 IX Results C-37 let- 23 site of action Discussion let- 23 site of action C-37 C-39 C-39 Figure Figure 1 Chapter 4: Additional characterization of LIN-15 proteins C-41 D-1 Abstract D-2 Introduction D-2 Materials and methods D-5 Results D-6 Broodsizes at 20°C D-6 Broodsizes at 25°C D-8 Discussion D-9 Figures Figure 1 D-12 Figure 2 D-14 Summary E-1 References F-1 A-1 Chapter 1 The power of genetics A-2 Genetic analysis is a powerful tool used to clarify how genes specify complex structures and behaviors in higher organisms. It is used to order genes in functional pathways as well as to define in which cells a gene product is required (genetic mosaic analysis). Caenorhabditis elegans: A model system for genetics The experimental organism chosen for my genetic study is the small ( 1mm long) nematode, Caenorhabditis elegans. C.elegans has several features that make it particularly amendable to genetic analysis. These features include a short generation time of 3 1/2 days and an invariant pattern of cell divisions. Also, differentiation and morphorgenesis can be viewed with single-cell resolution in intact living animals. These self-fertilizing hermaphrodites allow new mutations to become homozygous, without the additional generation consequential to sibling mating (Brenner, 1973; Brenner, 197 4; Kenyon, 1988; Riddle et al. 1997; and Wood, 1998). One way to identify potentially interesting alleles of genes involved in complex structures and behaviors is by chemical mutagenesis. Potent mutagens such as ethyl methanesulphonate (EMS) penetrate the animal easily and effectively. EMS (at 50mM) induces point mutations (G/C--~A/T transitions) at frequency of 7xl0-6 per mutagenized G/C base pair resulting in loss of function, reduction of function alleles or gain of function, and is therefore commonly used. Many of the mutants isolated from EMS mutagenesis are lethal. Mutants isolated have been selected and categorized on the basis A-3 of morphological abnormalities (i.e. , size or shape), deviation from the normally smooth sinusoidal movement of the nematode ' s body on the agar surface, and mating behavior (Brenner, 1973; Kenyon, 1988; Riddle et al. 1997; and Wood, 1998). Once the mutants are placed into a broad category, they are genetically characterized. Recently, the C. elegans genome has been sequenced. This not only allows for easy cloning, but most importantly, finding functional homo logs within its genome as well as other genomes that have been completed (i.e., human, Drosophila, and Saccharomyces cerevisiae ). Deciphering functional pathways by genetics The dissection of developmental pathways in C. elegans begins with thorough comprehension of the relevant phenotypes associated with the genes involved. Double mutant analysis can be used to determine the epistatic relationship between mutations (Avery and Wasserman, 1992). Epistasis is the masking of one mutant phenotype by a second mutant phenotype that maps to another locus. Epistasis analysis can order gene action of two types but the order depends on the type of pathways: the substratedependent pathway and the switch regulation pathway. The distinction between switch regulation pathway versus substrate-dependant pathway depends on the phenotype studied or the event assayed, respectively (Avery and Wasserman, 1992; and Huang, 1995). The substrate-dependent pathway involves a substrate initiating a required series of events to generate a final outcome. In C. elegans ' vulval development, there are a A-4 series of genes that are necessary for the development of the 12 "Pn.p" cells (Pl .p-P12.p). A subset of which (P3.p-P8.p) is competent to be vulval precursor cells (VPCs). Three of the VPCs (P5.p-P7.p) adopt vulval cell fates (Sulston and Horvitz, 1977; Sulston and White, 1980; Sternberg and Horvitz, 1986; Ferguson, Sternberg and Horvitz, 1987; Sternberg, 1988; Ferguson and Horvitz, 1989; Huang, Tzou, and Sternberg, 1994; and Huang, 1995). Mutant alleles of lin-26 (fin= lineage abnormal), lin-39 and let-23 (let= lethal) result in a vulvaless phenotype. lin-26 (zinc finger transcription factor) is responsible for the formation of the Pn.p cells and if mutated, the Pn.p cells are absent. lin-39 (homeoprotein) is responsible for P3.p-P8.p adopting VPCs fate while let-23 (EGF receptor) determines which Pn.p cell will actually differentiate into vulval tissue. Animals with mutations in lin-39 have no VPCs generated, while animals' with mutations in let-23 have undifferentiated VPCs. The Pn.p cells are the substrate to the activities of lin-26, lin-39, and let-23. The developmental status or fate of the Pn.p cells by these genes' activity determines the order of action of the three genes (Sulston and Horvitz, 1977; Sulston and White, 1980; Sternberg and Horvitz, 1986; Ferguson, Sternberg and Horvitz, 1987; Sternberg, 1988; Ferguson and Horvitz, 1989; Huang, Tzou, and Sternberg, 1994; and Huang, 1995). Switch regulation pathway is dependent upon distinct phenotypic states like in the case of C. elegans, multivulva (Muv) versus vulvaless (Vul) versus wildtype vulva (wt). Epistasis tests are done between two mutations in different loci with opposite phenotypes in order to define the given switch regulation pathway. A-5 Analysis of the vulval induction pathway was done using comprehensive doublemutant analysis. The inductive signal that initiates C.elegans vulval differentiation occurs between the anchor cell (AC), a cell in the gonad, and six equipotential cells in the ventral epidermis or VP Cs, P3. p-P8. p (Sulston and Horvitz, 1977; Kimble and Hirsh, 1979; Sulston and White, 1980; Sternberg and Horvitz, 1986; and Thomas et al. 1990). As mentioned previously, 3 of the 6 VP Cs adopt vulval fate while the other three cells adopt non-vulval, non-specialized epidermal fates. The induced VPCs may adopt either a 1° or 2° vulval fate, which can be distinguished by subsequent cell division patterns and morphology (Sulston and White, 1980; Kimble, 1981 ). If the AC is eliminated by laser ablation, the inductive signal, LIN-3 protein, is not produced and therefore its receptor, LET-23, can not initiate the vulval induction pathway, resulting in all 6 VPCs adopting non-vulval, non-specialized epidermal fates (Vul) (Kimble, 1981; Hill and Sternberg, 1992). Other mutations that cause this Vul phenotype are: let-23 (EGFR), lin-3(EGF), let-60 (Ras protein), and lin-45 (Raf kinase). Mutations that result in the opposite phenotype or Muv are lin-15 (novel proteins) and lin-1 (ETS domain protein, transcription factor) (Ferguson, Sternberg, and Horvitz, 1987; Han, Aroian and Sternberg, 1990; Hill and Sternberg, 1992; and Sternberg, 1993). According to the double mutant analysis lin-1 is epistatic to all Vul genes affecting VPC specification. The other double mutants yield the following result: let-23 epistatic to lin-15,· lin-15 epistatic to lin-3,· let60 and lin-45 are epistatic to lin-15 (Avery and Wasserman, 1992; Ferguson, Sternberg, A-6 and Horvitz, 1987; Han, Aroian and Sternberg, 1990; Hill and Sternberg, 1992; Sternberg, 1993; Lackner et al. 1994). The double mutant analysis with the Muv and Vul genes resulted in this preliminary pathway: lin-3 -l lin-15 - j let-60, let23, lin-45-j lin-J - j vulval fates (Avery and Wasserman,1992; Ferguson, Sternberg, and Horvitz, 1987; Hill and Sternberg, 1992; Sternberg, 1993, Lackner et al. 1994). Inference of this pathway by epistasis was misleading because not all the genes used are complete loss of function. Also, most pathways are not linear and simple as epistasis results imply. Interpretation of epistasis can lead to an incorrect order of a pathway if the description of phenotype is rudimentary. For example, the double mutant lin-15(Muv); n300 (Vul) is Vul as in n300 therefore suggesting that n300 is downstream of lin-15. However, lin-15 is downstream of n300 because the cause of the Vul phenotype is the absence of the VPCs (Ferguson et al. 1987 and Huang, 1995). Genetic redundancy also complicates the interpretation of epistasis. If two or more genes can perform the same function, then inactivation of one of these genes often has little to no effect on the biological process (Nowak et al. 1997). There are examples of genetic redundancy in many studies of developmental biology, immunology, neurobiology and the cell cycle and it seems to dominate in the genomes of higher organisms (Nowak et al. 1997). The synthetic multivulva (synMuv) pathway is an example of a genetically redundant pathway in C.elegans (Ferguson and Horvitz, 1989; Huang, Tzou, Sternberg, 1994 and Clark, Lu, Horvitz, 1994 and Nowak et al. 1997). This functionally redundant pathway consists of two classes of gene types, A and B class, that affect vulval induction. A mutation in either an A or a B class gene or genes has no A-7 phenotypic result on the vulva. If both A and B class genes are mutated, the hermaphrodite is Muv (Ferguson and Horvitz, 1989; Huang, Tzou, Sternberg, 1994 and Clark, Lu, Horvitz, 1994; and Huang, 1995). The four class A genes (lin-8, lin-15A, lin- 38, and lin-56) and the ten class B genes (lin-9, lin-l 5B, lin-35, lin-36, lin-37, lin-51, lin52, lin-53, lin-54 , and lin-55) encode negative regulators of vulval induction (Horvitz and Sulston, 1980; Ferguson et al. 1987; Ferguson and Horvitz, 1989; Huang et al. 1994; and Lu and Horvitz, 1998). The absence of the synMuv activity causes P3 .p, P4.p and P8.p to adopt vulval fates resulting in the Muv phenotype of the animal. Positive and negative regulators during vulval induction Vulval induction in C. elegans occurs between the AC and P3.p - P8.p (VPCs) cells (Sternberg and Horvitz 1986; Sulston and White 1980). The anchor cell secretes the LIN-3 (EGF-like protein) to the VPCs, causing 3 of the 6 cells to adopt vulval fates since LIN-3 binds and activates its LET-23 (receptor tyrosine kinase). The other 3 cells will adopt an epidermal fate resulting in one round of division. There are two different vulval fates, 1° and 2° that can be distinguished by the pattern of the subsequent divisions and morphology adopted by the granddaughter cells of the induced VPCs (P5.p-P7.p) (Katz et al. 1995; Sternberg and Horvitz 1986). During induction in intact wild-type hermaphrodite, P6.p will adopt the 1° fate since it is closest to the anchor cell while P5.p and P7.p adopt 2° vulval fate (Sulston and Horvitz 1977). Lateral signaling from P6.p to A-8 P5.p and P7.p elicit the invariant pattern of cell fates (Greenwald et al. 1983; Katz et al. 1995; Koga and Ohshima 1995b; Sternberg and Horvitz 1986; Sternberg and Horvitz 1989). Once LET-23 is stimulated by LIN-3, the effector proteins downstream (SEM-5, LET-341 SOS, LET-60 RAS, LIN-45 RAF) alter the transcriptional factors to specify the cell to adopt a vulval fate. This positive regulative pathway for vulval induction utilizes a member of the epidermal growth factor (EGF) receptor (EGFR) family of receptor tyrosine kinases (RTKs) (Aroian and Sternberg 1991; Eisenmann and Kim 1994; Greenwald and Broach 1990; Gutch et al. 1998; Hill and Sternberg 1992; Kayne and Sternberg 1995; Koga and Ohshima 1995b; Moghal and Sternberg 1999; Simske et al. 1996). Acting on this EGF/EGFR pathway, there are five negative regulatory pathways affecting vulval development (Clark et al. 1994; Ferguson and Horvitz 1989; Galisteo et al. l 995; Huang et al. 1994; Jongeward et al. 1995; Lesa and Sternberg 1997; Yoon et al. 1995). Two of the five pathways, synMuv A and synMuv B, appear distinct from the other 3 negative regulators (sli-1, unc-1 OJ, and rok-1) which are dependent on and act directly on LET-23 (Clark et al. 1994; Galisteo et al. 1995; Huang et al. 1994; Jongeward et al. l 995; Lesa and Sternberg 1997; Yoon et al. 1995). The functionally redundant synthetic multivulva pathways comprise two classes, the synMuv class A and the synMuv class B. The Muv strain CB1322 was found first to require mutations in two unlinked genes, lin-8 and lin-9 (Horvitz and Sulston 1980). An additional 5 synMuv mutations were inadvertently found after mutagenizing a strain with an undetected class A mutation (Ferguson and Horvitz 1989). Eventually, mutagenesis were done on the known single mutants of class A and B, each phenotypically wild-type, A-9 which led to further isolation of synMuv mutants (Ferguson and Horvitz 1989). Hermaphrodites carrying an A class and a B class mutation result in all 6 Pn.p cells adopting either a primary or secondary VPCs fate (i.e., A Muv phenotype). Hermaphrodites with one or two mutations of the same class have a wild-type vulva phenotype (Clark et al. 1994; Ferguson and Horvitz 1985; Ferguson and Horvitz 1989; Horvitz and Sulston 1980; Huang et al. 1994; Lu and Horvitz 1998). The synMuv genes encode negative regulators of vulval induction (Clark et al. 1994; Ferguson and Horvitz 1985; Ferguson and Horvitz 1989; Horvitz and Sulston 1980; Huang et al. 1994; Lu and Horvitz 1998). There are 4 class A genes ( lin-8, lin-l 5A, lin-38, and lin-5 6) and 10 class B genes (lin-9, lin-l 5B, lin-35, lin-36, lin-37, lin-51, lin-52, lin-53, lin-54, and lin-55 (Clark et al. 1994; Ferguson and Horvitz 1985; Ferguson and Horvitz 1989; Horvitz and Sulston 1980; Huang et al. 1994; Lu and Horvitz 1998). lin-15 is a complex locus with two independent mutable activities, A and B class (Clark et al. 1994; Ferguson and Horvitz 1985; Ferguson and Horvitz 1989; Horvitz and Sulston 1980; Huang et al. 1994; Lu and Horvitz 1998) and it acts independently of two known signals controlling the fates of the vulval precursor cells (VPCs), the anchor cell (AC) inductive signal and a lateral signal among the VPCs (Herman and Hedgecock 1990). Each of the two cistrons of the lin-15 locus encodes a hydrophilic protein, LIN15A and LIN-15B, which have no obvious similarity to each other or to other known proteins, so far. Previous mosaic analysis indicated that lin-15 acts in cells other than AC and the VPCs (i.e., non-autonomous) (Herman and Hedgecock 1990). The lin-15 locus is A-10 also involved in cell fate specification of the C. elegans male tail (Chamberlin and Sternberg 1993 ; Chamberlin and Sternberg 1994) Mosaic Analysis Once a gene is characterized, genetic mosaic analysis can be used to determine in which cells a particular gene product is required to rescue a certain phenotype or event. C. elegans transparent body and its invariant cell lineage allows one to score at the single cell level for the presence of a given gene activity by using non-autonomous single cell marker plus the gene of interest (Herman, 1984, 1987, and 1989). Determining which cells the gene product is needed for a given function is more biologically relevant than simply knowing where the gene is transcribed, or where the protein is found. Mosaic analysis is informative when the cells are genotypically mutant for a given gene while another set of cells is genotypically wild type in a given animal. Then one asks what is the phenotypic event for the animal (Herman, 1984, 1987, and 1989; and Hedgecock and Herman, 1995). Mosaic analysis of a gene can be done only with the knowledge about the phenotype of the mutant or null animal. One can perform mosaic analysis on a mutant phenotype and not focus on cellular abnormalities such as dumpy worm" (Dpy) in the case of C. elegans. Mosaics are generated to determine which cells, either hypodermal or muscles cells, for example, need the wild-type dpy gene to rescue the Dpy phenotype. The mutant phenotype is rescued only when the responsible cells contain wild-type copies of the given gene regardless of the other cell' s genotype. These data imply the site of action of the gene among all the cells in the animal (Herman, 1984, 1987, and 1989; and Hedgecock and Herman, 1995). A-11 Genetic mosaics are generated by the loss of the wild-type gene from a progenitor cell during development thus generating a lineage of mutant cells. This type of analysis addresses the question of whether the phenotype of the affected cell is dependant upon the genotypes of other cells due to cellular interactions (cell non-autonomous) or the cellular abnormality is solely dependent on the genotype of the affected cell (cell autonomous) (Herman, 1984, 1987, and 1989; and Hedgecock and Herman, 1995). The wild-type protein that was synthesized in the progenitor cell or its grand or great-grand parent cells prior to gene loss might persist and be transmitted to its descendants even though the gene is not present. Such persistence is called perdurance (Garcia-Bellido and Merriam, 1971; Herman, 1984, 1987, and 1989; Villeneuve and Meyer, 1990; and Hedgecock and Herman, 1995). The persistence of the gene product even after the gene is lost masks the site of action. sdc-1 is a gene involved in both sex determination and dosage compensation. Genetic mosaic analysis of sdc-1 reveals neither AB(-) nor P1(-) (symbolize loss of wild-type copy of the gene) mosaics in the cell lineage of sdc-1 exhibited a wild type phenotype (Villeneuve and Meyer, 1990). Another form of perdurance is maternal effect. One type of maternal effect is maternal rescue. Maternal rescue occurs when homozygous mutant progeny from heterozygous mother has a less severe phenotype than the homozygous mutant progeny from a homozygous mutant mother. lin-15 demonstrates maternal effect of the Muv phenotype. A homozygous mutant for a lin-15 mutant is Muv as its progeny would be Muv. If the lin-15 mutant were a heterozygote, then the progeny that is homozygous mutant for lin-15 would have wild-type vulvae (Ferguson and Horvitz, 1989; Villeneuve A-12 and Meyer, 1990; Huang, Tzou, Sternberg, 1994 and Clark, Lu, Horvitz, 1994; and Huang, 1995). Gene characterization, pathway analysis and its site of action in an organism can be determined with the power of genetics. As mentioned previously, lin-15 is a member of a set of negative regulators of vulval development in which appropriate mutation combinations result in a multivulva (Muv) phenotype (Ferguson and Horvitz, 1989). lin15 is a complex locus with two independent, mutable activities, A and B (Ferguson and Horvitz, 1989; Huang, Tzou and Sternberg, 1994; Clark, Lu and Horvitz , 1994; Lu and Horvitz,1998) and it acts independently of two known signals controlling the fates of the VPCs, the AC inductive signal and a lateral signal among the VPCs (Herman and Hedgecock, 1990). The two cistrons of the lin-15 locus each encode a hydrophilic protein, LIN-15B and LIN-15A, which have no obvious similarity to each other or to other known proteins. In this thesis, I develop a powerful new technique, GFP-Lacl + lac02 56, which is used for a variety of genetic tests. I demonstrate its utility by analyzing the site of action of lin-3 for vulval induction. Also, I use GFP-Lacl + lac0 256 as a single cell marker for mosaic analysis on the lin-15 locus in order to determine its site of action for both gene activities. Moreover, I further characterize lin-15A by localizing its expression to certain tissues of the hermaphrodite. Finally, I identify vital domains in the gene for proper protein activity. B-1 Chapter 2 Visualization of C. elegans extrachromosomal arrays by GFP: A single cell marker for mosaic analysis and its use demonstrating lin-3 functions in anchor cell B-2 Abstract We have visualized extrachromosomal arrays by targeting the green fluorescent protein (GFP) to a specific DNA sequence (lac operator) incorporated into C.elegans ' transgenes. Cells containing this system have nuclear-localized bright spots of GFP-Lacl bound to lacO, and diffuse nuclear fluorescence corresponding to nuclear localized GFPLacl. A chromosomal-integrated array of lac operators allows detection of nematode chromosomes in living animals. This technique allows rapid, accurate determination of spontaneous loss of an array, thereby allowing high-resolution mosaic analysis. This system can also be used to determine polyploid and to investigate chromosome segregation. We carried out genetic mosaic analysis on lin-3, which encodes an epidermal growth factor family member, using the GFP-Lacl + lacO system. The anchor cell is the site of action for induction of the vulva by lin-3. INTRODUCTION The green fluorescent protein (GFP) of the jellyfish Aequorea victoria has been used extensively for observation in vivo of gene expression and cell morphology in C.elegans (Chalfie et al. 1994; Cubitt et al. 1995; Heim et al. 1994; Heim and Tsien 1996). GFP has also been targeted to specific subcellular structures by fusing GFP to various proteins (Chalfie et al. 1994; Cubitt et al. 1995; Heim et al. 1994; Heim and Tsien 1996). A technique utilizing a chimeric protein of GFP (S65T) and the E. coli lac repressor (Lael) along with lac operator (lacO) makes the visualization of chromosomes B-3 possible (Chalfie et al. 1994; Cubitt et al. 1995; Heim et al. 1994; Heim and Tsien 1996; Robinett et al. 1996; Straight et al. 1996; Webb et al. 1995). This fusion protein has the DNA-binding capability of Lael and the fluorescent properties of GFP. The fusion protein is capable of binding to the lacO, thus localizing GFP expression at the DNA repeat. Such localization allows direct visualization of segregating chromosomes during mitosis. We have applied the GFP-Lacl technique to C. elegans. We show that the GFPLacl + lacO repeat technique allows visualization of extrachromosomal arrays, viewing chromosomal segregation and determining polyploidism in C. elegans. We have also applied the GFP-Lacl + lacO technique to mosaic analysis. Genetic mosaics in C. elegans are typically generated by the spontaneous somatic loss of an extrachromosomal array or free duplication (Hedgecock and Herman 1995; Herman 1984; Herman 1989; Herman 1995). When the free duplication or extrachromosomal array containing a wild-type cell-autonomous marker gene (usually ncl-1; enlarged nucleoli) and a gene of interest is lost from one of the daughter cells during mitosis, it gives rise to a lineage of cells lacking wild-type activity of the marker gene and the gene of interest (Hedgecock and Herman 1995; Herman 1984; Herman 1989; Herman 1995). This "loss" allows the determination of which cells are required for proper gene function. Extra-chromosomal arrays are mitotically unstable such that the mosaic pattern is complex (Hedgecock and Herman 1995; Herman 1984; Herman 1989; Herman 1995; Miller et al. 1993), and thus a precise method of scoring individual cells under fluorescence microscopy would be useful. B-4 The LIN-3 protein affects hermaphrodite fertility. It is also an inductive signal for vulval differentiation, animal viability, as well as the specification of anterior cell fates in male B cell lineage (Ferguson and Horvitz 1985; Ferguson et al. 1987; Hill and Sternberg 1992; Horvitz and Sulston 1980; Liu et al. 1999; Sulston and Horvitz 1981 ). lin-3 gene encodes a protein of the epidermal growth factor (EGF) family (Hill and Sternberg 1992; Liu et al. 1999). The EGFs family is involved in animal development to promote cell proliferation and differentiation. LIN-3 has an extracellular domain with one EGF motif, a transmembrane domain and a cytoplasmic domain. We focus on LIN-3 inductive signal to initiate vulva differentiation in this paper. The progeny of three vulva precursor cells (VPCs) forms the vulva. The VPCs are the posterior daughters (P3. p-P8. p) of the 12 P cells that are present since hatching (Sternberg and Horvitz 1986; Sulston and Horvitz 1977). During vulval induction, the AC secretes the epidermal growth factor LIN-3 protein (Hill and Sternberg 1992; Katz et al. 1995; Sternberg and Horvitz 1986). The VPC (P6.p) that is nearest to the AC will adopt the primary fate since it has more of its receptor tyrosine kinases occupied by the LIN-3 protein. P5.p and P.7.p cells are induced to adopt the secondary fate while the VPCs (P3.p, P4.p. and P8.p) further from the AC adopt a tertiary or non-vulval fate. The fates adopted by the VPCs indicate the number of cell descendants. The primary and secondary cell fates generate 8 and 7 cell descendants, respectively. Together, these cells form the vulva while the tertiary fates generate 2 non-vulval descendants that fuse with B-5 the hyp7 epidermis (Horvitz 1988; Horvitz and Sternberg 1991; Kimble and Hirsh 1979; Koga and Ohshima 1995b; Liu et al. 1999; Simske et al. 1996; Simske and Kim 1995; Sternberg and Horvitz 1986; Sulston and White 1980). Evidence from genetic and laser ablation studies and structural comparison with other EGFs suggest LIN-3 is secreted from the AC to activate the induction pathway resulting in three VPCs to take vulval fate (Aroian et al. 1990; Hill and Sternberg 1992; Hill and Sternberg 1993; Katz et al. 1996; Liu et al. 1999; Simske et al. 1996; Sternberg and Horvitz 1986). We have confirmed via mosaic analysis using GFP-Lacl + lacO, that lin-3 signal is required solely in the anchor cell for proper vulval induction. MATERIALS AND METHODS Nematode methods: Growth and handling of C. elegans strain N2 were according to Brenner (1974) and Sulston and Hodgkin (1988). All experiments were performed at about 20°C unless otherwise stated. The genetic and cellular nomenclature of C. elegans was followed according to Horvitz et al. (1979) and Sulston et al. (1983), respectively. Strains: The standard wild-type N2 strains and other mutant strains used ncl-1 (e 1865) and lin-5(el 348) dpy-1 0(el 28) II were obtained from the Caenorhabditis Genetics Center (USA). The lin-15 null allele el 763 was used for lin-l 5A mosaic analysis (Ferguson and Horvitz 1985). B-6 The transgenes syEx[dpy-20(+) (20ng/µl) + dpy-30::S65T*Lacl (1 00ng/µl) + pPD49-78GFP-Lacl (l00ng/µl) and syEx(dpy-20(+) (20ng/µl) + pPD49-78 GFP-Lacl + lacO (50ng/µl)] were integrated into ncl-1 (el 865)111; dpy-20(el 282)1Vand dpy20(el 282)1V strains via X-ray irradiation (Fire 1986), respectively, to yield PS2441 (sy1s39) and PS2442 (syls44) (Table 1). GFP-Lacl fusion plus 256 lacO repeat: The GFP-Lacl fusion protein plus the lacO repeat (Robinett et al. 1996; Straight et al. 1996; Webb et al. 1995) was graciously given to us by Dr. Andrew Belmont. We placed GFP-Lacl under the transcriptional control of an hsp16 promoter/enhancer element pPD49-78 (Fire and Xu 1995; Mello and Fire 1995; Perry et al. 1993). The fusion protein was inserted into Kpnl/Sacl site of heat shock vector pPD49-78. pPD49-78 is expressed very well in the neural and hypodermal cells, as well as in the gut, muscles, and pharynx but not in the germline (Mello and Fire 1995; Perry et al. 1993). The GFP-Lacl was also placed under the transcriptional control of the dpy-30 promoter graciously given to us by Dr. Barbara Meyer. The dpy-30 promoter directs expression throughout the animal, including the germline. The GFP was replaced with GFP(S65T) from the vector pPD93-65, which contains introns, in order to increase translation of the fusion protein (Mello and Fire 1995). The GFP (now designated S65T*) is inserted in the Kpnl/EcoRI site of the dpy-30::GFP-Lacl, now called dpy30:: S65T* -Lael. B-7 Germline-mediated transformation by microinjection: Microinjection was performed according to Mello et al., (1991), which was modified from Fire (1986). Young adult hermaphrodites were placed live on pads of 2% agarose under an inverted differential contrast-interference (Nomarski) microscope (Carl Zeiss, Oberkochen, West Germany) and the DNA was injected into the gonad using an Eppendorf micro injector 5242 (Eppendorf Gertebau Netheler, Hamburg, West Germany). For the Ncl vs. GFP-Lacl and polyploid experiments, the plasmid pRF4, containing the rol-6(sul 006) mutant gene (Mello et al. 1991 ), was used as a dominant transformation marker at a concentration of 40ng/µl). The injection mixture for the Ncl vs. GFP-Lacl experiment contained pPD4978GFP-LacI (1 00ng/µl), 256 repeat lacO array (50ng/µl), cosmid C33C3 (rescues the Ncl-1 mutant phenotype (Miller et al. 1996) (50ng/µl) and pBluescript II SK+ (Stratagene) as carrier DNA (5ng/µl). This mixture was injected into ncl-1 (el865) gonads. The injection mixture for the polyploidism experiments contained pPD4978: :GFP-LacI (1 00ng/µl), 256 repeat lacO array (50ng/µl), and pBluescript II SK+ (Stratagene) as carrier DNA (5ng/µl). This injection mixture was injected into the gonads of lin-5(el 348) dpy-1 0(el 28) II to yield syEx207 in the strain PS2629. The transgenic lines obtained from each experiment were heat-shocked for 30 minutes at 33°C to elicit GFP-Lacl expression. Expression of the GFP-LacI can be seen as early as 30 minutes after heat-shock, and as late as 24 hours. Mosaic analyses lin-3 gene function in vulval induction: Mosaic animals were obtained from a somatic loss of the extrachromosomal array syEx345[lin-3(+), lacO, B-8 myo-2::GFP( pPDJ 18-33)} from the vulvaless strain sy!s46,· lin-3(n3 78) let-59(s49) unc22(sy7)/ lin-3 (nl 059)unc-24(el 38) (Table 1). The point of loss is determined by the absence of the fluorescent spot. We used L3-L4 wildtype, multivulva, and vulvaless animals with their pharynx fluorescing, due to MYO-2: :GFP, for mosaic analysis to ensure the array is present (Okkema et al. 1993). The nuclei observed to identify mosaic animals are: AC, P3.p, P4.p, P5.p, P6.p, P7.p and P8.p. Microscopy and Photography: Animals were anesthetized with 2mM levamisole on 5% Noble agar pads. Photographs were taken on Kodak Ektachrome, ASA 160 or Fuji Provia, ASA 400 on a Zeiss Axioplan with Chroma High Q GFP LP filter set (absorption band 450nm and 505nm emission) at 1OOX optics or by Confocal photomicrography for strain PS2442. Results Visualization of Chromosomes: To test whether the GFP-Lacl + lacO system could be used to visualize the DNA of extrachromosomal arrays in C. elegans, we engineered a GFP-Lacl fusion protein under the control of the heat-shock promoter in vector pPD4978 (hsGFP-Lacl). We then microinjected a DNA mixture containing hsGFP-LacI, the lacO repeat and dpy-20 rescuing DNA (pMH86) into the gonad of an adult dpy-20 (el 282) hermaphrodite. After a 30-minute heat-shock at 33°C, transformants were B-9 found to express nuclear GFP and intense foci of subnuclear fluorescence, presumably corresponding to the DNA of the extrachromosomal arrays. DAPI co-staining confirmed that the GFP-Lacl + lacO system has nuclear expression and association with the DNA. We first detected expression in embryos at early gastrulation (~24 cell stage). Larvae and adults express GFP broadly. DNA molecules injected into the C. elegans gonad syncytium assemble into arrays; extrachromosomal arrays consist of many rearrangements of the DNA injected (Mello et al. 1991 ). Figure IA and Figure IB demonstrate, respectively, the fusion protein bound to the lacO repeat resulting in one to two bright spots per nucleus as well as the unbound fusion protein resulting in nuclear diffuse fluorescence ("haze"). Mitotic loss of these mixed extrachromosomal arrays in a single founder cell resulting in a clone of cells lacking the activities of all genes in the array (Herman 1984; Herman 1989; Miller et al. 1996). Figure 1B also demonstrates the mitotic instability and the ease of determining whether a loss occurred (AB loss). In order to test the reliability and consistency of the GFP-Lacl + lacO as a detection method for transgenes, non-Dpy transformants were X-irradiated to integrate the transgenic array into the genome, yielding sy!s44 in the strain PS2442. In this strain, we observed that most nuclei had one or more spots of fluorescence (see Figure 1C). Detection of chromosomes was efficient. For example, we observed two pairs of sister cells in each of the 20 animals, the embryonic sisters F and U and the postembryonic sisters P8.pa and P8.pp, and found that all 80 cells had one or two fluorescent spots. Therefore, we are able to detect a transgene in every cell. B-10 GFP-Lacl + lacO as a single cell marker The ncl-1 (el 865) mutation results in enlarged nucleoli (Ncl phenotype) of a large number of cell types. Since ncl-1 acts in a cell autonomous fashion, it is useful as a cell lineage marker (Hedgecock and Herman 1995). The cosmid clone (C33C3) rescues the ncl-1 phenotype and has been used as a cell lineage marker on extrachromosomal arrays (Koga and Ohshima 1995b; Miller et al. 1996; Yochem et al. 1998). To test the utility of the GFP-Lacl + lacO technique as a single cell marker, we compared it with ncl-1. A DNA mixture composed of the lacO repeat, C33C3, and the lin-l 5B(+) DNA was injected into the gonads of syls46; ncl- 1(el 865); dpy-20(el 282); lin-l 5(el 763) animals (Table 2). The isolated transgenic mosaic animals were then heat shocked (See Materials and Methods). We scored the Ncl phenotype in the nucleoli of 22 different cells (m2, m3L, m3VL, m4, m3R, m3VR, m3DR, m3DL, hyp7 dorsal head, hyp7 ventral head, P/I, p3.p, P4.p, P5.p, P6,p, P7.p, P8.p, B, F, U, hyp7 ventral tail, hyp7 anus) per mosaic animal (n=37)(Table 2). The presence of the spot is unequivocal evidence that the trans gene is present. The existence ofNcl(-) cells with spots indicate a false negative by Ncl-1. Conversely, non-Ncl cells with no spots may indicate the perdurance of the NCL-1 protein (i.e., false positive) or an early loss of the lacO array. According to Table 2, both markers agree in scoring approximately 80%, while false negatives of Ncl-1 or (N, +) occur about 16%. The occurrence of false positives of Ncl-1 or (W, -) is 2%. However, neither marker is perfect. The N cl marker is undetectable in the germline, intestinal nucleoli and endogenously large nucleoli such as some hyp cells and muscle cells. The GFP-Lacl B-11 + lacO system has a higher apparent loss rate per cell division of 15. 9% (Table 3)(discussed later) as well as fading of the GFP. One possibility for the lack of intense fluorescent spots is that the expression of GFP-LacI is insufficient. We thought this possibility likely since the expression depended on the GFP filter combination used, and the light source (200 watt vs. 100 watt). To increase the sensitivity, we engineered a GFP-LacI under the control of the ubiquitously expressed dpy-30 promoter/enhancer (Hsu et al. 1995). Another possibility is that non-Ncl nuclei without spots reflect perdurance of NCL-1. The combined use of the cell lineage marker ncl-1 and the GFP-LacI + lacO would increase the accuracy and ease of mosaic analysis. In order to use both markers, the double mutant ncl-1 ,· dpy-20 was injected with the DNA mixture (pMH86 (dpy20(+)) + pPD49-78::GFP-LacI + dpy-30::GFP-LacI). Once the non-Dpy transformants were isolated, the extrachromosomal array was integrated into the genome by X-ray irradiation to yield strain PS2958 syls46 [pMH86 + pPD49-78::GFP-LacI + dpy30::S65T*Lacl] JI,· ncl-1 III,· dpy-20 IV This strain became the base for our genetic mosaic analysis of lin-l 5A and lin-l 5B,· the results of which will be discussed in a later journal. Polyploidy To test whether our method can detect polyploidy, we injected into lin-5(el 348) mutant, which fails to undergo mitosis (Albertson et al. 1978), a DNA mixture B-12 consisting of a fusion protein under the control of the heat-shock promoter pPD49-78, the lacO repeat, plus rol-6(sul 006) dominant, mutant transforming marker. The Rol segregants of strain PS2629 confirmed that GFP-Lacl +lacO can assay for polyploid cells. Multiple dots have been seen when viewing polyploid cells (i.e. , intestines and hypodermal cells; Figure 6). We conclude that the GFP-Lacl +lacO method is useful in determining which cells are polyploid. However, the number of spots within the cell cannot unambiguously determine the extent of ploidy. Diploid cells have 1-3 spots while polyploid cells express more than 4 spots. GFP-Lacl + lacO as a mosaic marker: The GFP-Lacl + lacO as a mosaic marker confirms lin-3's site of action for vulval induction is in the AC. The strain we chose to use contains to mutant alleles of lin-3 in trans and syls46 in the background. The mutant alleles we chose for our purpose are: n3 78 that is defective only in vulval development, i.e., vulvaless hermaphrodites, and nl 059 that resembles a genetic null and causes L 1 lethality (Hill and Sternberg 1992; Liu et al. 1999). This strain syls46; lin-3 (n3 78) let59(s49) unc-22(sy7)/lin-3(nl059) unc-24(el38) was then injected with lin-3(+) (20ng/µl) , lacO (50ng/µl), transformation marker pPDl 18-33 (myo-2 ::GFP)(l6nglµl) (Okkema et al. 1993), and carrier DNA BSK+II (120ng/µl). We examined animals with fluorescent pharynx due to myo2::gfp. These chosen animals have the trans gene in either the AB lineage or P 1 lineage or both lineages B-13 (Okkema et al. 1993). We picked L3-L4 animals expressing myo-2: :GFP by viewing them under a dissecting microscope with a GFP filter. These animals were then heatshocked for 30 minutes in a 33 degree water-bath followed by a one-hour recovery period in a 20 degree incubator. We examined a total of 114 animals prescreened by the dissecting microscope. We considered three possibilities: lin-3 acts in the AC, it acts in the VPCs or both. We therefore scored the AC and the VPCs of W.T., Vul and Muv lin-3 transgenic animals. Of the 114 animals, 91 were wild-type vulva, 15 animals were vulvaless and 8 animals were multivulva. 88 animals with the array present in both the AC and VPCs were wt and Muv. Eight animals lacking the array in both the AC and VPCs were Vul. 11 animals had the array in the AC but not in the VPCs were wt (n=l0) and a Muv (n=l) (Figure 2, 3, and 5). Seven animals had the array in the VPCs but not in the AC were all Vul (Figure 2 and 4). We conclude lin-3 acts in the AC. Discussion Visualization of arrays: We have demonstrated that GFP-Lacl + lacO can be used to visualize arrays transgenes, either as extrachromosomal arrays or integrated into a chromosome, in living C. elegans. We have also shown that GFP-Lacl + lacO is a useful in vivo marker for ploidy determination. We also show that this direct visualization allows high-resolution mosaic analysis using transgenes. We examined this method by comparing its efficiency with Ncl-1 as a single cell marker for mosaic B-14 analysis. We have demonstrated the utility of GFP-LacI + lacO as a mosaic marker by locating lin-3 site of action at the AC for vulval induction. Single cell marker: The comparison between ncl-1 (el 865) and the GFP-LacI + lacO indicate that this new marker is comparable in its reliability to ncl-1 as a cell lineage marker for the presence of a transgene (Table 2). The main advantage of using the fusion protein GFP-LacI + lacO rather than ncl-1 is that scoring the mutant Ncl phenotype is typically more difficult than scoring cells with the bound GFP-LacI fusion protein. Also, GFP-Lacl can be used in cells such as intestinal cells and germline for which ncl-1 is not applicable. We find that the GFP-LacI method (spot or not spot) is much easier than scoring nucleolus size. Such ease of scoring may also be used for more accurate mosaic analysis. The comparison between the GFP-LacI + lacO and ncl-1 as a single cell marker as well as its loss rate per cell division (Table 2 and 3) confirms that using both the ncl-1 and the integrated GFP-LacI together will increase the accuracy for mosaic analysis. An alternative mosaic marker, SUR-5GFP(NLS), demonstrates the ease and speed of scoring cells by fluorescence comparative to the Ncl-1 marker (Yochem et al. 1998). In this technique, one is able to rapidly screen with a dissecting microscope for rare mosaic animals (Yochem et al. 1998), unlike the GFP-Lacl + lacO methodology that requires a compound microscope. B-15 The high loss rate of GFP-LacI + lacO, 15.9%, may be due to the destabilization of the arrays formed such as the early loss of the marker gene possibly with the of the gene of interest expression continuing or there may be silencing of neighboring genes due to heterochromatic regions formed by the lacO repeat. The latter case is more likely than the former because multiple repeats due have a tendency to condense affecting the genes nearby. The early loss of the array with the expression of the gene of interest continuing is the result of the transgenic array breaking. This situation can be circumvented by having more than one stable transgenic line to score for mosaics in order to secure no irregularity of the results obtained. The chances having three or more stable transgenic line such unstability are nearly zero. Site of action of lin-3: We used the PS2958 strain for the lin-3 mosaics. This strain is an excellent base for performing mosaic analysis for any gene. Any null mutation for the gene of interest can be placed in the background in the PS2958 strain. Then inject into the new strains' gonad the remaining components of the mosaic markers, ncl-1 (+) and the lacO repeat, the rescuing DNA of the gene of interest and a transformation marker (if needed). lin-3 is required at multiple time points for several aspects of C.elegans development. It's required throughout all larval stages for viability. It is required during mid-larvae stages for vulval induction and male spicule development, and in the later stages for fertility (Aroian et al. 1990; Hill and Sternberg 1992; Hill and Sternberg 1993; Katz et al. 1996; Liu et al. 1999; Simske et al. 1996; Sternberg and Horvitz 1986). We focus on lin-3' s requirement in vulval induction. One mutant allele lin-3 (e 1417) has a B-16 mutation in the promoter region, which affects the expression of lin-3 in the AC. This allele has the YPCs adopting non-vulval fates with no other developmental defects. This was confirmed genetically by constructing the strain el41 7/nl059. If the el41 7 allele specifically affects the vulva, the phenotype of el 417/nl 059 should be Yul but have no other lin-3 mutant phenotype (Liu et al. 1999). If el 41 7 has low levels of activities in all tissue, the phenotype of el41 7/nl059 would not only be Yul but also have pleotropic phenotypic effects of lin-3 loss (Liu et al. 1999). The resulting phenotype of el41 7/nl059 is solely Yul, therefore, specifically affecting the vulva due to nonexpression of lin-3 in the AC. Of the 114 animals scored during the lin-3 mosaics, 18 mosaic animals (Figure 2) further confirm lin-3 function is required in the AC to induce vulval differentiation (Figure 3, 4, 5). The 10 animals with wild-type vulva, loss the array (no bright spot) in the Pn.p cells but all had the array present (bright spot) in the AC (Figure 2 and 3) signifying that lin-3 is not required in the YPCs to have vulva development but in the AC. The 7 vulvaless animals had the array (bright spot) in the Pn.p but all loss the array (no bright spot) in the AC (Figure 2 and 4) signifying that the AC is the site of lin-3 expression for vulval induction. One multivulva animal loss the array (no bright spot) in all the Pn.p cells but present (bright spot) in the AC again signifying that lin-3 is not required in the YPCs to have vulva development but required in the AC for vulval induction (Figure 2 and 5). Acknowledgments: We greatly thank Andrew Belmont for the fusion protein GFP-Lacl and lacO repeat constructs as well for invaluable help developing this system, and Linda B-17 Huang for suggesting its use in mosaic analysis. We also thank Barbara Meyer for the dpy-30 promoter. We appreciate Shahla Gharib ' s assistance during the strain integration. We also thank the members of our lab for vital input into this manuscript. The USPHS (grant HD23690 to PWS) supported this work. A.S.G-S. is a Howard Hughes Medical Institute Graduate Fellow. P.W.S. is an Investigator with the Howard Hughes Medical Institute. The Caenorhabditis Genetic Center provided some strains. B-18 Figure 1. Visualization of C. elegans extrachromosomal arrays by GFP a) One to two bright spots are seen per nucleus when the fusion proteins are bound to the lacO array. b) If the fusion proteins remain unbound, then the nucleus has diffuse fluorescence. Embryos, dpy-20; syEx [pMH86, pPD49-78: :GFP-Lacl, lacO], were mounted on 5% Noble agar and examined under Nomarski optics and epifluorescence at lOOX. c) A confocal photomicrograph of syls44 L4 hermaphrodite's pharynx. Arrowheads point to unbound GFP-Lacl. Arrows point to bound GFP-Lacl to lacO. B-19 B-20 Figure 2. Mosaic analysis of lin-3 with GFP-Lacl + lacO Mosaic analysis of lin-3(n3 78)/(nl 059)) animals using GFP-LacI + lacO as the marker reveals that the wild-type lin-3 gene is required in the AC for normal vulval induction.+: GFP-LacI• lacO, fluorescent spot; -: no fluorescence. Letters correspond to vulval status: W= normal vulva; M= multivulva; V = vulvaless. The numbers in the Pn.p column indicates the number of nuclei with bright spots of fluorescence. The asterisks indicate where pseudovulvae formed in Muv animal. Worm P3.p P4.p P5.p P6.p P7.p W.1 P8.p Anchor Cell +2 + inferred + +3/7cells - +5/7cells + + +2 +2/7cells -8 +2/6cells +2 -2 -7 -7 -2 +4/7cells -8 +2/7cells -2 W.58 +1 -7 -7 W.64 +1 +5/7cells -8 +6/7cells -2 W.84 -2 -2 -2 +2/4cells -4/4cells -4/4cells -2 + + + + + + -7 -7 -8 -7 -7 -2 + inferred + + -2 + + + + + + W.26 W.36 + W.39 W.53 + W.89 W.91 -8 -8 -8 V.2 V.3 V.7 V.9 V.15 M.5 -2 + + + + + + + + + + + + + + + + +2 +2 +2 +2 +2 + + + + + -2 -* -* * -2 V.10 V.12 -2 + B-21 Figure 3. lin-3 mosaic animal: wild-type vulva a) lin-3 mosaic animal at L4 stage with normal vulval development. Anchor cell labeled with arrow. b) Same lin-3 mosaic animal at L4 stage with normal vulval development. The anchor cell expresses the transgenic array (lin-3(+) + lacO + pPDJ 18-33) or bright-localized spot. The vulval precursor cells do not express the transgenic array or no bright-localized spot. B-22 lin-3 mosaics: AC= +; VPCs= Wildtype Vulva B-23 Figure 4. lin-3 mosaic animal: vulvaless a) lin-3 mosaic animal at L4 stage with no Pn.p cells adopting vulval fate. Anchor cell labeled with yellow arrow. Pn.p cells labeled with white arrow. b) Same lin-3 mosaic animal at L4 stage with no Pn.p cells adopting vulval fate. The anchor cell does not express the transgenic array (lin-3(+) + lacO + pPDJ 18-33) or bright-localized spot. The Pn.p cells do express the transgenic array or bright-localized spot. B-24 lin-3 mosaics: AC= -; VPCs= + Vulva less B-25 Figure 5. lin-3 mosaic animal: multivulva vulva a) lin-3 mosaic animal at L4 stage with multivulva phenotype. Anchor cell labeled with arrow. b) Same lin-3 mosaic animal at L4 stage with multi vulva phenotype. The anchor cell expresses the transgenic array (lin-3(+) + lacO + pPDJ 18-33) or brightlocalized spot. The vulval precursor cells do not express the transgenic array or no bright-localized spot. B-26 lin-3 mosaics: AC= +; VPCs= Multivulva B-27 Figure 7. Assay for Polyploidy of nuclei Comparison of body muscle between syls44 [dpy-20(+)+pPD49-78::GFPlacl+lacO]; dpy-20 and lin-5(el348), dpy-1 0(el 28) II; syEx20 7 [pRF4 (rol-6(sul 006)) +pPD49- 78GFP-LacI+/acO]. Animals were mounted on 5% Noble agar containing ~l00nM levamisole and examined under Nomarski microscopy and fluorescence at 100X. a) lin5 (e 1348), dpy-10(e128) II; syEx207 [pRF 4 (rol-6(sul 006))+pPD49- 78GFP-Lacl+/acO] L4 hermaphrodite. b) syls44 [dpy-20(+) +pPD49-78::GFP-LacI+/acO ]; dpy-20 L4 hermaphrodite. Arrowheads point to unbound GFP-Lacl. Arrows point to bound GFPLacl to lacO. B-28 B-29 Table 1. Transgenes and strains PS2442: syis44 [pMH86 (dpy~20(+) ), pPD49-78GFP-lacI, lacO]; dpy-20(e1282) PS2381: syExl 54 [pRF4 (rol-6(sul 006) ), C33C3 , pPD49-78GFP-lacI, lacO]; ncl1(el 865) III PS2629: lin-5(e1348), dpy-1 0(e128) II; syEx207 [pRF4 (rol-6(sul 006) ), pPD49- 78GFP-LacI, lacO256] PS2958: syis46 [pMH86 (dpy-20(+)), dpy-30S65T*Lacl, pPD49-78GFP-LacI] II,· ncl- 1(el 865) III,· dpy-20(el 282) IV,· him-5(el 490) V PS3047: syis46,· ncl-l(el865),· dpy-20(el282),· lin-15(e1763) ,· syEx272 [lin-15B (+), lacO, C33C3] PS3427: syis46,· lin-3(n3 78) let-59(s49) unc-22(sy7)/ lin-3 (nl 059) unc-24(el 38),· syEx345 [lin-3 (+ ), lacO, pPDl 18-33] B-30 Table 2. ncl-1 versus GFP-Lacl + lacO as markers for mosaic analysis. lin-15B mosaic animals (n=37) used to determine the occurrence of the Ncl phenotype and GFPLacl + lacO. Scored by cell from anterior to posterior of the worm: m2, m3L, m3VL, m4, m3R, m3VR, m3DL, m3DR, hyp7(dorsal, head), hyp7(ventral head), P/1, P3.p, P4.p, P5.p, P6.p, P7.p, P8.p, B, F, U, hyp7(tail), hyp7(anus). +: GFP-Lacl bound to the lacO, fluorescent spot; -: no fluorescence, W: normal nucleolus size, N: enlarged nucleolus and ? : undetermined. Cell m2 m3L m3VL m4 m3R m3VR m3DR m3DL hyp7(D. head) hyp7 (V.head) P/1 P3.p P4.p P5.p P6.p P7.p P8.p B F u hyp7 (V.tail) hyp7 (anus) Mean% Standard Dev W, + or N,32(86.5%) 31(83.8%) 31(83 .8%) 28(75.7%) 31(83.8%) 30 (81%) 29(78.4%) 30 (81%) 30(81%) 32(86.5%) 33(89.2%) 30(81%) 29(78.4%) 30(81%) 32(86.5%) 33(89.2%) 26(70.3%) 22(59.5%) 31(83.8%) 29(78.4%) 29(78.4%) 21(56.8%) 80% 0.08 W,0 2(5.4%) 1(2.7%) 0 2(5.4%) 1(2.7%) 0 0 1(2.7%) 0 1(2.7%) 1(2.7%) 2(5.4%) 2(5.4%) 0 0 1(2.7%) 1(2.7%) 1(2.7%) 2(5.4%) 0 1 (2.7%) 2% 0.02 N, + 3 (8%) 4 (10.8%) 5 (13.5%) 9 (24.3%) 4 (10.8%) 6 (16.2%) 8 (21.6%) 7 (18.9%) 6 (16.2%) 5 (13.5%) 3(8.1%) 3 (8.1%) 4 (10.8%) 4 (10.8%) 4 (10.8%) 3(8.1%) 9 (24.3%) 14(37.8) 5 (13.5%) 6 (16.2%) 7 (18.9%) 8 (21.6%) 7% 0.07 ? 2 3 2 1 1 1 1 1 7 2% 0.04 B-31 Table 3. Apparent loss rate per cell division: FU sister cells. -/- : cell had lost the array; +/- : loss at this cell division; +/+: no loss at this cell division. The determination of the loss rate for each marker. Loss rate is [+/-]/[( +/+) +( +/-)] Strains used PS3427 (Table 1). Integrated GFP-Lacl: n=67 animals [PS3427: lin-3 mosaics] + + + - FU# FU% Loss Rate 37 55.2% 15.9% 23 34.3% 7 10.4% C-1 Chapter 3 Mosaic analysis of lin-15 gene function in vulval induction C-2 Abstract The products of the lin-15 gene were first defined genetically as negative regulators of the vulval induction pathway. The lin-15 locus encodes two novel hydrophilic proteins, LIN-1 SA and LIN-1 SB. lin-l 5A and lin-l 5B belong to the synthetic multi vulva (synMuv) set of genes which are comprised of two classes, A and B. Mutation of both an A and a B gene is required to obtain a multi vulva (Muv) phenotype. We used both, the GFP-Lacl + lac0256 system as well as the ncl-1 gene (abnormally large nucleoli, used as a single cell marker), as genetic mosaic markers to determine the site of action of lin-l 5A and lin-l 5B. Both markers indicate that lin-l 5A gene function is required within the vulval precursor cells (VPCs) to prevent an excessive number of VPCs from generating vulval progeny. lin-l 5B has a broad focus making it difficult to pinpoint a site of action. Further mosaics for lin-l 5B were done using the SUR-5::GFP as an additional mosaic marker and again proved difficult to pinpoint a site of action. We concluded either LIN-15B is required at the hypodermis or the perdurance of the LIN15B protein is confounding the mosaic analysis result. Previous mosaics with a free duplication and a mutation that eliminate function of both lin-l 5A and B (lin-l 5(n309)) (Herman and Hedgecock 1990) indicated that at least one lin-15 function acts nonautonomously. Our results indicate lin-l 5A gene activity in the VPCs is sufficient to rescue the Muv phenotype. This result is strengthened by the rescue of the lin-15 null phenotype by localizing lin-l 5A expression solely at the VPCs. C-3 Introduction Vulval development Four different pathways are involved to form the hermaphrodite vulva: the receptor tyrosine kinase LET-23 (RTK)/Ras pathway, the LIN-12 Notch pathway and two functionally redundant synthetic multivulva pathways known as synMuv class A and synMuv class B (Figure 1) (Greenwald and Broach 1990; Greenwald et al. 1983; Horvitz 1988; Sternberg and Horvitz 1986; Sternberg and Horvitz 1989). The initiating signal for vulva patterning and morphogenesis is from the anchor cell (AC). The AC decision is determined by lateral signaling. Two gonadal cells Zl .ppp and Z4.aaa have an equal chance of becoming an AC, with the remaining cell becoming a ventral uterine precursor (VU). Factors involved in this decision are the lin-12 (receptor) and lag-2 (ligand) (Greenwald and Broach 1990; Greenwald et al. 1987; Greenwald et al. 1983). LIN-12 protein is a member of the Notch protein family which are predicted transmembrane proteins with epidermal growth factor (EGF) motif, 3 LNR (LIN-12 /Notch repeat) motifs in their extracellular domains and 6 ankrin repeats in their cytoplasmic domains. lin-12 activity is also seen in lateral signaling between the VPCs, which will be described later (Greenwald et al. 1983; Sternberg and Horvitz 1989). LET-23/Ras pathway The VPCs are the posterior daughters (P3.p-P8.p) of the 12 P cells that are present since hatching (Sulston and Horvitz 1977). During vulval induction, the AC secretes the C-4 epidermal growth factor LIN-3 protein (Hill and Sternberg 1992). The VPC (P6.p) that is nearest to the AC will adopt the primary fate since it receives more LIN-3 protein or receives it earlier. P5.p and P.7.p cells are induced to adopt the secondary fate via LIN12 while the VPCs (P3.p, P4.p. and P8.p) further from the AC adopt a tertiary or nonvulval fate. The fates adopted by the VPCs indicate the number of cell descendants. The primary and secondary cell fates generate 8 and 7 nuclei descendants, respectively, but also differ in their morphogenesis. Together, these cells form the vulva while the tertiary fates generate 2 non-vulval descendants that fuse to the hyp7 epidermis (Horvitz 1988; Horvitz and Sternberg 1991; Kim 1995; Kimble and Hirsh 1979; Koga and Ohshima 1995b; Simske et al. 1996; Sulston et al. 1980; Sulston and Horvitz 1977). There is also lateral signaling during vulval induction, involving the LIN-12/N otch protein. The primary cell signals the lateral cells in order to prevent them adopting the primary fates. lin-12 affects the VU/AC decision before vulval induction as well as VPCs fates. In a lin-12 null animal, there are additional primary cell fates which replaces the secondary cell fates (Ferguson et al. 1987; Greenwald et al. 1983; Sternberg and Horvitz 1989; Wilkinson and Greenwald 1995). Synthetic multivulva pathway Two additional pathways involved in vulva development are the functionally redundant synthetic multi vulva pathways. There are two classes of pathways involved: the synMuv class A and the synMuv class B. Animals with an A class and a B class mutation result in a Muv phenotype while animals with one or two mutations of the same C-5 class have a wild-type vulva phenotype (Clark et al. 1994; Ferguson and Horvitz 1985; Ferguson and Horvitz 1989; Horvitz and Sulston 1980; Huang et al. 1994; Lu and Horvitz 1998). The synMuv genes encode negative regulators of vulval induction (Clark et al. 1994; Ferguson and Horvitz 1985; Ferguson and Horvitz 1989; Horvitz and Sulston 1980; Huang et al. 1994; Lu and Horvitz 1998). There are 4 class A genes and 10 class B genes (Refer to Chapter A)(Clark et al. 1994; Ferguson and Horvitz 1985; Ferguson and Horvitz 1989; Horvitz and Sulston 1980; Huang et al. 1994; Lu and Horvitz 1998). lin-15 is a member of a set of negative regulators of vulval development in which appropriate mutation combinations result in a multivulva (Muv) phenotype (Ferguson and Horvitz 1989). It has two independent mutable activities, A and B class (Clark et al. 1994; Ferguson and Horvitz 1985; Ferguson and Horvitz 1989; Horvitz and Sulston 1980; Huang et al. 1994; Lu and Horvitz 1998) and it acts independently of two known signals controlling the fates of the vulval precursor cells (VPCs), the anchor cell (AC) inductive signal and a lateral signal among the VPCs (Herman and Hedgecock 1990). lin-15 locus encodes novel hydrophilic proteins, LIN-15A and LIN-15B. Antibodies staining against both proteins show each protein present in all cells, including oocytes (Huang 1995). As we shall see, GFP expression under the control of the lin-15 promoter shows fluorescence in all cells except early germline cells. Since both antibody staining and GFP expression pattern are broad, the site of action for each gene for repressing vulval induction could not be determined. lin-l 5's site of action during vulva induction can be determined by genetic mosaic analysis. Previous mosaic analysis indicated lin-15 acts in cells other than AC and the VPCs (i.e., non-autonomous) C-6 (Herman and Hedgecock 1990). We have expanded this mosaic analysis by performing mosaic studies on each cistron (/in-15A and lin-15B) separately using GFP-Lacl + lacO as well as ncl-1 as mosaic markers. We describe the analysis that shows lin-15A gene site of action is at the VPCs. The localization of the LIN-15A protein to the VPCs further complements the mosaic result of lin-15A. VP Cs localize lin-15A is sufficient to rescue the Muv phenotype of the null lin-15 allele unlike its localized expression in the hypodermis and intestines. Materials and Methods Nematode methods Growth and handling of C. elegans strain N2 were according to Brenner (1974) and Sulston and Hodgkin (1988). All experiments were performed at about 20°C unless otherwise stated. The genetic and cellular nomenclature of C. elegans was followed according to Horvitz et al., (1979) and Sulston et al. (1983), respectively. (Brenner 1974; Horvitz et al. 1979; Sulston et al. 1983) Strains The standard wild-type N2 strains and ncl-1 (e1865) were obtained from the Caenorhabditis Genetics Center (USA). The lin-15 null allele el 763 was used for lin15A mosaic analysis (Ferguson and Horvitz 1985). C-7 The transgenes syEx[dpy-20(+) (20ng/µl) + dpy-30: :S65T*Lacl (l00ng/µl) + pPD49- 78GFP-Lacl (1 00ng/µl) was integrated into ncl-1 (el 865)111,· dpy-20(el 282)IV (Fire, 1986), respectively, to yield PS2958 (syls46). (Table 1, Chapter 2). Molecular determination of lin-15A lesions Genomic DNA was purified from strains carrying known lin-15A mutations: linJ5(sy197); lin-15(n744B, sy211); and lin-15(n744B, sy212). The lin-15 coding region and the regions of introns near the splice sites were amplified using the polymerase chain reaction (PCR), and the sequences of theses PCR products were determined using an automated ABI 373A cycle sequencer by the California Institute of Technology sequencing facility (Applied Biosystems, Foster City, CA). We also amplified lin-l 5A genomic clone (pBLH51) (Huang 1995; Huang et al. 1994) by PCR in order to introduce premature stop codons at the end of exon 4(K304Amber), exon 5(S360Amber) and in the middle of exon 6(G579Amber). Each clone with a premature stop codon was injected into the gonads of lin-15(el 763) animals in order to determine Muv rescue. The injection mixture consisted of the premature stops in pBLH51 (l00ng/µl), the transformation marker pRF4 (40ng/µl) and 80ng/µl ofN2 genomic DNA (Pvull digested) as carrier. The lin-15A genomic clone, pBLH51, has a 330 bp deletion from the fifth exon in the lin-15B transcript. This construct is only able to rescue lin-15A mutant alleles not lin-15B mutant alleles (Huang et al. 1994). C-8 Construction of lin-15::GFP reporter The lin-15 promoter region (~559bp) was amplified with primers AS59 5' CTCCACCGCGGTGTCGACCGCTCTAGAAC 3' end AS60 5' GCGTTTGCATAGGTACCTGAAAATA 3' flanked with restriction sites, SalI/Kpnl, using PCR. The PCR product was digested and then ligated into a promoterless GFP reporter vector, pPD95-81, which contains a C.elegans unc-54 3' end and a fluorescence enhancing S65C mutation (A. Fire, personal communication). The lin-15: :GFP construct was injected into the hermaphrodite's gonads of unc- J J9(ed4). The injection mixture consisted of 100ng/µl of lin-15::GFP, 40ng/µl of unc119(+) DNA and 80ng/µl ofN2 genomic DNA (Pvull digested) as carrier. 12 rescued lines were isolated after germline transformation of unc- l l 9(ed4) (Maduro and Pilgrim 199 5). The transformed animals from the 12 rescued lines were viewed under fluorescence. Localized expression of lin-15A The native promoter of lin-l 5A genomic DNA was placed under the transcriptional control of the vit-2 promoter (Spieth et al. 1988; Spieth et al. 1991) and the col-IO promoter (Lu and Horvitz 1998) and the LIN-31 promoter [Miller, 1996; Eisenmann, 1994; Miller, 1993]. Each construct was co-injected at a concentration of 100ng/µl) with pRF 4 (rol-6(sul 006) mutant gene) at a concentration C-9 40ng/µl) (Mello eta!. 1991) into the lin-15 null allele el 763. 3 stable Rol-Muv transgenic lines were isolated after vit-2: :lin-l 5Agenomic germline transformation. two stable Rol-nonMuv transgenic lines were isolated after col-10::lin-15A genomic germline transformation. Two stable Rol-nonMuv as well as 3 non-Rol nonMuv transgenic lines were isolated after lin-31:: lin-l 5Agenomic germline transformation. Germline-mediated transformation by microinjection Microinjection was performed according to Mello et al. (Mello et al. 1991) which was modified from Fire (Fire 1986). Young adult hermaphrodites were placed live on pads of 2% agarose under an inverted differential contrast-interference (Nomarski) microscope (Carl Zeiss, Oberkochen, West Germany) and the DNA was injected into the gonad using an Eppendorf micro injector 5242 (Eppendorf Gertebau N etheler, Hamburg, West Germany). For the lin-l 5A and B mosaics, the plasmid containing the lin-l 5A ( +) or linl 5B(+) DNA, depending on the mosaic, was also used as the transformation marker at a concentration of 100ng/µl. Also, included in the injection mixtures of both mosaics are: 256 repeat lacO (50ng/µl) , ncl-1 (+) (50ng/µl) and pBluescript II SK+ (Stratagene) (5 ng/µl). The mixtures were injected into the gonads of syls46; ncl-1 (el 865) ,· dpy20(el 282) ,· lin-l 5(el 763) . The transgenic lines obtained from each experiment were heat-shocked for 30 minutes at 33°C to elicit GFP-Lacl expression. Expression of the GFP-Lacl can be seen as early as 30 minutes after heat-shock, and as late as 24 hours. C-10 Mosaic analyses Mosaic animals of lin-l 5A gene function and lin-l 5B gene function are obtained from a somatic loss of an extrachromosomal array syEx2 73 [lin-l 5A(+) + lacO + C33C3] and syEx2 72 [lin-l 5B(+)+ lacO + C33C3] from sy]s46,· ncl-1 (el 865),· dpy-20(el 282),· lin-15(el 763). C33C3 is the rescuing cosmid for ncl-1. The point of loss is determined by the absence of the fluorescent spot as well as enlarged nucleoli. We used L3-L4 Muv animals for mosaic analysis that ensures that lin-l 5(el 763) is homozygous. The nuclei observed to identify mosaic animals are: pharyngeal cells: m2L, m3L, m3VL, m4R, m3R, m3VR, m3DL, m3DR, pharyngo-intestinal valve cells, hyp7; Tail cells: hyp7, F, U; VPCs (Pn.p cells); and intestines (Refer to Figures 3 and 4 for lineage). Mosaic analysis of lin-l 5B gene function was also done with SUR-5GFP(NLS) as the mosaic marker (Yochem et al. 1998). Mosaic animals are obtained from a somatic loss of an extrachromosomal array syEx316 [lin-l 5B(+) + lacO + sur-5GFP(NLS) + C33C3] from sy]s46,· ncl-1 (el 865),· dpy-20(el 282,· lin-l 5(el 763) (Table 1, Chapter 2). The nuclei observed are the same as the previous mosaic (Figure 5). Microscopy Animals were anesthetized with 2mM levamisole on 5% Noble agar pads. The fluorescence was viewed with the Zeiss Axioplan with Chroma High Q GFP LP filter set (absorption band 450nm and 505nm emission) at 100X optics. The animals were placed live in 3 microliters of S basal+ cholesterol on 5% Noble agar pads (Wood 1985). C-11 Results lin-15::GFP reporter is expressed broadly We observe expression of GFP driven by the lin-15 promoter in all cells except in the gonadal cells in L 1 and L2 stage animals. In the later larval stages as well as in adult, the germline cells do not express GFP. There is embryonic expression as early as "comma"- stage embryo (400min after fertilization) (Figure2). lin-1 SA Mosaics We crossed the lin-15 null allele (el 763) into the PS2958 strain to create PS3048, and then injected the mosaic markers, ncl-1 (+) + lacO, and lin-l 5A(+). We checked for fluorescent spots as well as nucleolar size in the nucleus of the cells scored. A fluorescent spot and/or normal nucleolar size indicates the presence of the lin-l 5A gene. We observed by Nomarski and fluorescence microscopy, 120 non-Muv animals and 52 Muv animals. The mosaic non-Muv (n=5) animals lose both of the mosaic markers (i.e., GFP and Ncl-1) in every lineage except those leading to the VPCs. In mosaic Muv animals (n=8), the mosaic markers are present in every lineage except the VPCs (i.e., AM2.5 and AM3.24) (Figure 3). Figure 3 shows the key mosaic animals (n=13) that indicate that lin-l 5A has a site of action in the VPCs. Of the 5 non-Muv animals, the VPCs P3.p, P4.p and P8.p are ncl1 (-) and lacO(-) raising the possibility of local non-autonomy. The Muv animal, AM3.19, had the array present, according to the lacO marker, at P3p, therefore further C-12 supporting local non-autonomy of lin-15A among the VPCs. According to Figure 3, F and U cells might be another site for lin-15A. The other 159 animals scored do not support the pattern of lin-15A function at F and U (data not shown). We conclude that lin-15A function is required in the VPCs to rescue the Muv phenotype. lin-15B Mosaics lin-l 5B mosaics were done in a similar manner as with lin-l 5A except that the rescuing DNA was lin-l 5B(+). We observed 37 animals using Nomarski optics and fluorescence microscopy. Out of 37 animals, 3 were non-Muv. Figure 4A and B show no obvious pattern of lin-15B function. These results are suggesting that lin-l 5B is needed broadly for proper function (i.e. , hypodermis) or perdurance of the protein skew the site of action since we were not able to determine in the cell lineage where lin-15B(+) is needed to rescue the multivulva phenotype. We also performed the lin-l 5B mosaics using SUR-5GFP(NLS) as the mosaic marker (Yochem et al. 1998). The differences between the latter mosaic versus this mosaic with SUR-5GFP(NLS) are: the stability of the transgenic line syls46;syEx272 which is 30-40%, compared to the stability of the transgenic line syls46;syEx316 is 80-90%. We scored only Muv animals that expressed SUR-5GFP in order to eliminate foci that do not require lin-l 5B gene expression for multivulva rescue. Of the12 animals observed by Nomarski and fluorescence microscopy, 5 were non-Muv and 7 were Muv. Animal WT.5 and M3.6 indicate that P3.p, P4.p and P8.p do C-13 not require lin-l 5B gene expression for rescue. We observed fluorescing hyp7 nuclei around the vulva in animal WT.6 (data not shown). In Muv animals, it was difficult to determine which are hyp7 nuclei around the vulva nonetheless if it fluoresces or Ncl. It is possible that the maternal effect of lin-15 B may be affecting the determination of the focus of action of lin-l 5B when examined by mosaic analysis (Figures 4 and 5). Molecular determination of lin-1 SA lesion We used PCR to amplify lin-15 DNA from mutant synMuv class A alleles to determine the sequence changes in these strains. lin-l 5(syl97) has a splice-site point mutation (base addition) at the splice acceptor of the fifth exon in the A transcript resulting in a frame-shift. We were able to determine the molecular lesion of the lin-l 5B allele n744 because it was in the background of two lin-l 5A alleles we sequenced: linl 5(n744B, sy21 l) and lin-l 5(n744B, sy212). lin-l 5(n744) has a transition mutation, (C~T) resulting in a missense mutation of the amino acid, S124F. lin-15(sy21 l) has a transition mutation (G~A) at the splice acceptor of exon 5 in the A transcript. linJ5 (sy2 l 2) has a transition mutation, (C~T) resulting in a nonsense mutation, Ql 16Amber (Table 1). In order to determine how much of the lin-l 5A gene is needed to rescue the Muv phenotype of lin-15 null allele, we placed an amber codon at the end of the fourth and fifth exon as well as an amber codon in the middle of the sixth exon (Table 2). The !in- C-14 15A truncation, 5ATAG, is sufficient to rescue the Muv phenotype. 4ATAG and 6ATAG did not rescue the Muv phenotype. The transgenic lines obtained from the 4ATAG injection did not remain stable. An array containing 4ATAG DNA may be lethal since there were dead L 1 larvae and unhatched eggs on the plate level. lin-15A localize expression to tissues in hermaphrodites In order to confirm LIN-15A protein activity is needed in the VPCs for Muv rescue of a lin-15 null allele, we drove lin-l 5A gene expression with tissue specific promoters. lin-l 5A expression is localized to the intestines (vit-2 promoter) (Spieth et al. 1988; Spieth et al. 1991), the Pn.p cells (lin-31 promoter) (Miller et al. 1993; Miller et al. 1996) and hypodermis and Pn.p cells (col-JO promoter) (Lu and Horvitz 1998). Each promoter drive the expression of a promoterless lin-l 5A genomic DNA since linJ5A cDNA does not rescue the Muv phenotype of lin-15 mutant alleles. I have viewed many transformed animals after the germline transformation for each tissue-specific construct. The 3 transgenic lines of the vit-2::lin-l 5A genomic were transmitting Rol animals that were Muv. The 2 transgenic lines of the col-JO::lin-15Agenomic were transmitting roller non-Muv animals. The 5 transgenic lines of the lin-31::lin-l 5A genomic were transmitting either roller non-Muv or only non-Muv animals, never roller Muv animals. Of the three constructs injected into the gonads of the null lin-l 5(el 763) allele hermaphrodites, col-I 0:: lin-l 5Agenomic and lin-31:: lin-15A genomic C-15 rescued the Muv phenotype. vit-2::lin-l 5Agenomic did not rescue the Muv phenotype. Since the col-I 0:: lin-l 5Agenomic and lin-31 :: lin-l 5Agenomic rescue the Muv phenotype, we conclude lin-l 5A expression at the VPCs is sufficient to rescue the lin15 (-) phenotype (Figure 6). Discussion Previous mosaics suggested the lin-15 locus act non-autonomous. Herman and Hedgecock hypothesized that there is a negative signal sent by the product of the lin-15 locus is from the hypodermis preventing vulval differentiation (Herman and Hedgecock 1990). It was then determined that the lin-15 locus encodes two uni-directional transcripts. The two proteins that it encodes are not similar to any currently identified proteins and contain no significant homology with known protein motifs (Clark et al. 1994; Huang et al. 1994). We performed genetic mosaic analysis with lin-l 5A and linl 5B genes using 2 mosaic markers, ncl-1 and GFP::Lacl + lacO. We determine the site of action for lin-l 5A gene expression is at the VPCs (i.e. , autonomous) while the lin-l 5B remains unclear due to maternal effect or it may act at the hypodermis. Site of action of lin-1 SA Figure 3 shows the key mosaic animals (n=13) that indicate that lin-l 5A has a site of action in the VPCs. We conclude that lin-l 5A function is required in the VPCs to rescue the Muv phenotype. This result is in contrast to previous lin-15 mosaics done by Herman and Hedgecock (1990), which suggested lin-15 acts within the hypodermis. C-16 They concluded it had a hypodermal focus because loss of the array, which contained osm-J (+), unc-3(+), and sup-JO(+) in every cell lineage no matter if the animal was Muv or non-Muv (Herman and Hedgecock 1990). They scored mosaicism by whole animal phenotype unlike our cell-by-cell method. In order to confirm LIN-l 5A protein activity is needed in the VPCs for Muv rescue of a lin-J 5 null allele, we drove lin-J 5A gene expression with tissue specific promoters. lin-J 5A expression is localized to the intestines (vit-2 promoter) (Spieth et al. 1988 ; Spieth et al. 1991 ), the Pn.p cells (lin-3 J promoter) (Eisenmann and Kim 1994; Miller et al. 1993; Miller et al. 1996) and hypodermis and Pn.p cells (col-JO promoter) (Lu and Horvitz 1998) (Figure 6). Since the col-I 0: :lin-J 5Agenomic and lin-3 J:: lin- J5Agenomic rescues the Muv phenotype but vit-2:: lin-J 5Agenomic do not rescue the Muv phenotype, we conclude lin-J 5A expression at the VPCs is sufficient to rescue the lin-J 5(-) phenotype. This result further supports the hypothesis that lin-J 5A acts in the VPCs to negatively regulate the vulval induction pathway preventing P3.p, P4.p and P8.p adopting either 1° or 2° vulval fate. Synthetic multivulva genes Synthetic multi vulva (synMuv) genes encode negative regulators of vulval induction (Clark et al. 1994; Ferguson and Horvitz 1989; Horvitz and Sulston 1980; Huang et al. 1994). In the absence of synMuv activity, P3.p, P4.p, and P8.p generate vulval cells. As mentioned previously, the Muv phenotype is the result of mutations in each class, referred to as A and B, which represent two functionally redundant pathways. C-17 There are four class A genes (lin-8, lin-l 5A , lin-38, and lin-56) and ten B class genes (lin9, lin-l 5B, lin-35 , lin-36, lin-3 7, lin-51 , lin-52, lin-53, lin-54, and lin-55) (Ferguson and Horvitz 1989; Horvitz and Sulston 1980; Lu and Horvitz 1998). lin-36, lin-l 5A and linl 5B each encode novel proteins. lin-35 encodes a protein related to Rb, and lin-53 encodes a protein similar to the Rb-binding protein, p48 (Lu and Horvitz 1998). So far, all proteins examined are nuclear proteins [Lu, 1998; Huang, DeModena, and Sternberg, unpublished observations). Based on mosaic analysis, the B class gene lin-37 acts cell non-autonomously, possibly in the hyp 7 hypodermis (Hedgecock and Herman 1995) while the B class gene lin-36 acts cell autonomously in the VPCs cells (Thomas and Horvitz 1999). Lu and Horvitz ( 1998) argue that synMuv gene activity acts in the VPCs from the results of triple mutants carrying either lin-35 or lin-53 mutation. They also hypothesize that LIN-35 and LIN-53 act cell autonomously due to localization of the 2 proteins in P(3-8).p cells as detected by the antibody and a GFP trans gene, respectively. As a result of our data, we hypothesize class A synMuv function in the Pn.p cells. Protein interaction mapping by yeast two-hybrid reveal interaction sequence tags clusters for synMuv gene products (Walhout et al., 2000). The informative clusters are: LIN-53/LIN-37/LIN-36/EGR1/LIN-53; LIN-36/LIN-15A/LIN-33 and LIN-35 (pRB)/ LIN-53 (RbAp48)/HAD-1/LIN35 (Walhout et al. 2000). Also, RNA-mediated interference (RN Ai) experiments to further study the function of egr-1 brought the possibility of the recruitment of a nucleosome remodeling and histone deacetylase (NURD) complex by both synMuv pathways to repress vulval development target genes by local histone deacety lation C-18 [Solari, 2000; Solari, 1999]. The information obtained about the potential protein interaction of the synMuv genes from the IS Ts clusters plus C.elegans gene homologues to the NURD complex, mosaic data and protein localization, may lay the foundation of a synMuv class B complex (similar to Rb pathway) and the synMuv class A pathway activities are initiating or maintaining the NURD complex to alter chromatin structure of vulval development genes to antagonize the Ras-mediated vulva! induction (Figure 7). The different foci of action for lin- l 5A and lin-15B are puzzling since they are expressed as part of an operon (Clark et al. 1994; Huang et al. 1994). Antibody studies of LIN-15A and LIN-15B proteins are broadly expressed and nuclear (L. Huang, J. DeModena and P. Sternberg, personal com.). GFP driven by the lin-15 promoter further show expression in all cells except early germline (Figure 2). It is possible that the differential requirement for A and B is quantitative. For example, both proteins might act in all cells, non-autonomously, but there is a greater requirement for lin-l 5A function at the VPCs than in nearby cells. Another possibility is that the different functions respond differently to mosaic analysis: greater perdurance of B than A could also lead to different apparent foci of action. C-19 Figure 1. Model for vulval induction This pathway summarizes the work of many people (as referenced in Moghal et al. 1999; Sternberg et al. 1993). The inductive signaling EGF lin-3 growth factor i i EG F Receptor Tyrosine Kinase let-341 Sos let-23 Grb-2 SH3-SH2-SH3 "adaptor" sem-5 i i let-60 ras lin-45 raf-1 serine/threonine kinase MEK 2 537 mek- /let(MAP kinase kinase) synMuv A and B genes activity i i ✓ /\\ sur-1/mpk-1 MAPK/ERK lin-25 sur-2 lin-31 lin-1 >\ ✓< Vulval Differentiation Epidermal Differentiation C-20 Figure 2. lin-15::GFP expression pattern In a unc-119(ed4) background, there is a broad fluorescent pattern of GFP indicating where the lin-15 promoter drives expression. The GFP fluorescence is not nuclear. A. Embryos approximately 400 minutes after fertilization. B. L 1 larvae. C. Mid-L4 hermaphrodite with the VPCs and the utse tissue fluorescing. Anterior is right; dorsal is up. D. Spermatheca. E. Intestines. Photomicrographs taken using N omarski optics at 100X. C-21 C-22 Figure 3. Mosaic Analysis of the lin-15A gene with the GFP-Lacl + lacO and ncl-1 Mosaic analysis of lin-l 5(el 763) reveals that the wild-type lin-l 5A gene is required in the VPCs for normal negative regulation of the lin-3/let-23 pathway. The data shown are the key mosaic animals from the 172 animals viewed that indicate the lin- l 5A focus of action. L3-L4 Muv and non-Muv animals were examined. +: GFP-LacI bound to the lacO, fluorescent spot; -: no fluorescence, W: normal nucleolus size and N: enlarged nucleolus. Letters correspond to vulval status: AW: normal vulva; AM2. #: Muv animal with 2 pseudovulvae; AM3. #: Muv animal with 3 pseudovulvae; AM4.#: Muv animal with 4 pseudovulvae. The numbers in the Pn.p column indicates the number of nuclei with the bright fluorescent spot or ncl-1(+/-). Under the "ventral tail; head hyp7" heading, "T" stands for tail while "H" stands for head. C-23 ZyJote I J1 AB p. . I I Phar/lnt est ~ MS ,L, ~ m2L m1Vlm3L Worm m2 W2 W4 ? W4 N4 +2 '-vPc/ N N W4 W4 -4 +4 + + AM3.19 AM 3.20 AM3 .2 N4 N W4 N N4 N w ? VW2W N N N -4 -4 + + + AM3 .2,7,20 AM3 .19 AM3.2 4 AM4.9 AM4.9 w V+2 + N4 -4 N m3DL? m3DR lntest. 'b Body Muscle ? FU Excr.cell m3VR hl£(27 F U P312 P4e N2 WWW W2 w WWW W2 w N2 W2 w W2 WWW W WN N2 w N2 W2 WI N N N w + + +2 + -2 -2 -2 +2 + +2 + + + + + -2 + -2 +2 +2 + + - AM2.2 AM2.5 AM2.2 AM2.5 AM3 .7 ABplpp ABplpa hyp7 m3 vl ? +4 -4 AM3.24 7 m3L m3VL m4 m3R W6 N w w w w N6 w ws w N N w w N6 w W6 N N N ;t i + + + + -6 + +5 + + + -6 + +6 + AW11 AW43 AW63 AW70 AWSO AW11 AW43 AW63 AW70 AWSO -4 hyp A35) E ~ ABprap ABplap m3R m3VR ABa p J2 EMSI ABa N w w w N N6 N W6 W -6 +6 + w + W6 N N6 N W6 N W4 W W6 N +3 +3 +S N N N W4 N +4 N w N NI W2 -2 +2 N NN N NN NW NN N N NN NN + N NN P/1 m3DL m3DR Int hl£Q7 N N "N" N ? N N ? N W8 ?8 W8 W8 W8 +8 +4 +8 +8 +8 W7 ?7 W7 W4 W7 +7 -7 -7 +3 -7 W2 WI W2 W2 N2 +2 +I +2 +I +2 N T:N2H:N2 N T :N2H:W2 W T:W2H:W2 W T :W2H:N2 N T:W2H:W2 T:-2 H:-2 T :-2 H:+2 + T:+2H:+2 + T:-2H:-2 T:+2H:+2 N2 N• -2 N• N7 N8 NS -8 -8 N7 N7 -7 -7 N• N• N• N* N• N• Nu N• N• N* N• N8 N* N* N* N* N• N N N N N w w N N N N N N w w w N N w w -8 N7 N7 N7 N7 N7 -7 -7 -7 w w ... N7 N7 N7 N7 N7 -7 -7 -7 + + + + + + + + + + + + N2 -2 N** NS -8 N7 -7 N** W T:W2H:W2 w w + T:-2 H:+2 + + w ? + +2 -7 W2 N N2 N W2 N N2 N "W2" N +2 +2 +2 W2 +2 PS[! PSe P712 PB12 B hl£127 W7 ?7 W7 W4 W7 +7 -7 -7 +3 -7 ... w w w w N w N N N N w + + + + + + N T :N2 H:N2 N N N T :W2 H:W2 w w T :-2H:-2 T:-2 H:+2 + + N T :N2H:N2 T:N2H:N2 T:N2H:W2 T :N2H:N2 T:N2H:W2 T:-2H:-2 T:-2H:-2 T:-2 H:+2 N +4 +S + + + + + N N w + + w N N + + N C-24 Figure 4. Tissue specific promoters localizing lin-15A expression lin-15A expression is driven by tissue specific promoters in order to determine which tissue expressing Iin-15A is sufficient to rescue the muv phenotype of the /in-15 null. lin-15A expression is localized to the intestines (vit-2 promoter), the Pn.p cells (lin31 promoter) and hypodermis and Pn.p cells (col-JO promoter). Each construct was injected into lin-l 5(el 763) animal. The cross section of a hermaphrodite reveal the relative distance of the intestines, gonad and hypodermis to the Pn.p cells. Localized expression of lin-15A Promoter Expression pattern col-10 hypodermis and Pn.p cells Rescue Muv # transgenic # transformed phenotype lines animals viewed YES 2 Many vit-2 intestines NO 3 Many lin-31 Pn.p cells YES 5 Many C-25 Figure SA and B. Mosaic Analysis of the lin-1 SB gene with GFP-Lacl + lacO and ncl-1 Mosaic analysis of lin-l 5(el 763) animal's reveal that the wild-type lin-l 5B gene may be required ubiquitously for normal negative regulation of the lin-3/let-23 pathway. The data shown below are the key mosaic animals from the 37 animals viewed that determined lin-l 5B foci of action. L3-L4 Muv and non-Muv animals were examined.+: GFP-Lacl bound to the lacO, fluorescent spot; -: no fluorescence, W: normal nucleolus size and N: enlarged nucleolus. Letters correspond to vulva! status: BW: normal vulva; BMl. #: Muv animal with 1 pseudovulvae; BM2. #: Muv animal with 2 pseudovulvae; BM3. #: Muv animal with 3 pseudovulvae; BM4. #: Muv animal with 4 pseudovulvae. The numbers in the Pn.p column indicates the number of nuclei with the bound fusion protein/spot or ncl-1(+/-). Under "ventral tail; head hyp7" heading, T: tail while H: head. C-26 Zyf°te I I I P1 AB p~, Phar/lntest ~ m2L m3R m3VR hyp 7 ABplpa Excr. cell m3vL 0 ABprap "' ABplpp FU VPCs / m3DL? m3DR ? I J2 ~ C P.3 E ,~YCl1. 7 f MS ,.L, ABalpa ? aJ-, hyp10 A~p ~Ba m~~~re ? ABprppp BY m1VLm3L Worm BW.1 BW.2 BW.3 BM1.1 BM1.2 BM1.3 BM1 .4 BM1.5 BM1 .6 BM1 .7 BM1 .8 BM2.1 BM2.2 BM2.3 BM2.4 BM2.5 BM2.6 BM2.7 BM2.8 BM2.9 BM2.10 BM2.11 BM3.1 BM3.2 BM3.3 BM3.4 BM3.5 BM3.6 BM3.7 BM3.B BM3.9 BM3.10 BMJ.11 BM3.12 BMJ.13 BM4.1 BM4.2 m2 +4 +2 +4 +4 ?4 +4 +4 +2 +4 +4 +4 +4 +4 +2 +4 -4 +4 +3 +2 +4 +4 +4 +2 +2 +2 ?4 -4 -4 +1 -4 +4 +3 +4 +2 +4 +4 -4 m3L m3VL m4 m3R m3VR h;ie7 F U P3e P4e P5e PGe P7e PSe B +2 +2 +7 +8 +7 +2 + +6 + + + + + + + +2 +7 +8 +7 +2 + +2 +2 + + + +2 +7 +8 +7 +1 +2 + +6 + + + + + + +* +3 +3 +2 + +2 +4 + + +6 + + + + + -7 +2 + +4 + +2 + + + +7 +1 + + + +· +8 +7 +2 +7 +2 + +6 + + + + + + + +· +1 -7 +6 +2 + + + +6 + +2 + + + + +· +7 +8 +7 +2 + +2 + + +6 + + + + + +· +7 +8 +7 +6 + +2 +2 + + + + + + + +· +7 +8 +7 +2 + +6 + +2 + + + + + + +· +7 +8 +7 +2 + +6 + +2 + + + + + + +* +* +8 +7 +2 + + +2 + +6 + + + + +** +7 +8 +7 +2 + +6 + +2 + + + + + + +* +* +7 +8 +7 +6 + +2 + + + + + + + +* +8 +2 + + +6 + +4 + + +2 + - + -8 -7 +5 -2 +3 + + + +* +* +7 +8 +7 + +6 + +2 + + + + +* -7 +6 +2 +5 -7 + + +* -7 -7 -8 +6 -2 + + + + + +** +7 +7 +1 +8 -2 -6 + + + +* +7 +* +8 +7 +6 + +2 + + + + + + + +* +7 +8 +7 +2 + + + +6 + +2 + + + +* +** ?7 +* +5 + +2 ?8 ?7 + + + + + + +** +7 +* +8 +7 + +2 + + + + + ? +3 + +** +4 +* +8 -7 +2 + +3 + + + + - + +* +6 + +4 + +2 + + + + + + +3 +7 +** +1 +5 + -2 + + +3 + + +3 + + -8 -7 -2 -7 + -2 + +3 +* -7 -6 + +1 + +3 -7 + + +** -7 -8 -7 +6 +2 + + +** +7 +8 +7 +* +6 + + +2 + + + + +7 +8 +7 +* + + -2 +* +3 + + + +** +* +8 +7 +7 + +6 + -2 + + + + + * * +7 +7 +8 +2 + + + +6 +* +* +* +7 +8 +7 +2 + + + +3 + + +** +5 +8 + + +6 + -2 +3 +* + + + +* -7 -8 -7 -2 + -6 * -* - - . - - - - - . -. - . - -.. -. .. .. - - - . .. .. - - . . - h:z:e7 T:+2 H:+2 T:+2 H:+2 T:+2 H:+2 T:+1 H:+2 T:+2 H:+2 T:+2 H:+2 T:-2 H:+2 T:+2 H:+2 T:+2 H:+2 T:+2 H:+2 T:+2 H:+2 T:+2 H:+2 T:+2 H:+1 T:+2 H:+2 T:+2 H:+2 T:+2 H:+2 T:+2 H:+1 T:+2 H:+2 T:+1 H:-2 T:+1 H:-2 T:+2 H:+2 T:+2 H:+2 T:+2 H:+2 T:+2 H:+2 T:+1 H:+2 T:+2 H:+2 T:+2 H:+2 T:-2H:+1 T:+2H:+1 T:-2 H:+2 T:+1 H:+2 T:+1 H:+2 T:-2H:-2 T:-2 H:-2 T:+2 H:+2 T:+2 H:+1 T:-2 H:-2 h:z:e7 P/1 m3DL m3DR Int + + + + + +2 + + +5 + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +2 + + +4 +4 + + + + + + + + +2 +4 +2 ? + + + +2 +2 + + C-27 Zyrte I I h?-7 MS ,l-,m3R m3VR m2L m1VL m3L m3vL ABprap ABplap hyp 7 ABplpa Excr. cell ' ABplpp FU VPCs/ m2 m3L m3VL m4 m3R m3VR h)l:e7 F u P3e P4e PSe PGe P1e Pae s BW.1 BW.2 W4 N4 N W4 W4 ? N W4 W4 lil:~H a~la BM2.1 BM2.2 BM2.3 BM2.4 BM2.5 BM2.6 BM2.7 BM2.8 BM2.9 BM2.10 a~a lJ BM4.1 BM4.2 W4 w w N W2 W6 N N YY.. N6 N w w '!::1. "W' YY.. "W' W1 N2 W2 w WW w WW YY.. YY.. YY.. W2 W2 W2 W2 W2 w w w w w ~ ?* w w W2 w W4 w W4 w w w w w w YY..~ )1::1. )1::1. ~ )1::1. )1::1. '1:12. )1::1. )1::1. )1::1. N6 N N N2 N N w N w w W2 w w W4 w w W4 W4 N4 N W4 W4 N W2 N W4 N W4 N w w W4 N N N w w )1::1. )1::1. w N W2 + W2 "W' W2 + N4 + N4 + W4 + N4 + W4 + N4 + N4 + W4 + YY..~ + W4 w N4 N + "W' + + + + + w w w w w w W6 W6 W6 w w w w w w W2 W2 W2 w w w N6 N N N2 N W6 W6 N6 N6 W6 ~ N6 N4 w w N N N N N w W2 )1::1. '1:12. )1::1. )1::1.~ N w N N N2 N2 N N "W' "W' W2 w "N" W1 N2 W1 W1 N2 N N N N N w W6 W6 N N N w N N N N2 N2 w w w N N N N W2 W2 N2 N2 + + W6 w w YY.. w '1:12. W6 N6 N N N2 N2 N N )1::1. N6 N6 ~ w w w w w N6 N6 W2 W2 N ? WW WW WW N N WN N N W N* WW WW w w w W6 W6 W6 YY.. W2 W2 W2 w WW w WW w WW w WW w WW w WW w WW "N2" "W2" ws w W6 w W6 w W6 w W6 w W6 w ar.1z ll YY..~ BM3.1 BM3.2 BM3.3 BM3.4 BM3.5 BM3.6 BM3.7 BM3.8 BM3.9 BM3.10 BM3.11 BM3.12 w w w N w w N ? N ? N N N WW N N* N N N N WN N N WW WW w YY.. )1::1.~ W7 W7 W7 W7 W7 W7 WB WB WB WB WB WB N N* hii:e7 W7 W2 w T:W2 H:W2 W7 W2 N T:W2 H:N2 'l:Jl )tj]. YY.. r ·:tat:!":ta 'tJ:L ~ W* 1/'17 w 1/'17 w 1/'17 WB WB WB WB NB N* w N* N* w N7 1/'17 W3 N7 W* W7 W7 wa ws NB wa w WB ~ ?** N** N** N** 'tJ:L YY..a W7 wa N7 W4 W4 N6 WB WB WB NB NB NB WB NB NB W* 1/'17 N7 N7 W* N7 N** N** W* 1/'17 N** N** N7 N7 w 1/'17 W8 ~ 'tJ:L ~ N** N7 NB C P3 f 7 inl'e'ki. 7 Body Muscle ? P/1 m3DL m3DR Int h)l:e7 w w w w YY.. YY.. w T:"N2" H:N2 N N w T:W2H:W2 w w w T:W2H:W2 w N W2 W8 N7 W2 w T:?2 H:W2 w w W7 WB W7 W2 w T:W2H:W2 w w W2 W7 WB W7 w w T:W2H:W2 w w w W7 WB W7 W2 w T:W2H:W2 w w w WW W* 1/'17 WB N m3DL? m3DR ? E ABprppp BY Worm BM1.1 BM1.2 BM1.3 BM1.4 BM1.5 BM1.6 BM1.7 ~2 ~ Phar/lntestJ_, b· .--i..__.. ~ hyp10A~p A~a ABalpa · I I P1 AB W6 N2 W7 W2 W7 W2 'tJZ. '1:12. '1:1.. I·~t;1·li0.2 N T:"W2" H:N2 N T:N2H:W2 T:W2H:l/v'2 N T:W2H:l/v'2 N7 N* N T:W2H:W2 W7 T:W2H:l/v'2 1/'17 N T:N2 H:VV2 N7 N* N T:W2 H:N2 W7 W2 N T:W2H:N2 W7 N T:N2H:l/v'2 'tJZ. '1:12. '1:1.. 1·~t;1·l0&2 W7 N* N T:"W2" H:N2 N7 N* N T:N2 H:W1 N7 N T:W2H:W2 1/'17 N* N T:N2H:W2 W7 N* T:W2H:N2 N7 N* w T:N2H:W1 N7 N* N T:N2 H:W1 N7 ?* N T:N2 H:N2 1/'17 N T:W2H:W2 N7 N* N T:N2 H:N2 N7 N T:N2 H:N2 1/'17 T:W2H:W2 'tJ:L ~ )/:J. I·~z~-~ W7 N T:W2H:W1 N7 N* N T:N2H:N2 1/'17 N2 W7 N2 W7 w W7 N* w w w w w w w w w w w w )1::1. )1::1. w N YY.. ? N ? ? ? ? ? ? ? w N w w w w )1::1. ? N N ? ? ? ? ? ? ? ? ? ? w N w N w w w w w w N N N N N N N w w w N w w ? ? w N N N w YY.. )1::1. )1::1. ? N N N ? ? ? ? ? ? ? ? ? w N N w w w w w N N N N N N w w w w N N N N N w w N N YY.. w· w w w w w w )1::1. N ? w N N w N N N w )1::1. N N w N w N w N ? ? N w w N w ? ? N ? )/:J. )1::1. ? ? ? ? w N N N N )1::1. w w w N N N N C-28 Figure 6. Mosaic Analysis of the lin-15B gene done with SUR-SGFP and ncl-1 Mosaic analysis of lin-15(e1 763) animal's reveal that the wild-type lin-15B gene maybe required ubiquitously for normal negative regulation of the lin-3/let-23 pathway. The data shown below are the mosaic animals from the 12 animals viewed that determined lin-15B foci of action. Young adult Muv and L4 non-Muv animals were used for this study. S+: SUR-5GFP(NLS) bright fluorescence; S-: no bright fluorescence, W: normal nucleolus size and N: enlarged nucleolus. Letters correspond to vulval status: WT: normal vulva; Ml. #: Muv animal with I pseudovulvae; M2. #: Muv animal with 2 pseudovulvae; M3. #: Muv animal with 3 pseudovulvae. The numbers in the Pn.p column indicates the number of nuclei with the bound fusion protein/spot or ncl-1(+/-). Under "ventral tail; head hyp7" heading, T: tail while H: head. Animals WT. I to WT.4 and M3.1 to M3.3 were heat-shocked at 33°C for 30 minutes for further analysis. C-29 Zyrte I I Pl Ai I hyplO ABa ? m2Lm1Vlm3L EMS~ Phar/lnlest b•ar ABf'pa ~ I ABp MS ABplap .s3Rm3VR 7 hyp ABplpa Excr.cell ABplpp FU ABprap "---vPc/ ~ ~ ? m3DL ? ? m3DR E ~~ hyp lnlesl. D Body Muscle ? ABprppp BY m3vl worm m2 m3L m3VL hyp6 hyp7 m3VR m3R m4 Ex.Cell F U P3pP4p P 5p P6p P 7p P8pB hyp6 hyp7 m3DL m3DRP/I hyp7'Int WT.I W4W w w w w W6 N N? ? ? N w w ? WT.2 W4 W w WWW w w w w w N W2 W2 w W4 W2 w w W6 w N N WT.3 W4 W w W4 W2 w w W6 N N N? N? W7 N8 W6 W2WW2 WI w w w N WT.4 N4 N N N N? N? W7 W8 W7 w N ? N W2 N N N6 ? N N w N WT.5 W2W w W2 N2 w WW? ? N N2 W2 w w W6 N? w N w S+ S+S+ S+2 S+7 S-8 S+7 S+ S+ S+2 S+4 S+ WT.I S+4S+ S+ S+4 S+2 S+ S+ S+6 S+ S+ S+ S+ S+ S+ S- S+ S+2 S+7 S-8 S+7 S+ S- S+2 S+4 S+ WT.2 S+4S+ S+ S+4 S+2 S+ S+ S+6 S+ S+ S+ S- SS-8 ? S- S+2 S+2 S+ WT.3 S-4 SS+ S+4 S+2 S+ S+ S+6 S+ S- S-? ? S+ S+ SS+ WT.4 S+4 S+ S+ S+4 S+2 S+ S+ S+6 S+ S- S- S- S- S+7 S+8 S+7 S+ S- S+2 S+2 S+ S+ S+ SS+ WT.5 S+2 S+ S+ S+ S+S- S-2 S-7 S+8 S-7 S- S- S-2 S-2 S+ S+2 S-2 S+ S+ S+6 SS+ S+ S+ S+ M2.I N M2.1 SM3.1 M3.2 M3.3 M3.4 N S- N N N N W4W N N M3.5 W4W M3.6 W4W M3.1 S- SM3.2 M3.3 M3.4 M3.5 S- SS+4 SS- SS+4S+ M3.6 S+4 S+ N S- N S- N S- N N N N N N N N N N W2 w N w w N W4 W4 SSS+ S- SS+ S+ SS+4 S+4 SS- W2 SSSSS+2 S+2 N S- N S- N N W2 N S- S- S+ I S- N S- N S- N N S- S- NNN NNN N N N N N N N N N N N w w N N N N N2 W2 N N N N N* N N N* N N N* WN N* N N2 N* N W2 W*WW2 SSS- S-* S- SS-* S- SS-* S+ S- SSSS- N S- N N N N N N N N N N N W6 N N w w w w N N W6 N W6 W SS- SSS- S- SS- SS+6 S- S- S- SS- S- S- S-** SS-** S- S- SS+6 SS+6 S+ S- S- SS- S- S- S-** S- SS+ S-*" S- S- S- S-* S- SS- S- S- S-2* S-7 S-8 S-7 S-* S- S+2 S-2 S+S+ S+ S+2~S+5 S+2 S+3 S+* S+ S+2 S+2 SSS+ S+ S+ N S- NNN N>l<+N S- S- S- S-** S- N S- S- N** N N* * N NNN N**N NNN N** N NNN N** N WWW W**W SSS- N N N N N N w w w w w w S- S+ SS- SS+ SS- SS+ SS+ S+ w SSS+ SS+ S+ w SSSS+ S+ S- N N N N N SS+ S+ SS+ S+ C-30 Figure 7. Positive and negative regulation of vulva) induction: model A possible model for specifying Pn.p cell fate. The lack of LIN-3 protein result in no strong activity of the EGFR pathway allowing the 2 synMuv pathway in recruiting the NURD complex to halt VPC specifying genes from being expressed due to an alteration of its chromatin structure (i.e., P3p, P4.p and P8.p). If LIN-3 is secreted from the AC, then the target proteins of synMuv pathway A and B may be phosphorylated resulting in no recruitment of the NURD complex to repress vulval development genes (i.e., P7.p, P6.p and P5.p). Model for P(3-8).p Cell-Fate Decisions LIN-3(-) pathway LIN-3(+} pathway hyp7 .. Asyr~t • vulva cell e decisi vulva cell fate decision \ Nonvulval fate P(3,4,8}.p ---- Vulval development gene Vulval fate P{S,6,7).p /UN-35\ ~ EGR{M • cleus C-31 Table 1. Sequences of lin-15 mutations Uppercase letters signify exon sequences and the lowercase letters signify intron sequences. The C.elegans consensus splice acceptor site is wwtttcag/NNN, where Wis A or T, N is any nucleotide (Fields 1990). Amino acid substitutions are shown as wild-type residue identity, residue number, and predicted mutant residue. Allele Wild-type sequence Mutant sequence Substitution or splicesite change syl97 aatgttttaag/AGA aatgttt~taag/AGA Exon 5 acceptor in lin-l 5A transcript n744 TCT TIT S 124F in lin-15B transcript sy211 aatgttttaag/AGA aatgttttaaf!;'AG A Exon 5 acceptor in lin-15A transcript sy212 CAG IAG Q 116amber in lin-15A transcript C-32 Table 2. Truncation of LIN-15A protein The lin-15A genomic clone, pBLH51 (Huang et al. 1994), has 330 bp deleted from the fifth exon in the lin-15B transcript. This construct is only able to rescue lin-15A mutant alleles not lin-15B mutant alleles (Huang et al. 1994). An amber codon (TAG) is introduced at the end of exon 4 (pBLH51 :K304amber), exon 5(pBLH51 :S360amber), and in the middle of exon 6 (pBLH51 :G579amber) in the lin-15A transcript in order to truncate the LIN-ISA protein. Each construct was injected into lin-15 null hermaphrodites. SL 1 signifies SL 1 trans-splice leader and SL2 signifies SL2 trans-splice leader (Huang and Hirsh 1989). Asterisk denotes premature stop codon, TAG. SL1 Rescue Muv # lines Phenotype examined 4ATAG: K304amber No (lethal) 2(died) 5ATAG: S360amber Yes 11 6ATAG: G579amber No 2 Construct C-33 Appendix 1 Mosaic analysis of let-23 C-34 Abstract The C. elegans epidermal growth factor receptor homologue LET-23 has multiple functions during development. In order to determine where let-23 is required for vulval induction, mosaic analysis was performed. Mosaics determine its site of action at the VPCs for proper vulval development (Koga and Ohshima 1995b; Simske and Kim 1995). In order to test the efficacy of the GFP::LacI + lacO as a single cell marker, we perform mosaic analysis on let-23. The GFP::Lacl + lacO confirmed let-23 functions at the VPCs for proper vulval development. Introduction LET-23 protein LET-23 is the C. elegans homologue member of the epidermal growth factor receptor family (Aroian et al. 1990; Lesa and Sternberg 1997). The extracellular portion of LET-23 contains two ligand-binding domains and two cysteine-rich domains. The cytoplasmic region contains a tyrosine kinase domain and a carboxyl-terminal tail. The tail has tyrosines which defines eight putative SH2-binding sites which specifies multiple functions: viability, vulval differentiation, and fertility (Aroian et al. 1990; Aroian et al. 1994; Aroian and Sternberg 1991; Lesa and Sternberg 1997). Mosaic analysis indicates let-23 act cell autonomously in the VPCs to promote vulval differentiation (Koga and Ohshima 1995b; Simske and Kim 1995) while mosaic analysis for viability indicates let23' s site the action is at the excretory cell (Koga and Ohshima 1995b). let-23 may also C-35 function in the gonad for fertility since mutations in let-23 results in defects in ovulation (Lesa and Sternberg 1997). We use the GFP::LacI + lacO system in order to verify its accuracy as a mosaic marker by confirming let-23 site of action for vulval differentiation is at the VPCs. We also indirectly determined the site of lethality of let-23(syl7) to be in the ABala lineage. MATERIALS AND METHODS Nematode methods: Growth and handling of C. elegans strain N2 were according to Brenner, 1974 and Sulston and Hodgkin (1988). All experiments were performed at about 20°C unless otherwise stated. The genetic and cellular nomenclature of C. elegans was followed according to (Horvitz et al. 1979; Sulston et al. 1983), respectively. GFP-Lacl fusion plus 256 lacO repeat: The GFP-Lacl fusion protein plus the lacO repeat (Robinett et al. 1996; Straight et al. 1996; Webb et al. 1995) was graciously given to us by Dr. Andrew Belmont. We placed GFP-LacI under the transcriptional control of an hsp16 promoter/enhancer element pPD49-78 (Fire and Xu 1995; Mello and Fire 1995; Perry et al. 1993). The fusion protein was inserted into KpnI/SacI site of heat shock vector pPD49-78. pPD49-78 is expressed very well in the neural and hypodermal cells, as well as in the gut, muscles, and pharynx but not in the germline (Fire and Xu 1995; Mello and Fire 1995; Perry et al. 1993). C-36 Germline-mediated transformation by microinjection For the let-23 mosaics, the plasmid pMH86, containing the dpy-20(+) gene, was used as a transformation marker at a concentration of 15ng/µl (Han and Sternberg 1991)). Also, included in this injection mixture for the mosaic analysis of let-23 are: pPD49-78 GFP-LacI (l00ng/µl), 256 repeat lacO array (50ng/µl) let-23 genomic DNA pk7-13.8 (50ng/µl) (Aroian et al. 1990) and pBluescript II SK+ (Stratagene) as carrier DNA (5ng/µl). syEx214 was created from this mixture injected into let-23(syl 7) unc4(el 20)/mnCJ; dpy-20 gonads to yield PS2642. The transgenic lines obtained from each experiment were heat-shocked for 30 minutes at 33°C to elicit GFP-LacI expression. Expression of the GFP-Lacl can be seen as early as 30 minutes after heat-shock, and as late as 24 hours. Mosaic analyses Mosaic analysis of let-23 gene function in vulval induction (Koga and Ohshima, 1995) was repeated to test the reliability of the GFP-Lacl plus lacO as a mosaic marker. Mosaic animals are obtained spontaneously from a somatic loss of an extrachromosomal array syEx214 [let-23(+) + dpy-20(+) + pPD49-78::GFP-LacI + lacO] from let-23(syl7) unc-4/ mnCJ ; dpy-20 parents. The point of loss was determined by the absence of fluorescent spots. We used L3-L4 Unc worms for mosaic analysis that ensures that let23 (syl 7) is homozygous. The nuclei observed to identify mosaic animals are: pharyngeal C-37 cells: m2L, ml VL, m3L, m3VL, m4R, m3R, m3VR, m3DL, m3DR, pharyngointestinal valve cells, excretory cell; Tail cells: hyp8, hyp9, F, U, B, Y; VPCs (Pn.p cells); intestines; body wall muscles derived from D. (Refer to Figure 1 for lineage). Results let- 23 site of action To test the use of GFP-Lacl + lacO as a mosaic marker, we repeated mosaics with let-23 that was done with ncl-1 (Koga and Ohshima 1995b). Then as described below, we tested it with new mosaic analysis. The strain PS 1484 includes a null allele of let-23 linked to a recessive unc-4 mutation balanced by mnCJ[dpy-1 0(el 28) unc-52(e444)], and dpy-20 as a transformation recipient marker. Homozygous let-23 (null) animals die as young larvae (Aroian and Sternberg 1991; Ferguson and Horvitz 1985; Sigurdson et al. 1986) while mnCJ/mnCJ worms are immobile, and semisterile (Herman 1978). This strain was used to repeat the mosaic analysis of Koga and Ohshima, (1995) and Simske and Kim, (1995) using the GFP-Lacl + lacO repeat as the mosaic marker instead of ncl1 (+). The DNA mixture for injection consists of the let-23 genomic clone, pk7-13.8, pPD49-78 GFP-Lacl + lacO and the injection transformation marker pMH86. Mosaic analysis using ncl-1 as the marker revealed that let-23(+) gene function is required in a vulval precursor cell to adopt the 1° vulval fate (Koga and Ohshima 1995b; Simske and Kim 1995). We examined a total of 53 let-23(syl 7) unc-4 animals, all of C-38 which were mosaic (Figure 1). Of these, 33 had complete vulvae, eight had incomplete vulvae, eleven were vulvaless, and one was multivulva. The 33 animals with complete vulva and the multivulva animal had partial or total loss in the ABalpa, ABar, ABplpa, ABplpp, MS , C and D lineages, indicating that complete vulval differentiation is not dependent on these foci. In contrast, the VPCs consistently had the array present, especially P6.p. The marked exception, animal B 11.3, has a complete vulva but there was no detectable expression of GFP-Lacl + lacO in the ABp lineage: this is either due to perdurance of let-23(+) or is a false negative. For the 11 vulvaless animals, they had partial or total loss in the ABalpa, ABar, ABplpa, ABplpp, MS, C and D but the VPCs had no array present (no spot:-), especially P6.p. let-23 is required for vulval induction in the ABp lineage, more specifically for the Pn.p cells (Figure 1) (Koga and Ohshima 1995b; Simske and Kim 1995). The incomplete vulva animals' VPC mosaicism was not analyzed because it was not vital for determining the effectiveness of the GFP-Lacl + lacO technique. Homozygous let-23 null alleles (mn23 and syl7) die as Ll larvae (Aroian and Sternberg 1991; Herman 1978; Koga and Ohshima 1995a). Mosaic analysis of let-23 gene function for animal survival was previously determined in a mn23 background. This study revealed somatic loss of the array was extremely rare in 2 lineages, AB al (except ABalpa) and ABplp (Koga and Ohshima, 1995). In a let-23(sy97) reduction of function background, mosaics in the AB-AB.p-AB.pl lineages were as rare as in the mn23 background. The let-23(sy97) focus oflethality is in the ABplp but not ABal C-39 (Koga and Ohshima, 1995). Vulvaless and lethal phenotypes resulting from the sem-5 and let-60 mutations are similar to the let-23 mutations. Genetic epistasis tests using let60 and let-23 gain of function alleles show that the 3 genes act in a common (Beitel et al. 1990; Clark et al. 1992; Han and Sternberg 1990; Katz et al. 1996; Lesa and Sternberg 1997). Since let-23 stimulates viability and vulval differentiation via SEM-5 and LET60, we indirectly scored. In the let-23(syl 7) null background, no "all+" or "all-" animals were observed. We can definitely conclude that the foci of lethality of let23 (sy J 7) is not in the ABplp lineage and ABalpa because 30/53 animals lost the array at the ABplp lineage (cells scored excretory cell, hyp8, hyp9, F and U) therefore inconsistent with sy97 foci of lethality. We cannot conclude anything about the ABal lineage (except ABalpa) since it was not scored with our technique. We believe the focus of viability is in the ABala lineage since it derives neurons, especially the vital neurons CANL and CANR for animal survival. (Chalfie and White, 1988; and Koga and Ohshima, 1995). Discussion let- 23 site of action Koga and Ohshima (1995) carried out mosaic analysis of let-23 using ncl-1 and found a focus in the VPCs. We repeated the let-23 mosaics using GFP-Lacl + lacO. Overall, GFP-Lacl + lacO mosaic data are consistent with a focus of the Vul rescue be let-23 in the VPCs. However, animal N. 7 (Figure 1) contain no fluorescent spots but the presence of let-23 (+) since the animal has a wild-type vulva. Another possibility for this C-40 animal's lack of fluorescence is fading of the GFP. Conservatively, this method unambiguously indicates which cells have an array present. C-41 Figure 1. Mosaic analysis of the let-23 gene re-done with GFP-Lacl + lacO as the marker a) Mosaic analysis of let-23 (syl 7) animals using GFP-LacI + lacO as the marker, reveal that the wild-type let-23 gene is required in the ABp lineage for normal vulval induction. Also, the locus of lethality is found in ABalp and ABplp lineages. L3-L4 Unc animals (n=53) were used for this study. +: GFP-LacI bound to the lacO, fluorescent spot; -: no fluorescence; H: only GFP-LacI present, presumably the array is lost; ND: not determined; F= fading; " ": cannot positively identify the cell but can determine if H, +, or-. Letters correspond to vulval status: V.1 to V.32= complete vulva; MV.1 = multivulva; IV. I to IV.8 = incomplete vulva; V.3 to V.12 = vulvaless. The numbers in the Pn.p column indicates the number of nuclei with the bound fusion protein or spot. C-42 b ? MS ABplap \ hyp7ABplpa F,7-, ABprap m3R m3VR.----~-- r ,_..I__, m2L m1Vlm3L L Phar/lnte~ ar ,-l--, ABalPa I I hyp1 OA p / AF Buplpp m3DL? m3DR ? VPCs E C ln~lf? ? ~ D? Body muscle ABcr_ppp Excr. cell m3vl worm m2 mlVL m3L m3VL m4R m3R m3VR Excr hYp8 hyp9 F U P3p P4p PSp P6p P7p PSp B Y P/1 m3DL m3DR Int b.m. N.l H - HHH++++ + + N.2 + N.3 + N.4 + + + + + + N.8 + + N.10 + + + + + ND ND + ND + + + + + .+ + N.14 N.15 + N.16 + + N.17 + + + + N.20 + + N.21 + + N.19 + + + +2 + - +8 +7 +2 - + + N.30 + N.31 + "+" ND ND + + + N32 + + Np MV. l + H IV.I + H + + + + + + + + + ND IV.6 IV.7 + - + + + +4 +4 +4 - + - +4 -7 -7 ND +1 +4 -7 ND +3 +3 ND ND - - - - - ND ND + + + + ND + + + - + + + - - +4 +4 -2 + - + + +8 +7 -2 + H + + + +1 +4 +3 +2 - - + + + H H H -2 + + H + ND +1 +3 -7 -2 +3 +3 +3 -2 H - + + -7 +2 -7 -2 + + + + -7 +2 -7 +2 + - + + -7 +8 -7 -2 + + + + + + + - +4 +4 +4 -2 + +7 -2 + + H H + + + + "+" + + + + + + + + + + + + + ND + + + + + + + + + NQ + + + - ND ND ND ND ND + + H + + + ND + + + + + + + + + + - H V .9 V.10 + ND + + + + + V.11 "+" - + V. 12 + + + + + + + + + + H + + + + + + + + + + + + - +8 +7 +2 + • + + + +3 +8 +2 -2 + ND + + +4+4+2+-++ + + + + + + +2 +4 +2 +7 +8 +7 +2 ND • +2 +J/H2 +4 +4 +/- + - +++ + + + +2+7 +8 +7 +2 + + + - ND +(- +2 +7 +s +7 +2 "+" NQ ND + + +7 +6 +7 -3 + + + + + - -/+ -/+ + +3 '+3" -/+ + + + + + -/+ + - + + - + H • + + + - + - + - ND ND - -/+ + +2 ND - - + • + +2 +2 ND ND ND "+" +4 - + - . H + +4- +-+H H + -/+ + + + + • + + + + + + - + + + ND + + - + + + + + + + + + + + ND+ + +?+?+?+-ND+ + + + + + + + - + + - + + - +? +? +?. + + + ND ND + + + ND + + + + + + + H - + ND ND H + + + + - - + + H7 + + - +8+1+2-+++ + + • ND + +8 + + + + +7 + + + +7 V .4 + + + + tt+II + + + + +2 + H + + + +2 ND ND - + + + + + + - H ND + + ND - + + + + + - + + + + ND - - + + + + + + + + + +2 + + + + + + - + H7 -2 F + +1 +2 + + + + +2 + + V.5 ND + + + + + -/+ +3 + + V.8 + + + -2 + V.3 V .7 + + + + ND + V.2 ND + + ND + + + + - -7 + + + V.l V .6 + ++ + -ND++ +5 H + - +6 + + - ND +8 + H H -7 +3 + + H +5 -7 + + + + +8+7- +2 ND H ND + +7 + + + IV .8 +7 + + N.29 IV.5 +8 + + N.28 IV.2 + + + - + + + + + + + ND ND ND ND + + + + + + + + + 11 + + + + ND 11 + ND + - + + + + + + - + + + + + + ND ND IV.3 H + + + N.27 + N.25 IV.4 + ND + N.26 N.24 + + + N.23 + + + + + + + + + + N.22 + + + + + + + + + + + + N.18 + + N.12 N.13 + + + + + + N.11 + + + + + N.6 N.9 + ND N.5 N.7 + + + + + + - + - D-1 Chapter 4 Additional characterization of LIN-15 proteins D-2 Abstract Further characterization of the lin-15 locus reveals an effect on fertility. Hermaphrodites with lin-l 5B mutant alleles have a considerable lower broodsize in comparison with wild type animals and lin-l 5A mutant animals at 20°C . lin-15 null animals at 25°C are completely sterile. Introduction The descendants of three of six tripotent form the C.elegans vulva hypodermal cells (VPCs). The fate of each of these 6 VPCs is determined by an intercellular signal generated by the AC that initiates positive and negative regulators of the EGF /EGFR pathway for vulval induction [Aroian, 1991; Beitel, 1990; Chamberlin, 1994; Chamberlin, 1993; Clark, 1994; Ferguson, 1989; Ferguson, 1987; Ferguson, 1985; Hill, 1992; Huang, 1994; Jongeward, 1995; Kayne, 1995; Moghal, 1999]. There are 14 identified genes involved in one or two negative regulative pathways out of the five that negative regulate the EGF/EGFR pathway for vulval induction. These 14 genes are involved in the synMuv pathways. Synthetic multivulva (synMuv) genes encode negative regulators of vulval induction (Clark et al. 1994; Ferguson and Horvitz 1989; Horvitz and Sulston 1980; Huang et al. 1994). In the absence of synMuv activity, P3.p, P4.p, and P8.p generate vulval cells. As mentioned previously, the Muv phenotype is the result of mutations in each class, referred to as A and B, which represent two functionally redundant pathways. There are four class A D-3 genes (lin-8, lin-l 5A, lin-38, and lin-56) and ten B class genes (lin-9, lin-l 5B, lin-35 , lin- 36, lin-3 7, lin-51 , lin-52 , lin-53 , lin-54, and lin-55) (Ferguson and Horvitz 1989; Horvitz and Sulston 1980; Lu and Horvitz 1998) lin-36, lin-l 5A and lin-l 5B each encode novel proteins. lin-35 encodes a protein related to Rb, and lin-53 encodes a protein similar to the Rb-binding protein, p48 (Lu and Horvitz 1998). The Muv strains share two characteristics: heat-sensitivity and maternal effect. When synMuv animals are grown at high temperatures, 25 °C, they display three common phenotypes: a longer generation in comparison to wildtype; adult hermaphrodite's body size decreases; and high incidence of sterility. Some, however, show a heat-sensitive decrease in viability. This heat-sensitivity may be reflecting the loss-of-function or reduction of function of the silent Muv genes (Ferguson and Horvitz 1989). The second characteristic is maternal effect. The penetrance of the Muv phenotype in hermaphrodites with both an A and B class mutation that are progeny of heterozygous hermaphrodites is lower than the penetrance of the Muv phenotype with both an A and B class mutation that are progeny of homozygous A and B class mutation for hermaphrodites. It has not been determined if the maternal effect is due to the combinatorial relationship between the 2 classes of synMuv mutations in the strain or is it due to one of the two mutations in the strain. The results from Ferguson, 1989 show evidence that heat-sensitivity decrease viability and fertility may be the influence of the B silent synMuv mutation. Phenotypic observations at the plate level between synMuv class A strains versus synMuv classB strains reveal while both classes are non-Muv, D-4 synMuv class B strains are in general thinner and less fertile [Ferguson, 1989; my observation]. lin-15 is a member of a set of negative regulators of vulva! development in which appropriate mutation combinations result in a multivulva (Muv) phenotype (Ferguson and Horvitz, 1989). lin-15 is a complex locus with two independent, mutable activities, A and B (Ferguson and Horvitz, 1989; Huang, Tzou and Sternberg, 1994; Clark, Lu and Horvitz, 1994; Lu and Horvitz, 1998) and it acts independently of two known signals controlling the fates of the VPCs, the AC inductive signal and a lateral signal among the VPCs (Herman and Hedgecock, 1990). We quantified the broodsize of the lin-15 null e1763 at 20°C and 25°C. At 20°C, lin-15(e1 763) have a reduced broodsize by 6 fold compared to wild-type. At 25°C, lin-15(el 763) is sterile. We saw the rescue of sterility of lin-15(el 763) at 25°C when the double mutant was built with lfe-1 and lfe-2. LFE1/ITR-1, an inositol 1,4,5-triphosphate receptor (IP3R) homologue, acts as a ras independent positive effector of LET-23, while LFE-2/IP3 kinase acts as a negative effector to mediate fertility (Clandinin et al. 1998; Lesa and Sternberg 1997). We believe lin-15 may be playing a role in fertility via let-23 mediated fertility not involving the ras pathway. D-5 Materials and Methods Nematode methods Growth and handling of C. elegans strain N2 were according to Brenner (1974) and Sulston and Hodgkin (1988). All experiments were performed at about 20°C unless otherwise stated. The genetic and cellular nomenclature of C. elegans were followed according to Horvitz et al. (1979) and Sulston et al. (1983), respectively. Strains The standard wild-type N2 strains was obtained from the Caenorhabditis Genetics Center (USA). Below is a list of alleles used in this work. The source of alleles other than from Brenner (1974) or the Caenorhabditis Genetics Center are also indicated. lfe- 1 (sy290) , unc-24(el 20) IV and unc-38(e264), lfe-2(sy326) I (Clandinin et al. 1998), lin9(nl 12) III, lin-l 5(el 763)X, lin-l 5(n765)ABts, and lin-9(nl 12) III,· lin-l 5(n749)X (Ferguson and Horvitz 1989; Huang et al. 1994), unc-4(el 20) let-23(syl0)/mnCI [dpy-10 unc-52}, unc-4(el 20)(Aroian et al. 1990,· Koga and Ohshima I 995b,· Lesa and Sternberg 1997,· Simske et al. 1996) and let-23(syl0)lmnCl[dpy-10 unc-52], lin-l 5(el763) (Ferguson and Horvitz 1989; Huang 1995; Huang et al. 1994). We crossed in lin-15(el763),· syEx[lin-15(+)}males into lfe-l(sy290), unc- 24(el 20) IV and unc-38(e264), lfe-2(sy326) I to obtain lfe-1 (sy290), unc-24(el 20)IV; lin-l 5(el 763) and unc-38(e264), lfe-2(sy326)I,· lin-l 5(el 763). We crossed in linl 5(n765) into lfe-1 (sy290), unc-24(el 20) IV and unc-38(e264), lfe-2(sy326) I to obtain D-6 lfe-1 (sy290), unc-24(el 20)IV; lin-l 5(n 765) and unc-38(e264), lfe-2(sy326) I; linJ5(n765). Broodsize quantification at 20°C and 25°C All manipulations were done with the ambient temperature at l 8°C. We place 10 L 1 hermaphrodites each on their own plate for each strain for this study. The hermaphrodites were grown in their respective temperature (20°C and 25°C) for 3 1/2 - 4 days then their progeny were counted. We performed two temperature assays concurrently with all strains involved. Since let-23 (syl 0) animals are sterile, let-23(syl 0) and let-23(syl0); lin-15(el763) animals were picked as LI Unc animals segregating from an unc-4(el 20) let-23(syl 0)/mnCJ [dpy-10 unc-52}, unc-4(el 20) and let-23(syl 0)/mnCJ [ dpy-10 unc-5 2}, lin-15 (e 1763) parent, respectively, in order to perform the assay accurately. Since lfe-1 and lfe-2 have no phenotype on there own, they are linked to unc24(el 20) and unc-38(e264), respectively, in order to score for their presence. Results Broodsizes at 20°C After 4 days growing in an incubator set for 20°C, L 1 larvae become adults with young progeny (n=l 0 for each strain). The total number of strains involved are 13: N2, lfe-1 (sy290) , unc-24(el 20) IV and unc-38(e264), lfe-2(sy326) I (Clandinin et al. 1998), lin-9(nl 12) III, lin-l 5(el 763)X, lin-l 5(n765)ABts, and lin-9(nl 12) III; lin-l 5(n749)X D-7 (Ferguson and Horvitz 1989; Huang et al. 1994), unc-4(el 20) let-23(syl 0)/mnCl [dpy-10 unc-52} [Aroian, 1990; Lesa, 1997; Simske, 1996; and Koga, 1995] and unc-4(el20) let23(syl 0)/mnCl [dpy-10 unc-52}, lin-l 5(el 763) (Ferguson and Horvitz 1989; Huang 1995; Huang et al. 1994); lfe-1 (sy290), unc-24(el 20)IV,· lin-l 5(n765) and unc38(e264), lfe-2(sy326) I; lin-15(n765),· and lfe-l(sy290), unc-24(el20)IV; lin-15(el763) and unc-38(e264), lfe-2(sy326)I,· lin-l 5(el 763). We calculated the average broodsize as well as percent fertility per each strain. N2 animals average broodsize at 20°C is ~300 (n=many). let-23(syl0) and let-23(syl0) ,· lin-15(el 763) are sterile (n=l0 for both). The average broodsizes from most to least are: unc-38(e264), lfe-2(sy326) = 182.7; lfel (sy290), unc-24(el20) = 158.5; lin-9(nll2) = 139.7; lin-15(n765) = 119.6,· unc38(e264), lfe-2(sy326),· lin-15(n765) = 95.9,· lin-9(nll2) ,· lin-15(n749)A = 82.4,· lin15(el 763) = 55.4; lfe-1 (sy290), unc-24(el 20),· lin-l 5(n765) = 47.5; unc-38(e264), lfe2(sy326) ; lin-15(el763) = 27.8; and lfe-l(sy290), unc-24(el20) ,· lin-15(el763) =21.4 (Table 1). A reduction of broodsize occurred when both alleles of lin-15, el 763 (null) and n765ABts, were used to build triple mutants with lfe-1 (sy290), unc-24(el 20) and unc-38(e264), lfe-2(sy326). The triple mutants lfe-1 (sy290), unc-24(el 20)IV,· linl 5(n765) and unc-38(e264), lfe-2(sy326) I,- lin-l 5(n765) as well as lfe-1 (sy290), unc24(el 20)IV; lin-15(el763) and unc-38(e264), lfe-2(sy326)I,- lin-15(el763), dropped 2 fold in broodsize compared to its parent strains. All the strains have 100% fertility except lfe-1 (sy290), unc-24 (el 20) IV; lin-15 (el 763) and unc-38 (e264), lfe-2(sy326)I,- linl 5(el 763) which each had 80% fertility (Table 2). D-8 Broodsizes at 25°C After 4 days growing in an incubator set for 25°C, the Ll hermaphrodites are now adults with young progeny (n= 10 for each strain). The total numbers of strains involved are 13. We calculated the average broodsize as well as percent fertility per each strain. N2 animals average broodsize at 25°C is ~300 (n=many). let-23(sy10) and let-23(syl0); lin-15(el 763) are sterile (n=l 0 for both). The average broodsizes are: unc-38(e264), lfe2(sy326) = 42.8; lfe-1 (sy290), unc-24(el 20) = 48.7; lin-9(nl 12) = 9.5; lin-15(n765) = 2.3; unc-38(e264), lfe-2(sy326); lin-15(n765) = 19; lin-9(n112),· lin-15(n749)A = 5.2; lin-15(el 763) = 0. l; lfe-1 (sy290), unc-24(el 20) ,· lin-15(n765) = 19; unc-38(e264), lfe2(sy326),· lin-15(el 763) = 12.4; and lfe-l(sy290), unc-24(e120),· lin-15(e1763) = 13.8 (Table 1). An increase of broodsize occurred when both alleles of lin-15, el 763 (null) and n765ABts, were used to build triple mutants with lfe-1 (sy290), unc-24(el 20) and unc-38(e264), lfe-2(sy326). The triple mutants, lfe-1 (sy290), unc-24(el 20)1V,· lin15(n765) and unc-38(e264), lfe-2(sy326) I; lin-15(n765), increased broodsize by 5 fold for lin-15(n765). Triple mutants, lfe-1 (sy290), unc-24(el 20)1; lin-15(el 763) and unc- 38(e264), lfe-2(sy326)1; lin-15(e1763) rescue lin-15(el 763) sterility. unc-38(e264), lfe2(sy326) I; lin-15(n765), lfe-1 (sy290), unc-24(el 20) IV and unc-38(e264), lfe-2(sy326) have 100% fertility. lin-9(nl l 2) and lfe-1 (sy290), unc-24(el 38); lin-15(n765) are 60% fertile while lin-9(nl12),· lin-15(n744), lfe-l(sy290), unc-24(e120)1V; lin-15(el763) and unc-38(e264), lfe-2(sy326)I,- lin-15(el 763) are 70%, 80% and 40% fertile, respectively (Table 2). D-9 Discussion SynMuv A and B proteins, all nuclear, may either recruit or activate, via their own pathways, a complex that binds to vulva genes in order to block the cell from adopting the vulva fate (Ferguson and Horvitz 1989; Huang 1995; Huang et al. 1994; Kelly and Fire 1998; Lu and Horvitz 1998; Solari and Ahringer 2000; Thomas and Horvitz 1999; Walhout et al. 2000). The disruption in both pathways results in all 6 VPCs cells adopting vulval fates therefore the animal will have a Muv phenotype fate (Ferguson and Horvitz 1989; Huang 1995; Huang et al. 1994; Kelly and Fire 1998; Lu and Horvitz 1998; Solari and Ahringer 2000; Thomas and Horvitz 1999; Walhout et al. 2000). A disruption in one of either A or B synMuv pathway is sufficient to suppress the vulval fate in a given VPC therefore a wild-type vulva but broodsize is noticeably reduced especially if the disruption is in the synMuvB pathway (Ferguson and Horvitz 1989). lin-9, a B class gene, has alleles (n942 and n943) that are sterile. There is a drastic reduction in brood-size when both synMuv pathways are disrupted and grown at 25°C as we have seen (Table 1 and 2). Animals with the null allele of lin-15 have broodsizes one-sixth lower than the standard wild-type strain, N2 at 20°C and at 25°C, lin-15(null) animals are sterile (Table 1 and 2). lin-l 5(n765)ABts animals also have broodsizes one-third lower than N2 strains at 20°C while at 25°C it is almost sterile. Both alleles of lin-15 were viewed under Nomarski optics and we observed a reduced number of mature sperm and oocytes. We see high expression in the spermatheca by GFP driven by the lin-15 promoter indicating possible activity in spermathecal D-10 contractions (Chapter 3, Figure 2). lin-15 may be involved in germline development due to low numbers of mature sperm and oocytes, but further investigation is needed. The receptor tyrosine kinase LET-23 is required for normal development five distinct tissues so far: the vulva, the male tail, the hermaphrodite's posterior ectoderm, the hermaphrodite gonad as well as an essential focus in Ll larvae. A RAS/MAP kinase cascade in all of these tissues except one, hermaphrodite's gonad, mediates LET-23 function. LET-23 activity in the gonad is RAS independent (Clandinin et al. 1998; Lesa and Sternberg 1997). Clandinin et al. , (1998), identified tissue-specific effectors of let23 which revert sterility but not the vulval or lethal defects associated with reduced pathway activity. Two loci were identified, lfe-1 and lfe-2, and they appear to function downstream of let-23 in the hermaphrodite gonad. They encode proteins involved in the regulation of intracellular calcium levels via inositol phosphate metabolism. Mutations in each gene alone are phenotypically silent but lfe-1,· lfe-2 double mutant animals are sterile, demonstrating involvement in ovulation of let-23(+)animals. The gonad of lfe-1,· lfe-2 double mutant animals differentiate normally but ovulation of mature oocytes is abnormal. lin-15 fertility is dependent on the LET-23 receptor since it is not able to suppress let-23(sy10) sterility as a double mutant, let-23(sy10),· lin-15(e1 763), at 20°C. Both lfe-1 and lfe-2 are able to rescue lin-15 sterility at 25°C as a double mutant (Table 1). At 20°C, the double mutants have a synergistic effect resulting in a lower brood-size as D-11 compared to the broodsizes as single mutants (Table 1). These results suggest that lin-15 is involved in another pathway that does not involve the Ras pathway via the let-23 receptor. We propose LET-23 affects intracellular calcium levels in the hermaphrodite somatic gonad, perhaps as part of the mechanism that regulates sheath and spermathecal contractions during ovulation, regulated by the lfe-1 and lfe-2 (Clandinin et al. 1998), as well as germline development and/or spermatheca contractions, regulated by synMuv pathways (possibly solely B synMuv pathway) (Ferguson and Horvitz 1989). D-12 Figure 1. Average Broodsizes at 20°C and 25°C The broodsizes shown is the average of IO progeny events of each strain used. Ten LI stage animals for each strain used were place on a plate, one per plate, for a 3-4 day incubation at 20°C and 25°C. The progeny were then counted and averaged for each strain at both temperatures let-23(sy1 0) ; unc-4(e120); lin-15(e1763) s· IA 0 -- -sII 01 0 I I I\.) I 0 0 I I I I I\.) I 01 0 I I I I I w 0 0 11 1 11 1 1 11 1 111 1 1 I 01 0 0 0 unc-38(e264), lfe-2(sy326); lin-15(n765) lfe-1 (sy290), unc-24(e120); lin-15(n765) II 1 1 111 1 11 1 1 11 1 11 g I'\) 01 0 (') (') CD CD I'\) I~-~- a. a. 1 1 1 11 1 1 111 1 11 1 1 I I I I I l g CD CD unc-38(e264), lfe-2(sy326); lin-15(e1763) , . , _ , , 1 11 1 1 111 1 11 1 1 11 I I I ID ■ lfe-1 (sy290) , unc-24(e120);Iin-15(e1763) unc-38(e264), lfe-2(sy326) lfe-1 (sy290), unc-24(e120) let-23(sy10); unc-4(e120) al ~ lin-15(e1763) lin-15(n765)ABts lin-9(n112); lin-15(n749)A 1 lin-9(112) N2 0 ~ ~ ~ t» -· cc "' CD ~ )> < 8. ~ 0 < (D "'N. "' 0 0 C. m .., (D (C cl (D )> w 0 I ...... D-14 Figure 1. Percent fertility at 20°C and 25°C Out of the IO LI stage animals for each strain, how many had progeny at 20° and 25°C 3-4 days later. s 11 - tn !e DI s· ~ ~ - unc-38(e264), lfe-2(sy326); lin-15(n765) lfe-1 (sy290), unc-24(e120); lin-15(n765) unc-38(e264), lfe-2(sy326); lin-15(e1763) lfe-1(sy290), unc-24(e120); lin-15(e1763) unc-38(e264), lfe-2(sy326) lfe-1 (sy290), unc-24(e120) let-23(sy1 0); unc-4(e120); lin-15(e1763) let-23(sy1 0); unc-4(e120) lin-15(e1763) I lin-15(n765)ABts lin-9(n112); lin-15(n749)A ~ lin-9(112) 0 D "' 01 "' 0 "' (') (') ~ ! '< ~ -;:R_ 0 .,, •.,, '#. <.,.) ~ ""O a, 01 '< ;:; ::::, !. aa, ...... CX) co ~ \ ~ 0 ' ,__ 0) ~ 2: CD .,,:::s ; ""C u. ~ 0I E-1 Chapter 5 Summary E-2 In my graduate work, I have investigated the mechanisms used in C.elegans vulval differentiation through molecular and genetic analysis of the lin-15 locus. The lin-15 locus has two separate activities, A and B, which act in the negative regulation of the inductive event in concert with synMuv class A genes and synMuv class B genes (Ferguson and Horvitz 1985; Ferguson et al. 1987; Huang 1995; Huang et al. 1994; Sternberg and Horvitz 1986). As mentioned in previous chapters, animals carrying mutations in either a class A gene or a class B gene have no phenotype. A double mutant animals defective in both A and B function display the Multivulva phenotype characteristic of all VPCs cells adopting vulval fate (excessive vulval differentiation) (Ferguson and Horvitz 1985 ; Ferguson et al. 1987; Huang 1995; Huang et al. 1994; Sternberg and Horvitz 1986). LIN-15A and LIN-15B proteins are nuclear with a broad expression pattern (Huang 1995). lin-15::GFP also has a broad expression patterns. Both the antibodies and the GFP result signifying involvement in other developmental events, not only vulva differentiation. There is strong evidence that the synMuv pathways, perhaps more so in the synMuv class B pathway, affect fertility (Ferguson and Horvitz 1989). Phenotypic observations at the plate level between synMuv class A strains versus synMuv classB strains reveal synMuv class B strains are in general thinner and less fertile [Ferguson, 1989; personal observation]. lin-15 fertility is dependent on the LET-23 receptor since it is not able to suppress let-23(syl0) sterility as a double mutant, let-23(syl0) ,· lin- l 5(el 763) , at 20°C. Both lfe-1 and lfe-2 are able to rescue lin-15 sterility at 25°C as a E-3 double mutant (Chapter 4). At 20°C, the double mutants have a synergistic effect resulting in a lower brood-size. These results suggest that lin-15 is involved in another pathway for fertility that does not involve the Ras pathway via the let-23 receptor. We believe LET-23 affects intracellular calcium levels in the hermaphrodite somatic gonad, as part of a mechanism controling sheath and spermathecal contractions during ovulation, regulated by the lfe-1 , lfe-2 (Clandinin et al. 1998) and lin-15. SynMuv pathways (possibly solely B synMuv pathway) may regulate germline development, via LET-23 due to the sterility lin-9 alleles n942 and n943 and the reduced number of mature sperm and oocytes as seen in the lin-15 null allele. We wanted to create an assay that can be used as a single cell marker, plus a variety other uses (Chapter 2), for mosaic analysis. The GFP: :Lael + lacO system (Straight et al. 1996; Webb et al. 1995; Webb et al. 1997) provides easy scoring (spot vs. no spot), in all cells including germline unlike the previous mosaic marker, ncl-1, which is limited to certain cells and the scoring is more challenging. We confirmed GFP::Lacl + lacO system effectiveness as a single cell marker for mosaic analysis by unequivocally determining lin-3 site of action for vulval induction is at the AC as well as let-23 site of action for vulval induction is at the VPCs (Chapter 2 and Appendix 1). The yeast two-hybrid of the synMuv proteins (Walhout et al. 2000) plus C.elegans gene homologues to the NURD complex (Solari and Ahringer 2000), mosaic data and protein localization (Lu and Horvitz 1998; Thomas and Horvitz 1999) lays the foundation of a synMuv class B complex (similar to Rb pathway) and the E-4 synMuv class A pathway activities are initiating or maintaining the NURD complex to alter chromatin structure of vulval development genes to antagonize the Ras-mediated vulval induction. We further strengthen the model by confidently using the GFP::Lacl + lacO to perform mosaic analysis on lin-l 5A and lin-l 5B. lin-15A site of action is at the VPCs. It was then further confirmed by localizing its expression within the VPCs (Chapter 3). Unlike the lin-l 5A mosaic, lin-l 5B was not as clear. The expression pattern of the mosaic marker did not reveal lin-l 5B site of action, which is due to the maternal effect of the LIN-I SB protein (Chapters 1 and 3). In order to bypass the maternal effect of LIN-I SB protein, tissue localized expression of lin-l 5B can determine where lin-l 5B activity is sufficient to rescue the Muv phenotype of lin-15 null allele. lin-15 is part of a new mechanism of receptor regulation. Further understanding its role in the A and B class synthetic Multivulva pathways and its association with the NURD complex that affects chromatin structure will further increase the importance of chromatin regulation in developmental decisions. The link between lin-15 to the NURD complex and its negative regulation to the EGF- receptor, will further elucidate molecularly and genetically how cancer cells adopt such a fate via its chromatin structure. Hopefully in the near future, individuals with carcinomas may be diagnosed early and be treated effectively due to our continuing knowledge on cell fate specification via the positive and negative regulation on the EGF- receptor/ MAP kinase signaling pathway. F-1 References Albertson, D. G., J. E. Sulston and J. G. White, 1978 Cell cycling and DNA replication in a mutant blocked in cell division in the nematode Caenorhabditis elegans. Dev Biol 63: 165-78. Aroian, R. V., M. Koga, J.E. Mendel, Y. Ohshima and P. W. Sternberg, 1990 The let-23 gene necessary for Caenorhabditis elegans vulval induction encodes a tyrosine kinase of the EGF receptor subfamily [see comments]. Nature 348: 6939. Aroian, R. V., G. M. Lesa and P. W. Sternberg, 1994 Mutations in the Caenorhabditis elegans let-23 EGFR-like gene define elements important for cell-type specificity and function. Embo J 13: 360-6. Aroian, R. V., and P. W. Sternberg, 1991 Multiple functions of let-23, a Caenorhabditis elegans receptor tyrosine kinase gene required for vulval induction. Genetics 128: 251-67. Beitel, G. J., S. G. Clark and H. R. Horvitz, 1990 Caenorhabditis elegans ras gene let- 60 acts as a switch in the pathway of vulval induction [see comments]. Nature 348: 503-9. Brenner, S., 1974 The genetics of Caenorhabditis elegans. Genetics 77: 71-94. Chalfie, M., Y. Tu, G. Euskirchen, W.W. Ward and D. C. Prasher, 1994 Green fluorescent protein as a marker for gene expression. Science 263: 802-5. F-2 Chamberlin, H. M. , and P. W. Sternberg, 1993 Multiple cell interactions are required for fate specification during male spicule development in Caenorhabditis elegans. Development 118: 297-324. Chamberlin, H. M., and P. W. Sternberg, 1994 The lin-3/let-23 pathway mediates inductive signalling during male spicule development in Caenorhabditis elegans. Development 120: 2713-21. Clandinin, T . R. , J. A. DeModena and P. W. Sternberg, 1998 Inositol trisphosphate mediates a RAS-independent response to LET-23 receptor tyrosine kinase activation in C. elegans. Cell 92: 523-33. Clark, S. G. , X. Lu and H. R. Horvitz, 1994 The Caenorhabditis elegans locus lin-15, a negative regulator of a tyrosine kinase signaling pathway, encodes two different proteins. Genetics 137: 987-97. Clark, S. G., M. J. Stern and H. R. Horvitz, 1992 C. elegans cell-signalling gene sem-5 encodes a protein with SH2 and SH3 domains [see comments]. Nature 356: 3404. Cubitt, A. B. , R. Heim, S. R. Adams, A. E. Boyd, L.A. Gross et al. , 1995 Understanding, improving and using green fluorescent proteins. Trends Biochem Sci 20: 448-55. Eisenmann, D. M. , and S. K. Kim, 1994 Signal transduction and cell fate specification during Caenorhabditis elegans vulval development. Curr Opin Genet Dev 4: 508-16. F-3 Ferguson, E. L., and H. R. Horvitz, 1985 Identification and characterization of 22 genes that affect the vulval cell lineages of the nematode Caenorhabditis elegans. Genetics 110: 17-72. Ferguson, E. L., and H. R. Horvitz, 1989 The multivulva phenotype of certain Caenorhabditis elegans mutants results from defects in two functionally redundant pathways. Genetics 123: 109-21. Ferguson, E. L., P. W. Sternberg and H. R. Horvitz, 1987 A genetic pathway for the specification of the vulval cell lineages of Caenorhabditis elegans [published erratum appears in Nature 1987 May 7- 13;327(6117):82]. Nature 326: 259-67. Fields, C., 1990 Information content of Caenorhabditis elegans splice site sequences varies with intron length. Nucleic Acids Res 18: 1509-12. Fire, A., 1986 Integrative transformation of Caenorhabditis elegans. EMBO 5: 26732680. Fire, A., and S. Q. Xu, 1995 Rolling replication of short DNA circles. Proc Natl Acad Sci US A 92: 4641-5. Galisteo, M. L. , I. Dikic, A. G. Batzer, W. Y. Langdon and J. Schlessinger, 1995 Tyrosine phosphorylation of the c-cbl proto-oncogene protein product and association with epidermal growth factor (EGF) receptor upon EGF stimulation. J Biol Chem 270: 20242-5. Greenwald, I., and J. R. Broach, 1990 63: 1113-6. Cell fates in C. elegans: in medias ras. Cell F-4 Greenwald, I., A. Coulson, J. Sulston and J. Priess, 1987 Correlation of the physical and genetic maps in the lin-12 region of Caenorhabditis elegans. Nucleic Acids Res 15: 2295-307. Greenwald, I. S., P. W. Sternberg and H. R. Horvitz, 1983 The lin-12 locus specifies cell fates in Caenorhabditis elegans. Cell 34: 435-44. Gutch, M. J., A. J. Flint, J. Keller, N. K. Tonks and M. 0. Hengartner, 1998 The Caenorhabditis elegans SH2 domain-containing protein tyrosine phosphatase PTP-2 participates in signal transduction during oogenesis and vulval development. Genes Dev 12: 571-85. Han, M., and P. W. Sternberg, 1990 let-60, a gene that specifies cell fates during C. elegans vulval induction, encodes a ras protein. Cell 63: 921-31. Han, M., and P. W. Sternberg, 1991 Analysis of dominant-negative mutations of the Caenorhabditis elegans let-60 ras gene. Genes Dev 5: 2188-98. Hedgecock, E. M., and R. K. Herman, 1995 The ncl-1 gene and genetic mosaics of Caenorhabditis elegans. Genetics 141: 989-1006. Heim, R., D. C. Prasher and R. Y. Tsien, 1994 Wavelength mutations and posttranslational autoxidation of green fluorescent protein. Proc Natl Acad Sci U SA 91: 12501-4. Heim, R., and R. Y. Tsien, 1996 Engineering green fluorescent protein for improved brightness, longer wavelengths and fluorescence resonance energy transfer. Curr Biol 6: 178-82. F-5 Herman, R. K., 1978 Crossover suppressors and balanced recessive lethals in Caenorhabditis elegans. Genetics 88: 49-65. Herman, R. K., 1984 Analysis of genetic mosaics of the nematode Caneorhabditis elegans. Genetics 108: 165-80. Herman, R. K., 1989 Mosaic analysis in the nematode Caenorhabditis elegans [published erratum appears in J Neurogenet 1989 May;5(2): 159]. J Neurogenet 5: 1-24. Herman, R. K., 1995 Mosaic analysis. Methods Cell Biol 48: 123-46. Herman, R. K., and E. M. Hedgecock, 1990 Limitation of the size of the vulval primordium of Caenorhabditis elegans by lin-15 expression in surrounding hypodermis. Nature 348: 169-71. Hill, R. J., and P. W. Sternberg, 1992 The gene lin-3 encodes an inductive signal for vulval development in C. elegans [see comments]. Nature 358: 470-6. Hill, R. J., and P. W. Sternberg, 1993 Cell fate patterning during C. elegans vulval development. Dev Suppl : 9-18. Horvitz, H. R., 1988 Genetic control of Caenorhabditis elegans cell lineage. Harvey Leet 84: 65-77. Horvitz, H. R., S. Brenner, J. Hodgkin and R. K. Herman, 1979 A uniform genetic nomenclature for the nematode Caenorhabditis elegans. Mol Gen Genet 175: 129-33. F-6 Horvitz, H. R. , and P. W. Sternberg, 1991 Multiple intercellular signalling systems control the development of the Caenorhabditis elegans vulva. Nature 351: 53541. Horvitz, H. R. , and J. E. Sulston, 1980 Isolation and genetic characterization of cell-lineage mutants of the nematode Caenorhabditis elegans. Genetics 96: 43554. Hsu, D.R. , P. T. Chuang and B. J. Meyer, 1995 DPY-30, a nuclear protein essential early in embryogenesis for Caenorhabditis elegans dosage compensation. Development 121: 3323-34. Huang, L. S., 1995 The Caenorhabditis elegans lin-15 locus, pp. in Biology. California Institute of Technology, Pasadena. Huang, L. S., P. Tzou and P. W. Sternberg, 1994 The lin-15 locus encodes two negative regulators of Caenorhabditis elegans vulval development. Mol Biol Cell 5: 395-411. Huang, X. Y., and D. Hirsh, 1989 A second trans-spliced RNA leader sequence in the nematode Caenorhabditis elegans. Proc Natl Acad Sci U S A 86: 8640-4. Jongeward, G.D., T. R. Clandinin and P. W. Sternberg, 1995 sli-1, a negative regulator of let-23-mediated signaling in C.elegans. Genetics 139: 1553-66. Katz, W. S., R. J. Hill, T. R. Clandinin and P. W. Sternberg, 1995 Different levels of the C. elegans growth factor LIN-3 promote distinct vulval precursor fates [see comments]. Cell 82: 297-307. F-7 Katz, W. S., G. M. Lesa, D. Yannoukakos, T. R. Clandinin, J. Schlessinger et al., 1996 A point mutation in the extracellular domain activates LET-23, the Caenorhabditis elegans epidermal growth factor receptor homolog. Mol Cell Biol 16: 529-37. Kayne, P. S., and P. W. Sternberg, 1995 Ras pathways in Caenorhabditis elegans. Curr Opin Genet Dev 5: 38-43. Kelly, W. G., and A. Fire, 1998 Chromatin silencing and the maintenance of a functional germline in Caenorhabditis elegans. Development 125: 2451-6. Kim, S. K., 1995 Tight junctions, membrane-associated guanylate kinases and cell signaling [published erratum appears in Curr Opin Cell Biol 1995 Dec;7(6):891]. Curr Opin Cell Biol 7: 641-9. Kimble, J., and D. Hirsh, 1979 The postembryonic cell lineages of the hermaphrodite and male gonads in Caenorhabditis elegans. Dev Biol 70: 396417. Koga, M., and Y. Ohshima, 1995a Drosophila MAP kinase kinase suppresses the vulvaless phenotype of !in- 3, let-23 and lin-45 mutations in Caenorhabditis elegans. Mech Dev 53: 15-22. Koga, M., and Y. Ohshima, 1995b Mosaic analysis of the let-23 gene function in vulval induction of Caenorhabditis elegans. Development 121: 2655-66. Lesa, G. M., and P. W. Sternberg, 1997 Positive and negative tissue-specific signaling by a nematode epidermal growth factor receptor. Mol Biol Cell 8: 77993. F-8 Liu, J., P. Tzou, R. J. Hill and P. W. Sternberg, 1999 Structural requirements for the tissue-specific and tissue-general functions of the Caenorhabditis elegans epidermal growth factor LIN-3. Genetics 153: 1257-69. Lu, X., and H. R. Horvitz, 1998 lin-35 and lin-53, two genes that antagonize a C. elegans Ras pathway, encode proteins similar to Rb and its binding protein RbAp48. Cell 95: 981-91. Maduro, M., and D. Pilgrim, 1995 Identification and cloning of unc-119, a gene expressed in the Caenorhabditis elegans nervous system. Genetics 141: 977-88. Mello, C., and A. Fire, 1995 DNA transformation. Methods Cell Biol 48: 451-82. Mello, C. C., J.M. Kramer, D. Stinchcomb and V. Ambros, 1991 Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences. Embo J 10: 3959-70. Miller, L. M., M. E. Gallegos, B. A. Morisseau and S. K. Kim, 1993 lin-31,a Caenorhabditis elegans HNF-3/fork head transcription factor homolog, specifies three alternative cell fates in vulval development. Genes Dev 7: 933-47. Miller, L. M., D. A. Waring and S. K. Kim, 1996 Mosaic analysis using a ncl-1 (+) extrachromosomal array reveals that lin-31 acts in the Pn.p cells during Caenorhabditis elegans vulval development. Genetics 143: 1181-91. Moghal, N., and P. W. Sternberg, 1999 Multiple positive and negative regulators of signaling by the EG F- receptor. Curr Opin Cell Bio 1 11: 190-6. Moghal, N. E., E. Wittich and D. V. Milford, 1999 The impact ofrenal replacement therapy on toddler time [In Process Citation]. Anna J 26: 331-5. F-9 Okkema, P. G., S. W. Harrison, V. Plunger, A. Aryana and A. Fire, 1993 Sequence requirements for myosin gene expression and regulation in Caenorhabditis elegans. Genetics 135: 385-404. Perry, M. D., W. Li, C. Trent, B. Robertson, A. Fire et al., 1993 Molecular characterization of the her- I gene suggests a direct role in cell signaling during Caenorhabditis elegans sex determination. Genes Dev 7: 216-28. Robinett, C. C., A. Straight, G. Li, C. Willhelm, G. Sudlow et al., 1996 In vivo localization of DNA sequences and visualization of large-scale chromatin organization using lac operator/repressor recognition. J Cell Biol 135: 1685-700. Sigurdson, D. C., R. K. Herman, C. A. Horton, C. K. Kari and S. E. Pratt, 1986 An X- autosome fusion chromosome of Caenorhabditis elegans. Mol Gen Genet 202: 212-8. Simske, J. S., S. M. Kaech, S. A. Harp and S. K. Kim, 1996LET-23 receptor localization by the cell junction protein LIN-7 during C. elegans vulval induction. Cell 85: 195-204. Simske, J. S., and S. K. Kim, 1995 Sequential signalling during Caenorhabditis elegans vulval induction. Nature 375: 142-6. Solari, F., and J. Ahringer, 2000 NURD-complex genes antagonise Ras-induced vulval development in Caenorhabditis elegans. Curr Biol 10: 223-226. Spieth, J., M. MacMorris, S. Broverman, S. Greenspoon and T. Blumenthal, 1988 Regulated expression of a vitellogenin fusion gene in transgenic nematodes. Dev Biol 130: 285-93. F-10 Spieth, J. , M. Nettleton, E. Zucker-Aprison, K. Lea and T. Blumenthal, 1991 Vitellogenin motifs conserved in nematodes and vertebrates. J Mol Evol 32: 42938. Sternberg, P. W. , A. Golden and M. Han, 1993 Role of a raf proto-oncogene during Caenorhabditis elegans vulval development. Philos Trans R Soc Lond B Biol Sci 340: 259-65. Sternberg, P. W. , and H. R. Horvitz, 1986 Pattern formation during vulval development in C. elegans. Cell 44: 761-72. Sternberg, P. W ., and H. R. Horvitz, 1989 The combined action of two intercellular signaling pathways specifies three cell fates during vulval induction in C. elegans. Cell 58: 679-93. Straight, A. F. , A. S. Belmont, C. C. Robinett and A. W. Murray, 1996 GFP tagging of budding yeast chromosomes reveals that protein-protein interactions can mediate sister chromatid cohesion. Curr Biol 6: 1599-608. Sulston, J. E., D. G. Albertson and J. N. Thomson, 1980 The Caenorhabditis elegans male: postembryonic development of nongonadal structures. Dev Biol 78: 54276. Sulston, J. E., and H. R. Horvitz, 1977 Post-embryonic cell lineages of the nematode, Caenorhabditis elegans. Dev Biol 56: 110-56. Sulston, J.E. , and H. R. Horvitz, 1981 Abnormal cell lineages in mutants of the nematode Caenorhabditis elegans. Dev Biol 82: 41-55. F-11 Sulston, J. E. , E. Schierenberg, J. G. White and J. N. Thomson, 1983 The embryonic cell lineage of the nematode Caenorhabditis elegans. Dev Biol 100: 64-119. Sulston, J. E. , and J. G. White, 1980 Regulation and cell autonomy during postembryonic development of Caenorhabditis elegans. Dev Biol 78: 577-97. Thomas, J. H., and H. R. Horvitz, 1999 The C. elegans gene lin-36 acts cell autonomously in the lin-35 Rb pathway. Development 126: 3449-59. Walhout, A. J. , R. Sardella, X. Lu, J. L. Hartley, G. F. Temple et al., 2000 Protein interaction mapping in C. elegans using proteins involved in vulva! development [In Process Citation]. Science 287: 116-22. Webb, C. D. , A. Decatur, A. Teleman and R. Losick, 1995 Use of green fluorescent protein for visualization of cell-specific gene expression and subcellular protein localization during sporulation in Bacillus subtilis. J Bacterial 177: 5906-11. Webb, C. D., A. Teleman, S. Gordon, A. Straight, A. Belmont et al., 1997 Bipolar localization of the replication origin regions of chromosomes in vegetative and sporulating cells of B. subtilis. Cell 88: 667-74. Wilkinson, H. A., and I. Greenwald, 1995 Spatial and temporal patterns of lin-12 expression during C. elegans hermaphrodite development. Genetics 141: 513-26. Wood, W. B., 1985 Determination of pattern and fate in early embryos of Caenorhabditis elegans. Dev Biol NY 5: 57-78. F-12 Yochem, J. , T. Gu and M. Han, 1998 A new marker for mosaic analysis in Caenorhabditis elegans indicates a fusion between hyp6 and hyp7, two major components of the hypodermis. Genetics 149: 1323-34. Yoon, C.H. , J. Lee, G.D. Jongeward and P. W. Sternberg, 1995 Similarity of sli-1 , a regulator of vulval development in C. elegans, to the mammalian proto-oncogene c-cbl. Science 269: 1102-5.