Sequence Analysis of a tRNA Gene Cluster: Drosophila Leucine-tRNA Genes contain Intervening Sequences Citation Robinson, Randy Richard (1981) Sequence Analysis of a tRNA Gene Cluster: Drosophila Leucine-tRNA Genes contain Intervening Sequences. Dissertation (Ph.D.), California Institute of Technology. doi:10.7907/p9cn-c915. https://resolver.caltech.edu/CaltechTHESIS:09152025-181743359 Abstract A recombinant DNA phage containing a cluster of Drosophila melanogaster tRNA genes has been isolated and analyzed. In situ hybridization localizes this phage to chromosomal region 50AB, a known tRNA site. Nucleotide sequencing of the entire Drosophila tRNA coding region reveals seven tRNA genes spanning 2.5 kb of chromosomal DNA. This cluster is separated from other tRNA regions on the chromosome by at least 2.7 kb on one side, and 9.6 kb on the other. Two tRNA genes are nearly identical and contain intervening sequences in the anticodon loop. These two genes are assigned to be tRNA Leu genes because of significant sequence homology with yeast tRNA 3 Leu , and secondary structure homology with yeast tRNA 3 Leu intervening sequences. In addition, an 8 base sequence (AAAAUCUU) is conserved in the same location in the inter- vening sequences of Drosophi1a tRNA Leu genes and a yeast tRNA 3 Leu gene. Similar sequences occur in all other tRNAs containing intervening sequences. The remaining five genes are identica1 tRNA Ile genes, which are identical to a tRNA Ile gene from chromosomal region 42A. The 5' flanking regions are only weakly homologous, but each set of isoacceptors contains short regions of strong homology approximately 20 nucleotides preceding the tRNA coding sequences: GCNTTTTG preceding tRNA Ile s; and GANTTTGG preceding tRNA Leu s. The genes are irregularly organized on both DNA strands; spacing regions are divergent in sequence and length. Preliminary in vitro transcription experiments with isolated restriction fragments demonstrate that both tRNA Leu genes and at least two of the five tRNA Ile genes are selectively transcribed in vitro by cytoplasmic extracts from HeLa cells. Item Type: Thesis (Dissertation (Ph.D.)) Subject Keywords: (Chemistry) Degree Grantor: California Institute of Technology Division: Chemistry and Chemical Engineering Major Option: Chemistry Thesis Availability: Public (worldwide access) Research Advisor(s): Davidson, Norman R. Thesis Committee: Unknown, Unknown Defense Date: 22 August 1980 Funders: Funding Agency Grant Number NIH UNSPECIFIED National Research Service Award UNSPECIFIED California Institute of Technology UNSPECIFIED Record Number: CaltechTHESIS:09152025-181743359 Persistent URL: https://resolver.caltech.edu/CaltechTHESIS:09152025-181743359 DOI: 10.7907/p9cn-c915 Default Usage Policy: No commercial reproduction, distribution, display or performance rights in this work are provided. ID Code: 17679 Collection: CaltechTHESIS Deposited By: Benjamin Perez Deposited On: 01 Oct 2025 13:12 Last Modified: 01 Oct 2025 13:24 Thesis Files PDF - Final Version See Usage Policy. 26MB Repository Staff Only: item control page

SEQUENCE ANALYSIS OF A tRNA GENE CLUSTER: DROSOPHILA LEUCINE-tRNA GENES CONTAIN INTERVENING SEQUENCES Thesis by Randy Richard Robinson In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy California Institute of Technology Pasadena, California 1981 (submitted August 22, 1980) -ii- To my parents, for motivation. To my advisor, for inspiration. To Debby and Erin, for understanding. -iii- Acknowledgements I owe a great deal to my advisor, Norman Davidson, in whose laboratory this work was accomplished. I shall not forget his dedication to his work and his colleagues, or his intense desire to discover and test new ideas. The many postdoctoral fellows and graduate students in Dr. Davidson's laboratory provided a stimulating environment of scientific discussion and exchanges. I especially thank Dr. Pauline Yen for the original gift of Ch4:Drn50AB and instruction in Southern hybridization and in situ hybridization, Dr. N. Davis Hershey for introducing me to Maxam-Gilbert sequencing, and Dr. Kenshi Hayashi for helpful discussions on the sequencing of tRNA genes. I also thank the members of the Tom Maniatis group for helpful discussions, especia~ly Dr. Ed Fritsch, who gave me valuable instruction and extracts for in vitro transcription, and Dr. Pamela Mellon, for instruction in DEAE paper electrophoresis. Financial aid was provided by a National Institutes of Health predoctoral traineeship, a National Research Service Award, and the California Institute of Technology. I especially thank Mary Arguijo for a superb job in typing and constructing this thesis. Finally, I thank my wife, Debby, for understanding and patience while yet another sequencing gel had to be run, or another paragraph had to be written. -iv- Abstract A recombinant DNA phage containing a cluster of Drosophila melanogaster tRNA genes has been isolated and analyzed. In situ hybridization localizes this phage to chromosomal region 50AB, a known tRNA site. Nucleotide sequencing of the entire Drosophila tRNA coding region reveals seven tRNA genes spanning 2.5 kb of chromosomal DNA. This cluster is separated from other tRNA regions on the chromosome by at least 2.7 kb on one side, and 9.6 kb on the other. Two tRNA genes are nearly identical and contain intervening sequences in the anticodon 1oop. • d to b e tRNA Leu genes b ecause o f These two genes are assigne significant sequence homology with yeast tRNAru, and secondary structure Leu homology with yeast tRNA3 intervening sequences. In addition, an 8 base sequence (AAAAUCUU) is conserved in the same location in the inter1 1 • t,.," vening sequences o f Drosop h'i 1 a t,.," .N.~ ALeu genes an d a yeas t .N.~ ALe3 u gene. Similar sequences occur in all other tRNAs containing intervening sequences. . . f.ive genes are i. d entica . 1 tRNA Ile genes, wh.ic h Te h remaining are identical to a tRNA Ile gene from chromosomal region 42A. The 5' flanking regions are only weakly homologous, but each set of isoacceptors contains short regions of strong homology approximately 20 nucleotides • preceding the tRNA cod'ing sequences: GANTTTGG preceding tRNA Leu s. GCNTTTTG prece d'ing tRNA Ile s; an d The genes are irregularly organized on both DNA strands; spacing regions are divergent in sequence and length. Preliminary in vitro transcription experiments with isolated restriction fragments demonstrate that both tRNA Leu genes and at least two of the five tRNAile genes are selectively transcribed in vitro by cytoplasmic extracts from HeLa cells. -vTABLE OF CONTENTS Summary . . . 1 Introduction 3 Results . . 7 Discussion . . . . . . . . . . . . . . 15 Experimental Procedures . . . . . . . . 25 References . . . . . . . . 30 Table 1 39 Table 2 40 Figure Legends 41 Figures . . . . 46 Appendix I. Nucleotide Sequence of Drosophila Sequences of p50AB: Sequence from the Sal I Site Extending 50 Nucleotides Beyond 57 the Eco RI Site Appendix II. Sequence Organization of Drosophila tRNA Genes. [Reprint from ICN-UCLA Symposium on Eucaryotic Gene Regulation, R. Axel and T. Maniatis, eds. New York), 1979] . . Appendix III. . . . . . . . . . (Academic Press, . . . . . . . . . . 62 Recombinant DNA Studies of DNA Sequence Organization Around Actin and tRNA Genes of Drosophila melanogaster. [Preprint from RNA Polymerase, tRNA and Ribosomes: Their Genetics and Evolution, S. Osawa, H. Ozeki, H. Uchida, and T. Yura, eds. Propositions (University of Tokyo Press), in press] 73 -1- summary A recombinant DNA phage containing a cluster of Drosophila melanogaster tRNA genes has been isolated and analyzed. In situ hybridization localizes this phage to chromosomal region 50AB, a known tRNA site (Elder, et al., 1980). Nucleotide sequencing of the entire Drosophila tRNA coding region reveals seven tRNA genes spanning 2.5 kb of chromosomal DNA. This cluster is separated from other tRNA regions on the chromosome by at least 2.7 kb on one side, and 9.6 kb on the other. Two tRNA genes are nearly identical and contain intervening sequences in the anticodon loop. tRNA Leu These two genes are assigned to be genes because of significant sequence homology with yeast tRNA~eu, and secondary structure homology with yeast tRNA~u intervening sequences. In addition, an 8 base sequence (AAAAUCUU) is conserved in the same location in the intervening sequences of Drosophila tRNALeu Leu genes and a yeast tRNA 3 gene. Similar sequences occur in all other tRNAs containing intervening sequences. The remaining five genes are . . 1 tRNA Ile genes, wh.ic h are a 1 so identical . . identica to a tRNA Ile gene from chromosomal region 42A (Hovemann, et al., 1980). The 5' flanking regions are only weakly homologous, but each set of isoacceptors contains short regions of strong homology approximately 20 nucleotides preceding the tRNA coding sequences: and GANTTTGG preceding tRNALeus . GCNTTTTG preceding tRNAiles; The genes are irregularly organized on both DNA strands; spacing regions are divergent in sequence and length. Preliminary in vitro transcription experiments with isolated -2- restriction fragments demonstrate that both tRNALeu genes and at least • . 1 y transcri. b ed in ' vitro . two o f t h e f ive tRNA Ile genes are se 1 ective by cytoplasmic extracts from HeLa cells (Weil, et al., 1979). Abbreviations used: bp - base pair; the nucleotides A, G, C, or T. kb - kilo base pair; N - any of -3- Introduction Several different organizational schemes for eukaryotic tRNA genes have been discovered. For the yeast Saccharomyces cerevisiae, there are approximately 300 tRNA genes, or about 5 genes per tRNA species. These genes are distributed over the yeast genome with little or no clustering (Beckmann, et al., 1977; Olson, et al., 1979). The fruit fly Drosophila melanogaster has an average of 10 genes per tRNA species; these 600 genes occur in clusters of 2 to 15 genes at approximately SO different chromosomal loci (Steffensen and Wimber, 1971; Weber and Berger, 1976; Elder, et al., 1980). In Drosophila, different tRNA species may be coded within a single gene cluster, while a single tRNA species may be coded in several separate gene clusters (Elder, .et al., 1980; Tener et al., 1980; s. Hayashi, et al., 1980). A Drosophila tRNA gene cluster isolated from chromosomal region 42A contains 18 tRNA genes scattered throughout 46 kb of genomic DNA (Hovemann, et al., 1980; Yen and Davidson, 1980). Drosophila Most of the tRNA species coded by the cluster at 42A are repeated within the cluster. These repeated genes are not arranged as tandem repeats, which is the case for Drosophila SS rRNA genes. In contrast, the african toad Xenopus laevis has about 6,500 tRNA genes (Birnstiel, et al., 1972). Actinomycin-CsCl gradients indicate that most of these genes are clustered on DNA of different G+c content than bulk Xenopus DNA (Clarkson and Kurer, 1976). One Xenopus tRNA gene repeat unit of 3.18 kb is tandemly repeated about 300 times in the genome. This repeat unit contains two tRNA~t genes, and potentially codes for -4- tRNA Phe , tRNA Tyr , and probably more tRNAs Muller and Clarkson, 1980). (Clarkson, et al., 1978; The reasons for these different schemes of tRNA gene organization are unknown. Other recent observations about tRNA gene structure have raised interesting questions about their expression. Several yeast tRNA genes and one Xenopus tRNATyr gene have been shown to contain intervening sequences: segments of DNA internal to the gene that are not colinear with the tRNA gene product (Goodman, et al., 1977; Knapp., et al., 1978; O'Farrell, et al., 1978; Valenzuela, et al., 1978; Etcheverry, et al., 1979; Ogden, et al., 1979; Venegas, et al., 1979; Muller and Clarkson, 1980). However, the frequency of occurrence of tRNA genes with intervening sequences in eukaryotes is still unknown. The function of intervening sequences in tRNA genes is also unknown, but their roie in the biosynthesis of tRNAs partially illuminated. has been In Xenopus oocytes, the removal of the intervening sequence of injected yeast pre-tRNATyr occurs after 3' and 5' end maturations and is the last step prior to transport of the tRNA to the cytoplasm (Melton, et al., 1980). The excision of the intervening sequence and religation of the tRNA half molecules is a two step enzymatic reaction which requires ATP for the second step (Peebles, et al., 1979). It is not known whether these re- actions are accomplished by a common enzyme (or set of enzymes), or by separate enzymes for different pre-tRNAs. If a common enzyme is involved, it should recognize some conserved feature, such as -5- sequence or secondary structure, in the intervening sequence of different precursor tRNAs. Although no one has yet observed any conserved sequences, similar secondary structures have been proposed. The proposed structures usually contain stem loop structures partially within the intervening sequence, and include base pairing of part of the anticodon to the intervening sequence (Knapp, et al., 1978; O'Farrell, et al., 1978; Valenzuela, et al., 1978; Etcheverry, et al., 1979; Ogden, et al., 1979; Venegas, et al., 1979; Muller and Clarkson, 1980). The genes for small RNAs such as tRNA and 5S rRNA also provide convenient systems for the study of eukaryotic gene transcription. A unique RNA polymerase, polymerase III, transcribes these RNAs, as well as small nuclear and viral RNAs (Reviewed by Roeder, 1976). In vivo and in vitro RNA polymerase III transcription systems accurately and specifically transcribe cloned tRNA and 5S rRNA genes. Xenopus oocytes accurately transcribe injected genes and process homologous and heterologous tRNAs (Brown and Gurdon, 1977, 1978; Kressman, et al., 1977; Melton, et al., 1980). Xenopus RNA polymerase III is also active in nuclear extracts obtained from oocyte germinal vesicles (Birkenmeier, et al., 1978; Schmidt et al., 1978). R. G. Roeder and coworkers (Weil, et al., 1979) have developed another in vitro polymerase III transcription system from cytoplasmic extracts of human tissue culture cells. The cytoplasmic extracts accurately transcribe exogenous 5S and small viral RNA genes. tRNA genes. We report that this system also transcribes Drosophila -6- Ultraviolet transcriptional mapping and numerous transcription studies indicate that eukaryotic tRNAs and 5S rRNAs are transcribed as small, independent units (Feldmann, 1977; Brown and Gurdon, 1977, 1978; Schmidt, et al., 1978; Garber and Gage, 1979). The transcription of Xenopus 5S rRNA genes is controlled by an intriguing mechanism: a small protein binds to an intragenic control region, allowing transcription initiation (Sakonju, et al., 1980; Bogenhagen, et al., 1980; Engelke, et al., 1980). Sequences flanking the 5' end of the gene do not affect proper initiation, but sequences flanking the 3' end are required for proper termination. An intragenic control region has also been found for Drosophila tRNALys genes (DeFranco, et al., 1980). However, in contrast to the Xenopus results, the 5' flanking sequences of one tRNA~ys gene negatively modulated transcription of the gene. The comparative study of the 5' flanking sequences of RNA polymerase III transcripts may yet yield insights into the control of transcription of these genes. We have continued our earlier studies (Yen, et al., 1977) of Drosophila tRNA gene organization. We report here the isolation, seque nce ana lysis , and in vitro transcription of a cloned Drosophila tRNA gene cluster. Five regi~ns in the cluster potentially code . . 11 y co d e f or tRNA Leu . f or tRNA Ile , an d two regions potentia Both . . . . f"icant tRNA Leu genes have intervening sequences an d s h are signi . . Leu homologies with yeast tRNA 3 genes. . The 5' flanking sequences of the genes contain weak homologies, and several genes are accurately transcribed by an in vitro extract. -7- Results Isolation and sequencing of a tRNA cluster A recombinant DNA phage containing a cluster of Drosophila tRNA genes was obtained by screening a recombinant library by the plaque filter hybridization method of Benton and Davis (1977). The recombinant library was constructed by cloning partial Eco RI digests of Drosophila nuclear DNA in the modified A cloning vector Charon 4 (Yen, et al., 1979; Davidson, et al., 1980). Previously isolated recombinant plasmids,which contained one or more Drosophila tRNA genes cloned in the vector Col El, were labeled with 32 P and used as hybridization probes for the screen (P. Yen, unpublished). 14 strongly hybridizing recombinant phage were isolated from this screen. DNA from each phage was bound to nitrocellulose filters 3 and hybridized to H labeled tRNA isolated from cultured Schneider Drosophila cells. The recombinant phage giving the strongest hybridization signal was estimated to contain 5-10 tRNA genes. In situ hybridization localized this phage to region S0AB of chromosome 2R (data not shown), and it was therefore named Ch4:Dm50AB. The restriction enzyme mapping and Southern hybridization analysis of Ch4:Drn50AB using 32 P labeled pupal tRNA as a probe indicated that all tRNA coding regions were located on a 3.4 kb stretch of DNA between a Sal I and an Eco RI restriction site (Fig. 1). In addition, four separate restriction fragments within the 3.4 kb Sal I-Eco RI fragment hybridized to the tRNA probe, indicating that multiple tRNA genes were located between the Sal I and Eco RI sites. -8- The Sal I-Barn HI restriction fragment containing the entire tRNA hybridizing region was subcloned into the plasmid vector pBR322, resulting in the recombinant plasmid p50AB. Additional restriction enzymes were used to further map the tRNA coding region between the Sal I and Eco RI sites of plasmid p50AB. The subcloning and restriction mapping are shown schematically in Figure 2. The entire nucleotide sequence of the tRNA coding region was determined by the method of Maxam and Gilbert (1980). the sequence runs is depicted in Figure 2. A summary of 55% of the sequence was obtained by sequencing both strands of a region or by independently sequencing the same strand. When comparing the sequence from opposite strands, we observed a discrepancy between the two readings of about 2%. Therefore, we expect approximately a 2% error rate in those regions that were sequenced only once. tRNA gene regions were sequenced at least twice. However, most The sequence had no discrepancies with the restriction map of the clone, with the exception of several predicted Taq I sites which were not cleaved by Taq I. At all of these sites, however, the Taq I recognition sequence overlapped with an Mbo I recognition sequence. This particular combination of overlapping sites has been observed to confer resistance to Taq I cleavage, probably due to A methylation within the Taq I site when the plasmid is grown in~ coli (Muller and Clarkson, 1980). Thus, we find no unexplainable discrepancies between the restriction enzyme map and the sequence. The complete nucleotide sequence between the Sal I and Eco RI sites is presented in Appendix I. -9- Identification of tRNA genes The strongest conservation of sequence within eukaryotic cytoplasmic tRNAs is in the TljJ loop region (Clark, 1978; Sprinzl, et al., 1980). With the aid of a computer program (Staden, 1977), we searched the nucleotide sequence of pS0AB for possible TljJ loop regions. The-sequence for all candidate tRNA regions were then folded into a cloverleaf secondary structure and checked for tRNA conserved sequences and secondary structure. Seven potential tRNA coding regions were discovered. These coding regions, their flanking sequences, and their cloverleaf structures are shown in Figure 3. Five of the genes code for an identical tRNA sequence . . . which contains the isoleucine anticodon AAU. . 1 tRNA Ile co d'ing An i'd ~ntica . sequence has been previously sequenced on a recombinant plasmid from region 42A of the Drosophila chromosome (Hovemann, et al., 1980). The remaining two tRNA coding regions are quite different from the tRNAile coding sequences, but are nearly identical with each other, and unexpectedly contain intervening sequences. As in all other tRNA genes containing intervening sequences, the location of the intervening sequences is within the anticodon loop. In our case, this location causes some ambiguity in the identification of the tRNAs due to the possibility that the splice junction may be within the anticodon of the mature tRNA. Knapp,et al. (1979), however, have found that there is a conserved site for the splice junction of all yeast tRNAs containing intervening sequences that have been analyzed. The conserved splice junction is just 3' of the purine nucleotide which is 3' to the anticodon. Following this rule for the position of the splice -10junction, we have tentatively identified the Drosophila tRNA genes as leucine tRNA genes, containing the anticodon CAA. between the sequences for the tRNA Leu-a The differences gene and the tRNA Leu-b gene lie entirely in the intervening sequences, and consist of one T~G transversion and an insertion of seven nucleotides (Figure 3). Sequence organization of the tRNA genes and spacers Four tRNA Ile genes are located on the same strand as the tRNA gene, corresponding to rightward transcription in Figure 1. tRNA Ile-a and tRNA Leu-a Leu-b The . genes are located on the opposite strand, corresponding to leftward transcription, divergent from the other five genes. The spacing regions between the genes are variable in length (339; ~ 165; 230; 409; 237; and 491 bases, from left to right in Figure 2). None of the tRNA coding regions includes a genomically coded CCA 3' end. Initial inspection of the sequences near the tRNA genes revealed that the preceding and trailing sequences diverge immediately beyond the mature tRNA coding sequences. Thus, there are no repetitive units within this cluster except for the mature tRNA coding sequences themselves. Examination of the restriction map of the parent Ch4:Dm50AB indicated that the tRNA gene cluster is separated from any other tRNA coding regions by 9.6 kb and 2.7 kb on the Drosophila genome. There .are no tandemly repeated units within the Drosophila DNA insert of Ch4:Dm50AB. If the insert is part of a tandemly repeated array, then the repeat unit would have a minimum length of 15.6 kb, the length of the Ch4:Dm50AB insert. -11- In vitro transcription The tRNA gene cluster was transcribed in vitro with HeLa cell cytoplasmic extracts containing RNA polymerase III activity (Weil, et al., 1979). Figure 4. stranded The results of these experiments are shown in In all of the transcription experiments, we used single 32 P labeled DNAs as convenient length standards to approximate RNA lengths. All acrylamide gels were 8M urea and and run at 60°C, with heat denaturation of samples in 80% formamide prior to loading. Under these conditions we find that the main band of Drosophila tRNA is located between 72 and 80 base single strand DNA markers. Since this is a reasonable size for tRNA, we believe that the size estimations are fair approximations. However, molecules that have an unusually high degree of secondary structure, or very short molecules, may migrate at anomalous lengths. In the results reported below, we find that RNA oligonucleotides comigrate with DNA oligonucleotides of approximately 10% greater length in a 25% acrylamide, 8 M urea gel. A similar case has been found for 20% acrylamide, 8 M urea gels (R. Ogden, personal communication). The in vitro transcription of supercoiled plasmid p50AB DNA produced several bands: two large bands of approximate length 145 and 137 bases; a heavy smear from 95 to 85 bases; and a ladder of smaller bands from 64 to 40 bases, including strong bands at 55, 51, 47, 44 and 40 bases (Figure 4A). In our hands, there was considerable background at mature tRNA size in the a- 32 P-UTP label in vitro transcription reactions. We presume that this is due to -12- • • anu.nation o f a- 32 P-UTP to a- 32 P-CTP by the extract, followed by terminal addition of ( 32 P)CCA to endogenous tRNAs in the extract. There was little background from the a- 32 P-GTP label reactions. In order to determine the origins of the various transcripts, we transcribed isolated restriction fragments containing tRNA coding regions (Figure 4B). The transcription of a 588 bp Alu I fragment . . th e tRNA Leu-a containing gene produced the 137 base band, a ladder of bands from 64 to 50 bases, and moderate bands at 44 and 40 bases. • • 1 I f ragment containing • • Th e transcription o f a 644 b p Au t h e tRNALeu-b gene produced a similar pattern of bands, except the 137 base band was replaced by a 145 base band, and the 40 base band was replaced by a 47 base band. The transcription product of a 618 bp Hha I fragment containing the tRNA ile-a gene was a ladder of bands from 91 to 79 bases, while the transcription products of the 1773 bp Hha I fragment containing the tRNAile-b, tRNAile-c, tRNAile-d, and tRNA Ile-e genes were two sets of bands centered at approximately 95 and 88 bases. However, a 674 bp Pvu II fragment containing the tRNAile-d gene transcribed extremely weakly, and a 169 bp Pvu II• d III f ragment containing • • th e tRNA Ile-e gene d'i d not transcr ib e Hin at all. Although the tRNAile transcriptions produced a moderate band of approximate length 79 bases, none of the tRNA Leu trans- criptions produced any significant bands corresponding to mature tRNA length. Therefore we have identified the in vitro transcription bands from the tRNA plasmid p50AB: the 137 base transcript is from the . th e 145 b ase transcript . . f rom th e tRNALeu-b tRNALeu-a gene region; is -13gene region; the 95-85 base transcripts are from the tRNAile gene regions; and the ladder of bands from 64 to 40 bases is from the tRNA Leu gene regions. The 137 and 145 base bands are precursors of smaller bands We surmised that the 137 and 145 base transcripts from the Leu gene regions . . . . . th e tRNALeu-a were primary transcripts containing tRNA Leu-b and tRNA sequences, respectively. In order to determine if the 137 and 145 base transcripts were precursors of smaller bands appearing during in vitro transcription, we isolated the 32 P labeled 137 and 145 base RNAs and chased them in an unlabeled in vitro transcription reaction. over a span of 60 min., both the 137 and . 145 base bands were chased into sets of small bands: the 137 base transcript produced bands at 40, 44, and a weak ladder from 50 to 56; the 145 base transcript produced bands at 44, 47, and a weak ladder from 50 to 56 (Figure 5, compare to Figure 4B). Therefore, at least some of the smaller bands produced during the transcription of the tRNALeu genes are processing or degradation products from the large transcripts. RNAase Tl and RNAase A oligonucleotides of in vitro transcripts are predicted by the DNA sequence To prove that the 137 and 145 base bands were due to trans• • • t'ion si·te cription o f t h e tRNALeu genes, and no t some o th er t ranscrip on the restriction fragments, we digested the transcripts with RNAase Tl and RNAase A and analyzed the products. isolated 32 First, the p labeled 137 and 145 base RNAs were digested with RNAase Tl -14- and the products were run on a denaturing 25% acrylamide, 8M urea gel. The lengths of the Tl oligonucleotides were compared to the Leu lengths predicted from the DNA sequences of the tRNA genes (Figure 6 and Table 1). The largest Tl oligonucleotide predicted from either transcript is located within the and has a length of 20 bases for tRNA Leu-a intervening sequence, and 16 bases for tRNA Leu-b Each of these Tl oligonucleotides were present as predicted, comigrating with single strand DNA markers of 22 and 18 bases, respectively. In addition to these two large characteristic oligonucleotides, the al.most identical sequence of the two tRNALeu genes predicted several identical Tl oligonucleotides, which were observed in all cases (Table 1). Also, the tRNA Leu gene sequences predicted some cases of differential a- 32 P-GTP or a- 32 P-UTP label, which were also observed. To further establish the identity of the Tl oligonucleotides, several characteristic oligonucleotides were isolated from the 25% acrylamide gel, digested with RNAase A, and electrophoresed on DEAE paper at pH 3.5. The predicted patterns for the 20 base and 16 base Tl oligonucleotides from tRNALeu-b and tRNALeu-a transcripts include no RNAase A products greater than 2 bases except for an A4U, which is present in each. As predicted, we found no RNAase A oligos greater than 2 bases except for a band migrating near the origin, characteristic of A~4N (data not shown). In addition, the RNAase A digest of the 13 base Tl oligonucleotides from both tRNA Leu-a and tRNALeu-b gene transcripts yielded no oligonucleotide greater than 2 bases except for an AAU oligonucleotide, also as predicted from the DNA sequence (data not shown). -15- Discussion The tRNALeu genes from pS0AB There are two arguments that the mature tRNAs from the two tRNA genes containing intervening sequences are identical leucine tRNAs containing the anticodon CAA. First, as mentioned above, previous studies of five yeast pre-tRNAs containing intervening sequences have demonstrated a conserved position for the splice junction: it is always located between the two nucleotides just to the 3' side of the anticodon (Knapp, et al., 1979). To comply with the rules for tRNA sequence and secondary structure (Clark, 1978), the intervening sequence of the pS0AB tRNALeu genes must lie within the anticodon loop. This location is consistent with the conserved site found for yeast tRNA intervening sequences. Secondly, there are significant homologies in sequence and secondary structure between yeast tRNA~eu genes (Venegas, et al., 1979; Kang, et al., 1980; Johnson, et al., 1980) and the proposed Drosophila tRNA Leu genes. Comparisons of the secondary structure of the yeast pre-tRNA~eus and the proposed Drosophila pre-tRNALeus were made after folding the sequences into cloverleaf form (Figure 7) and minimizing the free energy of all stem loop structures (Tinoco, et al., 1973; Borer, et al., 1974). The secondary structures involving the intervening sequences are almost identical (Figure 7). There are two stern loop structures involving the intervening sequences: the first has a stem of 5 bp in both Drosophila and yeast, while the second immediately follows the first with a stem of 6 bp. The sizes of the -16- loops differ slightly for the Drosophila and yeast precursors, from 7 to 5 bases for the first loop, and from 4 to 5 bases for the second. The predicted free energies of these two stern loop structures are -3.5 kcal and -4.0 kcal for the yeast pre-tRNA Leu s, and -1.0 kcal and 3 -3.7 kcal for the proposed Drosophila pre-tRNA Leu s. The CAA leucine anticodon is completely base paired to the yeast intervening sequence, and the last two anticodon bases are base paired to the Drosophila intervening sequence. In addition to the conservation of secondary structures, there is also strong sequence homology between the Drosophila and yeast tRNA~eu genes (Figure 8). Most of the 65% sequence homology between these genes occurs in the dihydrouridine stern and loop, in the mature tRNA anticodon stem and loop, and in the T ~ loop. Of the 47 nucleotides in these regions, 43 are conserved between the Drosophila and yeast genes. The 91% homology in these regions is much stronger than . . h other tRNAs: observe d wen comparing the Drosop h.i 1 a tRNA Leu genes wit h • h yeast tRNA Tyr ; 70% wit • h yeast tRNA Phe ; 5 3% wit • h Drosop h'l 7 4 % wit i a tRNAAsn and 51 % with Drosophila tRNAile_ These striking homologies suggest tha t t h e yeas t t RNA3Leu genes an d our Drosoph i' l a tRNA Leu genes have a common ancestor. The intervening sequences of the yeast and Drosophila tRNALeu genes contain two regions of·strong sequence homology (Figures 7,8). -17- One 8 base region, AAAAUCUU, in the Drosophila tRNALeu intervening sequences is exactly repeated in approximately the same location in Leu one yeast pre-tRNA3 (Venegas, et al., 1979). An almost identical sequence, AAUAUCUU, occurs at the same position in the other yeast Leu pre-tRNA 3 (Kang, et al., 1980; Johnson, et al., 1980). The homology originates in the first loop of the intervening sequence and continues into the stern which base pairs to the anticodon (Figure 7). A second homology of 5 bases occurs mainly within the second loop of the intervening sequences. The sequence in this region is UUAAC for one yeast pre-tRNA~u, and UGAAC for the other yeast and Drosophila tRNALeu genes. The probabilities of finding exact homologies in the same approximate location of two random sequences of intervening sequence length are .12 for 5 bases and .002 for 8 bases. The conservation of an 8 base region between the tRNALeu intervening sequences of very different organisms is an intriguing observation, and suggests that this sequence may be conserved in other tRNA genes containing intervening sequences. We have scanned published tRNA intervening sequences and have found similar sequences starting within all known tRNA intervening sequences (Table 2). Of six tRNA intervening sequences other than tRNALeu, three had a homology of 7 nucleotides with the sequence AAAAUCUU, two had a homology of 6, and one had a homology of 5. This family of conserved sequences starting within tRNA intervening sequences has additional similarities. The last 2 nucleotides, and usually more, are always base paired in a predicted stable secondary -18- structure. region. The first few nucleotides are always located in a loop The last nucleotide, and often more, is base paired to an anticodon nucleotide except for the two tRNATyr precursors. These similarities in sequence and secondary structure indicate that these sequences are strongly related. The homologies of this family of conserved sequences suggest a functional significance. One possible functional role might be the control of transcription of the tRNA gene (Johnson, et al., 1980). If the control of transcription of tRNA genes is similar to that for 5S rRNA genes (Bogenhagen, et al., 1980; Sakonju, et al., 1980; Engelke, et al., 1980), then the intervening sequences would lie in the transcription initiation control region. Johnson, et al. (1980) have found that an insertion in the second stern loop structure of . vitro ' • • • yeast pre-tRNA3Leu d i•d not a ff ect in transcription an d processing of the gene. However, the conserved sequence lies within the first loop structure; alterations in the second loop structure might not affect transcriptional control exerted by the conserved sequence. There are, however, some observations that the intervening sequence transcriptional control hypothesis does not explain. tRNA genes do not have intervening sequences. Many Also, many of these tRNAs have no sequence similarity to the 8 base conserved sequences (Drosophila tRNAile, for example). Thus, neither an intervening sequence nor the 8 base conserved sequence is required for the transcription of all tRNA genes. -19- Another possible function of these conserved sequences is to serve as a common recognition site for the enzyme or enzymes responsible for the removal of the intervening sequence. It is not yet known whether a single enzyme or different enzymes are required for removal of the intervening sequences of different tRNAs, but the recent isolation of yeast mutants which only affect tRNA intervening sequence metabolism (Hopper, et al., 1980) implies that a common enzyme may be involved. Our observations are consistent with a common enzyme involved in tRNA intervening sequence excision: the conserved family of sequences within the intervening sequence may provide a common recognition site for this enzyme. Homologies of Drosophila tRNA gene flanking regions There are imperfect homologies among the 5' flanking regions of the tRNA Ile genes. With no gaps or loopouts allowed, the best . Ile-b Ile-e alignment of the 50 nucleotides preceding the tRNA and tRNA genes produces a 62% sequence homology (Figure 9 ). Homologies in • region • among t h e oth er tRNA Ile genes are 36 % to 48 %. th is flanking region of the tRNA Ile The 5' gene from chromosomal region 42A (Hovemann, et al., 1980) has greatest homology (44%) with the sequence preceding the tRNA Ile-b gene. Although these homologies are weak, they are greater than homologies obtained from comparison of random sequences. These results suggest that the repeated tRNA Ile genes and their spacers may have been created by a gene duplication of an ancestral gene most closely related to the tRNA Ile-b gene. -20- A small region of strong homology precedes the p50AB tRNAile genes, starting 23 or 24 nucleotides from the 5' end of the tRNAile coding region. A consensus sequence derived from the nontranscribed strand of this region, 5' GCNTTTTG 3', occurs in the 5' flanking sequences of the tRNAile-b and tRNAile-e genes, while sequences which match 6 of the 7 consensus nucleotides precede the other tRNA (Figure 3). Ile genes The sequences from the tRNAile gene from chromosomal region 42A contain a run of 8 T nucleotides starting 23 nucleotides from the tRNA coding region, but otherwise are not homologous to the consensus sequence preceding p50AB tRNAile genes. sequences of the tRNA Leu The 5' flanking genes also contain a small conserved sequence, 5' GANTTTGG 3', preceding the tRNALeu-a and tRNALeu:b coding regions by 12 and 21 nucleotides, respectively. Similar small regions of imperfect homology have been found preceding repeated Drosophila tRNA~ys and tRNAArg genes. Hovemann, et al. (1980) have determined a consensus sequence from the 5' flanking sequences of the Drosophila tRNA~ys genes: Davidson, 1980). 5' GGCAGTTTTTA 3' (Hovemann, et al., 1980; Yen and It is interesting that the consensus sequences are G and T rich; they also contain runs of 3 or more T nucleotides. Whether the conservation of these small homologous regions preceding repeated tRNA genes is due to function or some other reason remains unclear. However, there is some evidence that 5' flanking sequences may modulate transcription of Drosophila tRNA~ys genes by Xenopus RNA polymerase III (DeFranco, et al., 1980). -21- The sequences flanking the 3' end of all the pS0AB tRNA genes contain strings of 6 or more T nucleotides in the nontranscribed strand, starting within 10 nucleotides of the tRNA coding region. Since all RNA polymerase III transcripts that have been studied terminate within runs of 4 or more T nucleotides in the nontranscribed strand (Silverman, et al., 1979; Korn and Brown, 1978; Garber and Gage, 1979), the stretches of T nucleotides trailing tRNA genes are probably termination sites. In vitro transcription Preliminary in vitro transcription experiments suggest tRNALeu genes and several tRNAile genes are Therefore, that the selectively transcribed. these tRNA genes appear to contain all information required for accurate initiation and termination of transcription by RNA polymerase III in HeLa cell extracts. We were not surprised that the HeLa system transcribed Drosophila tRNA genes because human cell extracts accurately transcribe Xenopus SS genes (Weil, et al., 1979). Also, Xenopus RNA polymerase III systems accurately transcribe a number of heterologous tRNA genes: Drosophila tRNAArg (Silverman, et al., 1979); Bombyx mori Ala tRNA2 (Garber and Gage, 1980); and yeast tRNAs (Ogden, et al., 1979; Johnson, et al., 1979). Clearly, the RNA polymerase III transcriptional apparatus is well conserved in eukaryotes. When labeled primary transcripts of the tRNA Leu genes are chased with unlabeled in vitro transcription extracts, the transcripts are partially processed, producing small bands of 56 to 40 bases. One of -22- the small processed fragments that we might expect to observe would be the excised intervening sequence from each tRNALeu transcript, predicted to be 38 bases for tRNALeu-a ~d 45 bases for tRNALeu-b_ Indeed we find candidate bands comigrating with single strand DNAs of 40 and 47 nucleotides, respectively (Figure 4). experiments indicate that the tRNA Leu-a Some preliminary 40 base band contains the RNAase Tl oligonucleotide characteristic of the intervening sequence (data not shown). However, we have not yet positively identified the 40 base fragment. Other fragments expected from processing of tRNALeu transcripts would be the 5' and 3' half tRNAs left after excision of the intervening sequence, and the mature tRNA. A preliminary experiment indicates that a band from tRNALeu-a transcription, which comigrates with 44 base single strand DNA, contains RNAase Tl oligonucleotides specific only for the 5' half of tRNA~u However, we have not identified any small transcription bands which originate only from the 3' half of the tRNA, and we have not found any significant bands corresponding to mature tRNA Leu . • 1·1es tha t at 1 east some o f t h e t RNA Te h ab sence o f mature tRNALeu imp processing enzymes are not present or active in the in vitro transcription extracts. Drosophila tRNA gene organization We do not know whether the tRNA genes from Ch4:Dm50AB are the only tRNA genes in chromosomal region 50AB; other tRNA genes may be -23- located on the chromosome near this cluster (but at least 2.7 kb away), which would make the tRNA genes reported here a sub-cluster of a larger region of tRNA genes. Nevertheless, the overall organization of the tRNA gene cluster in Ch4:Dm50AB is consistent with the results of previous investigations (Yen, et al., 1977; Tener, et al., 1980; Elder, et al., 1980; Hovemann, et al., 1980; Yen and Davidson, 1980). Drosophila tRNAs are organized in clusters of varying sizes. A cluster at chromosomal region 42A spans 46 kb and contains 18 tRNA coding regions: 8 tRNAAsn, 4 tRNAArg, 5 tRNALys, and 1 tRNAile_ The cluster reported here spans 2.5 kb and includes 7 tRNA coding regions: 5 tRNAile and 2 tRNALeu_ Although individual tRNA genes are often repeated within a cluster, the genes are irregularly spaced and located on both chromosomal DNA strands. The spacer regions are divergent in nucleotide sequence, but small homologies exist preceding repeated genes. The reasons for this type of clustering, as opposed to the tandemly repeated transcriptional units of Drosophila 5S rRNA genes (Hershey, et al., 1977; Artavanis-Tsakonas, et al., 1977), are unclear. Perhaps the relatively small number of genes for a specific tRNA is required to be more constant throughout evolution than is the number of 5S rRNA genes. The tandem repetitive organization of 5S rRNA genes allows rapid expansion or contraction of the number of genes by unequal crossover events (Smith, 1973, 1976). Because of their irregular sequence organizations, tRNA genes would not be as susceptible as 5S genes to unequal crossover, reducing the rapid -24- contraction or expansion of repeated gene numbers by recombination events. -25- Experimental Procedures Screening the recombinant library The construction and analysis of the recombinant library has been described previously (Yen, et al . , 1979; Davidson, et al., 1980). Partial Eco RI digested nuclear DNA from pupae of Drosophila melanogaster strain Canton S was size selected on sucrose gradients and cloned into the A vector Charon 4 (Blattner, et al., 1977). Insert sizes range from 10-21 kb, and Cot analysis indicates that the library is representative of 95 + 5% of the single copy Drosophila genome. Dr. Pauline Yen combined three recombinant plasmids containing one or more Drosophila tRNA genes cloned in the vector Col El (Yen, et al., 1977), labeled them by nick translation (Maniatis, et al., 1975), and used them as hybridization probes to screen the library (Benton and Davis, 1977; Maniatis, et al., 1978). Isolation and labeling of tRNA The isolation of Drosophila pupal tRNA and 3H labeled Drosophila Schneider cell tRNA has been described (Yen, et al., 1977). Drosophila pupal tRNA was labeled with 32 P by two different methods, each described in detail by Yen and Davidson (1980): tRNA 5' ends were labeled by treatment with T4 polynucleotide kinase and y- 32 P-ATP (Donis-Keller, et al., 1977); tRNA 3' ends were labeled by treatment with T4 RNA ligase and 32 P-pCp (Barrio, et al., 1978). -26- Gel electrophoresis, Southern hybridization, and restriction mapping Recombinant phage DNA was digested singly or in combination by restriction enzymes, and the products were separated by 0.7% or 1.5 % agarose gel electrophoresis in E buffer [40 rnM Tris, 5 rnM NaOAc, 1 rnM EDTA (pH 7.4) ]. Restriction fragments hybridizing to tRNA were detected by transfer of the fragments to a nicrocellulose filter (Southern, 1975), and hybridization to 0.1 µg/ml 32 P -tRNA at 65°C overnight in 1 M NaCl, 50 rnM Tris (pH 7.5), 10 rnM EDTA, 0 .1 % SDS, 0 . 2% bovine serum albumin, 0.2% PVP-40, and 0.2% Ficoll. A restriction map of the phage DNA was deduced by analysis of restriction fragment lengths on agarose gels and the ability of restriction fragments to hybridize to 32 P-tRNA probes. A restriction map of the plasmid p50AB was deduced by analysis of restriction fragment lengths on 5% acrylamide gels in TBE buffer [90 rnM Tris, 90 rnM HB04, 2.5 rnM EDTA (pH 8.3) ], and by partial digestion of end labeled restriction fragments (Smith and Birnstiel, 1976). In situ hybridization Dr. Pauline Yen prepared 3H-cRNA from Ch4:Dm50AB and then h ybr idized it in situ to squashed Drosophila larval chromosomes as described by Yen, et al. (1 9 77). Construction of plasmid p50AB 1.5 µ g Ch4:Dm5 0AB and 0.45 µg plasmid pBR322 DNA (Bolivar, et al ., 1977) were mixed and digested with Sal I and Barn HI restriction enz y mes. The resulting restriction fragments were ligated with T4 DNA ligase -27- (Mertz and Davis, 1972; Cohen, et al., 1973) and the ligation mixture was used to transform E. coli strain HB101. Transformants containing Drosop hila tRNA genes were selected by colony hybridization (Grunstein and Hogness, 1975) to 32 P-tRNA probe. Closed circulur DNA from one positive colony, p50AB, was prepared from a bacterial lysate of chloramphenicol-amplified culture (Clewell and Helinski, 1972) by ethidium bromide-cesium chloride equilibrium sedimentation (Radloff, et al., 1967) . Isolation, labeling, sequencing of restriction fragments Restriction fragments were isolated and labeled at 5' ends with T4 polynucleotide kinase and y- 32 P-ATP as described by Maxam and Gilbert (198 0 ). Fragments were labeled at 3' ends with E. coli DNA polymerase (Klenow fragment): 1 µg of DNA was treated with 0.2 - 1 units DNA polymerase (Klenow) in 30 µl of 5 rnM dithiothreitol, 6.6 rnM NaCl, 6.6 rnM MgC1 2 , and 6.6 rnM Tris (pH 7.5) with 1 µMeach of 32 P-dATP, 3 2 P-dCTP, 32 P-dGTP, and 32 P-dTTP (2000 Ci/mmole) at 37°C for 30 min. End labeled fragments were sequenced by the method of Maxam and Gilbert, using reaction s G, G+A, A>C, C+T, and C. Comp uter programs Minor modifi cat ions of the programs described by Sta den (1977, 1 97 8 ) we re used with a Digital Equipment VAX-11 comp uter to analyze DNA sequences. -28- In vitro transcription and RNA analysis Extracts of HeLa cells, prepared by the method of Weil, et al. (1979) by Dr. Ed Fritsch, were used for in vitro transcription experiments. The products of in vitro transcription were run on 8% denaturing acrylamide gels (Maxam and Gilbert, 1980), and 32 P-RNA bands were eluted from the gels as described for DNA fragments. Unlabeled E. coli tRNA was added to the eluted 32 P-RNA, ethanol precipitated, and resuspended in 5 µl RNAase Tl (10 units) in water. After incubation at 37°C for 30 ~in, the 32 P-RNA was added to an equal volume of 80% formamide loading buffer, heated to 90°C for 5 min, chilled in ice, and loaded onto a 25% acrylarnide, 8 M urea gel (Maxam and Gilbert, 1980). RNA bands from this gel'were eluted as before and digested in 20 µl of 0.1 mg/ml RNAase A at 37°C for 30 min, then loaded and run on DEAE paper at pH 3.5 (Brownlee, 1972). Containment of recombinant DNA organisms All recombinant DNA containing organisms were handled in P2, EK! conditions in accordance with the NIH Guidelines. -29- Acknowledgements Our collaborators, Dr. Pauline Yen, Dr. N. Davis Hershey, and Dr. Kenshi Hayashi provided many helpful discussions. We thank Dr. Yen for the original gift of Ch4:Dm50AB and for assistance in its localization by in situ hybridization. We gratefully acknowledge Dr. Ed Fritsch for gifts of in vitro transcription extracts and instruction in their use. We thank Dr. Rodger Staden for making available his computer programs for DNA sequence analysis, and Dr. Pamela Mellon for instruction in DEAE paper electrophoresis. RR was a recipient of a National Institutes of Health predoctoral traineeship and National Research Service Award 5 T32 GM 07616-02 from the National Institute of General Medical Sciehce. Additional funding was supplied by a grant from the National Institutes of Health. -30References Artavanis-Tsakonas, S., Schedl, P., Tschudi, C., Pirotta, V., Steward, R., and Gehring, W.J. gaster. (1977). The 5S genes of Drosophila melano- Cell g, 1057-1067. Barrio, J., del Carmen G. Barrio, M., Leonard, N.J., England, T.E., and Uhlenbeck, O.C. (1978). Synthesis of modified nucleoside 3' ,5'-Bisphosphatesand their incorporation into oligoribonucleotides with T4 RNA ligase. Biochemistry 17, 2077-2081. Beckmann, J.S., Johnson, P.F . , and Abelson, J. transfer RNA genes in Escherichia coli. Benton, W.D. and Davis, R.W. (1977). (1977). Cloning of yeast Science 196, 205-208. Screening Agt recombinant clones by hybridization to single plaques in situ. Science 196, 180-182. Birkenmeier, E.H., Brown, D.D. and Jordan, E. (1978). A nuclear extract of Xenopus laevis oocytes that accurately transcribes 5S RNA genes. Cell .!2_, 1077 ~1086. Birnstiel, M.L., Sells, B.H. and Purdom, I.F. (1972). of RNA molecules. Kinetic complexity J. Mol. Biol. 63, 21-39. Blattner, F.R., Williams, B.G., Blechl, A.E., Denniston-Thompson, K., Faber, H.E., Furlong, L., Grunwald, D.J., Kiefer, D.O., Moore, D.D., Schumm, J.W., Sheldon, E.L. and Smithies, 0. (1977). Charon phages: safer derivatives of bacteriophage lambda for DNA cloning. Science 196, 161-169. Bogenhagen, D.F., Sakonju, S. and Brown, D.D. (1980). A control region in the center of the 5S RNA gene directs specific initiation of transcription: II. The 3' border of the region. Cell 19, 27-35. -31- Bolivar, F., Rodriguez, R., Greene, P.J., Betlach, M., Heyneker, H.L., Boyer, H.W., Crosa, J. and Falkow, s. (1977). characterization of new cloning vehicles. Construction and Gene~' 95-113. Borer, P.N., Dengler, B., Tinoco, I., Jr. and Uhlenbeck, O.C. Stability of ribonucleic acid double stranded helices. (1974). J. Mol. Biol. 86, 843-853. Brown, D.D. and Gurdon, J.B. (1977). High-fidelity transcription of 5S DNA injected into Xenopus oocytes. Proc. Nat. Acad. Sci. USA 74 2064-2068. Brown, D.D. and Gurdon, J.B. (1978). Cloned single repeating units of 5S DNA direct accurate transcription of 5S RNA when injected into Xenopus oocytes. Brownlee, G.G. (1972). Proc. Nat. Acad. Sci. USA 22_, 2849-2853. Determination of sequences in RNA. In Laboratory Techniques in Biochemistry and Molecular Biology, T.S. Work and E. Work, eds. Clark, B.F.C. (1978). (Elsevier, New York), pp. 67-99. General features secondary and tertiary structure. and implications of primary, In Transfer RNA, S. Altman, ed., (MIT Press, Cambridge, Massachusetts), pp . 14-47. Clarkson, S.G. and Kurer, V. (1976). Isolation and some properties Met of DNA coding for tRNA 1 from Xenopus laevis. Clarkson, S.G., Kurer, V. and Smith, H.O. (1978). Cell.§_, 183-195. Sequence organization Met of a cloned tDNA 1 fragment from Xenopus laevis. Clewell, D.B. and Helinski, D.R. (1972). Cell 14, 713-724. Effect of growth conditions of the formation of the relaxation complex of supercoiled Col El deoxyribonucleic acid and protein in Escherichia coli. 110, 1135-1146. J. Bacter. -32- Cohen, S.N., Chang, A.C.Y, Boyer, H.W. and Helling, R.B. (1973). Construction of biologically functional bacterial plasmids in vitro. Proc. Nat. Acad. Sci. USA 70, 3240-3244. Davidson, N., Fyrberg, E.A., Hershey, N.D., Kindle, K., Robinson, R.R., Sodja, A. and Yen, P. (1980). Recombinant DNA studies of DNA sequence organization around actin and tRNA genes of Drosophila melanogaster. In RNA-polymerase,tRNA and Ribosomes: Their Genetics and Evolution, S. Osawa, H. Ozeki, H. Uchida and T. Yura, eds. (University of Tokyo Press, Tokyo), in press. DeFranco, D., Schmidt, O. and Soll, D. (1980). eukaryotic tRNA gene transcription. 22_, Two control regions for Proc. Nat. Acad. Sci. USA, 3365-3368. Donis-Keller, H., Maxam, A.M. and Gilbert, W. guanines and pyrimidines in RNA. (1977). Mapping adenines, Nuc. Acids Res. i_, 2527-2538. Elder, R.T., Szabo, P. and Uhlenbeck, O.C. (1980). organization in Drosophila melanogaster. 4S RNA gene In Transfer RNA: Biological Aspects, D. Soll, J. Abelson and P. Schimmel, eds. (Cold Spring Harbor Laboratory, New York), pp. 317-323. Engelke, D.R., Ng, S., Shastry, B.S. and Roeder, R.G. (1980). Specific interaction of a purified transcription factor with an internal control region of 5S RNA genes. Cell 19, 717-728. Etcheverry, T., Colby, D. and Guthrie, C. minor species of yeast tRNA Cell 18, 11-26. Ser (1979). A precursor to a contains an intervening sequence. -33- Feldmann, H. (1977). A comparison of transcriptional linkage of tRNA citrons in yeast and E., coli by the ultraviolet light technique. Nuc. Acids. Res.!, 2831-2841. Garber, R.L. and Gage, L.P. . Ala Mori tRNA2 gene: (1979). Transcription of a cloned Bornbyx Nucleotide sequence of the tRNA precursor and its processing in vitro. Cell 18, 817-828. Goodman, H.M., Olson, M.V. and Hall, B.D. of a mutant eukaryotic gene: suppressor SUP4-0. (1977). Nucleotide sequence The yeast tyrosine-inserting ochre Proc. Nat. Acad. Sci. USA 74, 5453-5457. Grunstein, M. and Rogness, D. (1975) . . Colony hybridization: A method for the isolation of a cloned DNAs that contain a specific gene. Proc. Nat. Acad. Sci. USA 72, 3961-3965. Hayashi, S., Gillam, I.e., Delaney, A.D., Dunn, R., Tener, G.M., Grigliatti, T.A. and Suzuki, D.T. (1980). Hybridization of tRNAs of Drosophila melanogaster to polytene chromosomes. Chromosoma (Berl.) 76, 65-84. Hershey, N.D., Conrad, S.E., Sodja, A., Yen, P.H., Cohen, Jr., M. Davidson, N., Ilgen, C. and Carbon, J. (1977). The sequence arrangement of Drosophila melanogaster 5S DNA cloned in recombinant plasmids. Cell 11, 585-598. Hopper, A.K., Schultz, L.D. and Shapiro, R.A. intervening sequences: (1980). Processing of A new yeast mutant which fails to excise intervening sequences from precursor tRNAs. Hovemann, B., Sharp, s., Yamada, H. and Soll, D. Drosophila tRNA gene cluster. (1980). Cell~, 889-895. Cell 19, 741-751. Analysis of a -34- Johnson, J.D., Ogden, R., Johnson, P., Abelson, J., Dembeck, P. and Itakura, K. (1980). Transcription and processing of a yeast tRNA gene containing a modified intervening sequence. Proc. Nat. Acad. Sci. USA].]_, 2564-2568. Kang, H.S., Ogden, R.C. and Abelson, J. (1980). In 12th Miami Winter Symposium, cited by Johnson, et al. (1980) (Academic Press, New York), in press. Knapp, G., Beckmann, J.S., Johnson, P.F., Fuhrman, S.A. and Abelson, J. (1978). Transcription and processing of intervening sequences in yeast tRNA genes. Cell 14, 221-236. Knapp, G., Ogden, R.C., Peebles, C.L. and Abelson, J. of yeast tRNA precursors: (1979). Splicing Structure of the reaction intermediates. Cell 18, 37-45. Korn, L.J. and Brown, D.D. (1978). borealis oocyte 5S DNA: related eukaryotic genes. Nucleotide sequence of Xenopus Comparison of sequences that flank several Cell 15, 1145-1156. Kressman, A. , Clarkson, S.G., Telford, J.L. and Birnstiel, M.L. (1977). Transcription of Xenopus tRNAMet and sea urchin histone DNA l injected into the Xenopus oocyte nucleus. Cold Spring Harbor Symp. Quant. Biol.~, 1077-1082. Maniatis, T., Jeffrey, A. and Kleid, D.G. of the rightward operator of phage A. (1975). Nucleotide sequence Proc. Nat. Acad. Sci. USA 72, 1184-1188. Maniatis, T., Hardison, R.C., Lacy, E., Lauer, J., O'Connell, C. Quon, D., Sim, G.K., and Efstradiatis, A. (1978). The isolation -35- of structural genes from libraries of eucaryotic DNA. Cell 15, 687-701. Maxam, A. and Gilbert, W. (1980). Sequencing end-labeled DNA with base-specific chemical cleavages. In Methods in Enzymology, Vol. 65, L. Grossman and K. Moldave, eds. (Academic Press, New York), pp. 499-560. Melton, D.A., DeRobertis, E.M. and Cortese, R. (1980). Order and intracellular location of the events involved in the maturation of a spliced tRNA. Nature 284, 143-148 (1980). Mertz, J.E. and Davis, R.W. (1972). Cleavage of DNA by RI restriction endonuclease generates cohesive ends. Proc. Nat. Acad. Sci. USA 69, 3370-3374. Muller, F. and Clarkson, S.G. . f Phe coding or tRNA X. laevis DNA. (1980). Nucleotide sequence of genes and tRNATyr from a repeating unit of Cell 19, 345-353. O'Farrell, P.z., Cordell, B., Valenzuela, P., Rutter, W.J. and Goodman, H.M. (1978). Structure and processing of yeast precursor tRNAs containing intervening sequences. Nature 274 438-445. Ogden, R.C., Beckmann, J.S., Abelson, J., Kang, H.S., Soll, D. and Schmidt, O. (1979). In vitro transcription and processing of yeast precursor tRNAs containing intervening sequences. Olson, M.V., Hall, B.D., Cameron, J.R. and Davis, R.W. Cell .!2_, 399-406. (1979). Cloning of yeast tyrosine transfer RNA genes in bacteriophage lambda. J. Mol. Biol. 127, 285-295 (1979). -36- Peebles, C.L., Ogden, R.C., Knapp, G. and Abelson, J. of yeast tRNA precursors: A two-stage reaction. Radloff, R., Bauer, W. and Vinograd, J. (1967). (1979). Splicing Cell 18, 27-35. A dye-buoyant-density method for the detection and isolation of closed circular duplex DNA: The closed circular DNA in HeLa cells. Proc. Nat. Acad. Sci. USA 57, 1514-1521. Roeder, R.G. (1976). Eukaryotic nuclear RNA polymerases. Polymerase, R. Losick and M. Chamberlain, eds. In RNA (Cold Spring Harbor Laboratory, New York), pp. 285-329. Sakonju, s., Bogenhagen, D.F. and Brown, D.D. (1980). A control region in the center of the 5S RNA gene directs specific initiation of transcription: I. The 5' border of the region. Cell 19, 13-25. Schmidt, O., Mao, J., Silverman, S., Hovemann, B. and Soll D. (1978). Specific transcription of eukaryotic tRNA genes in Xenopus germinal vesicle extracts. Proc. Nat. Acad. Sci. USA~, 4819-4823. Silverman, S., Schmidt, O., Soll, D. and Hovemann, B. (1979). The nucleotide sequence of a cloned Drosophila arginine tRNA gene and its in vitro transcription in Xenopus germinal vesicle extracts. J. Biol. Chem. 254, 10290-10294. Smith, G.P. (1973). families. Smith, G.P. Cold Spring Harbor Symp. Quant. Biol.~, 507-513. (1976). crossover. Unequal crossover and the evolution of multigene Evolution of repeated DNA sequences by unequal Science 191, 528-535. Smith, H.O. and Birnstiel, M.L. restriction site mapping. (1976). A simple method for DNA Nuc. Acids Res. 1_, 2387-2398. -37- Southern, E.M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98 503-517. Sprinzl, M., Grueter, F. Spelzhaus, A. and Gauss, D.H. (1980). Compilation of tRNA sequences. Staden, R. (1977). Nuc. Acids Res . .§_, 1-22. Sequence data handling by computer. Nuc. Acids Res.!, 4037-4051. Staden, R. (1978). computer. Further procedures for sequence analysis by Nuc. Acids Res.~. 1013-1015. Steffensen, D.M. and Wimber, D.E. (1971). Localization of tRNA genes in the salivary chromosomes of Drosophila by RNA:DNA hybridization. Genetics 69, 163-178. Tener, G.M., Hayashi, s., Dunn, R., Delaney, A., Gillam, I.e., Grigliatti, T., Kaufman, T. and Suzuki, D.T. (1980). RNA genes of Drosophila melanogaster. Transfer In Transfer RNA: Biological Aspects, D. Soll, J. Abelson and P. Schimmel, eds. (Cold Spring Harbor Laboratory, New York), pp. 295-307. Tinoco, Jr., I., Borer, P.N., Dengler, B., Levine, M.D., Uhlenbeck, O.C., Crothers, D.M. and Gralle, J. (1973). Improved estimation of secondary structure in ribonucleic acids. Nature New Biol. 246, 40-41. Valenzuela, P., Venegas, A., Weinberg, F., Bishop, R. and Rutter, W.J. (1978). Structure of yeast Phenylalanine-tRNA genes: An intervening DNA segment within the region coding for the tRNA. Proc. Nat. Acad. Sci. USA 22_, 190-194. -38- Venegas, A., Quiroga, M., Zaldivar, J., Rutter, W.J. and Valenzuela, P. (1979). Isolation of yeast tRNA Leu cloned tRNA 3 gene. Leu genes: DNA sequence of a J. Biol. Chem. 254, 12306-12309. Weber, L. and Berger, E. (1976). Base sequence complexity of the stable RNA species of Drosophila melanogaster. Biochem. 15, 5511- 5519. Weil, P.A., Segall, J., Harris, B., Ng, S. and Roeder, R.G. (1979). Faithful transcription of eukaryotic genes by RNA polymerase III in systems reconstituted with purified DNA templates. J. Biol. Chem. 254, 6163-6173 Yen,. P. and Davidson, N. (1980). The gross anatomy of a tRNA gene cluster at region 42A of the Drosophila melan~gaster chromosome. Manuscript submitted. Yen, P., Hershey, N.D., Robinson, R.R. and Davidson N. (1979). Sequence organization of Drosophila tRNA genes. In ICN-UCLA Symposium on Eucaryotic Gene Regulation, R. Axel and T. Maniatis, eds. (Academic Press, New York), pp. 133-142. Yen, P.H., Sodja, A., Cohen, Jr., M., Conrad, S.E., Wu, M. Davidson, N. and Ilgen, C. (1977). Sequence arrangement of tRNA genes on a fragment of Drosophila rnelanogaster DNA cloned in E. coli. Cell 11, 763-777. g 5 4.3 5 4.3 5 (2) 4 (3) 5 (2) 4 (7) g h h P-GPT 4 (8) 5 (2) 6 (2) 7 (2) 9 (1) -- 13 (1) P-UTP 4 (7) 5 (2) 6 (1) 7 (4) 9 (3) 11-14 (4-7) 13 (4) 16 (7) 32 predicted 16 (1) 32 32 7 6 7 6 4.3 Bands Oligo- the 5' termini of transcription have not been mapped. nucleotides originating from sequences 5' of the tRNA coding sequences are not included because strings of U nucleotides immediately 3' to the tRNA coding sequences (see Discussion). These termini are assumed to be Bands c and c' are diagnostic bands, labeled by UTP but not GTP, from the 3' termini of transcription. smaller than three nucleotides are not included. Numbers in parenthesis indicate relative amount of radioactivity predicted in a band. RNA lengths were determined from single strand DNA markers (Figure 6). 4.3 5 10 10 5 13,14 -- 15 15 P-UTP 18 32 18 P-GTP observed . T1 o 1 igonuc 1 eoti. d es f rom tRNA Leu-b Predicted and observed lengths of RNAase Tl oligonucleotides from in vitro transcripts of the tRNALeu genes. Table 1. f 6 6 6 (1) 6 (2) e f 7 7 7 (1) 7 (1) e d 10 10 9 (3) c' 12,13 -- 9 (1) b 15 15 d 10-13 (4-7) a' 22 P-UTP 22 P-GTP 32 observed -- 13 (4) 13 (1) b 32 C 20 (10) P-UTP 20 (1) P-GTP 32 predicted a 32 . Tl oligonuc 1 eoti'd es f rom tRNA Leu-a I w I \!) 6 7 AAAAAGUU - . . Ser s. cerev1s1ae tRNAUCG . . Trp tRNA s. cerev1s1ae AAAAUCUU AAAAUCUU . . Leu (b) tRNA 3 s. cerev1s1ae Leu in the tRNA precursor. nucleotides correspond to RNA nucleotides predicted to be base paired to anticodon nucleotides overlined Underlined nucleotides this report Venegas et al., 1979 Kang et al., 1980 Ogden et al., 1979 Etcheverry et al., 1979 Valenzuela et al., 1978 A conserved family of sequences in intervening sequences of tRNA genes. 8 7 6 Valenzuela et al., 1978 Goodman et al., 1977 Mliller and Clarkson, 1980 reference correspond to RNA nucleotides predicted to be base paired in the tRNA precursor; Table 2. D. melanogaster tRNA AAUAUCUU . . Leu (a) tRNA 3 s. cerev1s1ae - UAAAUCUU - AAAUACUU . . Phe (b) tRNA s. cerev1s1ae 7 7 5 AAAAACUU 3I . . Phe (a) tRNA s . cerev1s1ae CAAUCCUU # nucleotides matching Om sequence CAAAUCUU -- 51 conserved sequence s. cerevisiae tRNATyr . Tyr tRNA x. 1 aevis tRNA gene I .i,. 0 I -41- Figure Legends Figure 1. Restriction and Southern hybridization analysis of Ch4:Drn50AB. Panel A - ethidium bromide stained gel of Ch4:Drn50AB digested with the indicated restriction enzymes (left); light and heavy exposures of Southern hybridization of the DNA in this gel with Dm 32 P-tRNA probe (middle and right). The Eco Rl digest lane indicates that a single 10 kb fragment hybridizes to tRNA, while the Eco Rl + Hind III lane shows that two fragments of length 2.95 and 1.15 kb hybridize to tRNA. The 5.4 kb fragment in the Eco RI+ Hind III lane that hybridizes to tRNA is due to incomplete Hind III digestion. Panel B - ethidium bromide stained gels of Ch4:Dm50AB digested with the indicated restriction enzymes and light and heavy exposures of Southern hybridizations using Dm 32 P-tRNA probe. The Sal I+ Barn HI lane (left) contains a single 4.3 kb fragment which hybridizes to tRNA (higher molecular weight fragments that hybridize to tRNA are due to incomplete Sal I digestion). to form p50AB. This 4.3 kb fragment was subcloned into pBR322 The Pvu II+ Hind III lane (right) indicates that four distinct fragments hybridize to tRNA:1.75 kb; 1.11 kb; 0.66 kb; and 0.15 kb. Figure 2. p50AB. Restriction maps and sequencing gels of Ch4:Dm50AB and Restriction enzyme code: A-Alu I; B-Bam HI; D-Hind III; E-Hae III; F-Hinf I; H-Hha I; HP-HpaI; M-MspI; P-Pvu II; Rl-Eco RI; S-Sal I; T-Taq I; V-AvaII. Sequencing gels are schematically shown -42- as arrows in the direction of reading; dashed arrows indicate 3' end labeled fragments, while solid arrows indicate 5' end labeled fragments. tRNAs are schematically shown as arrows indicating direction of transcription. Figure 3. Sequences of p50AB tRNA genes and their flanking sequences. Panel A - The nontranscribed DNA strand in the 5' to 3' direction is shown. All five tRNAile genes have identical sequences for mature tRNA Ile. The tRNA Leu genes differ by a T-+ G transversion at position 42, and a 7 bp deletion starting at position 70. A i~dicates proposed sites for excision of the intervening sequences. Underlined sequences indicate small, strongly conserved sequences . Ile Leu preceding the tRNA and tRNA genes. structures for p50AB tRNA Ile and tRNA Leu Panel B - Clover leaf The tRNALeu structures contain the intervening sequence nucleotides. For the proposed stable secondary structure of the intervening sequences of the tRNA Figure 4. Leu genes, see Figure 7. In vitro transcription products of p50AB tRNA genes. In vitro transcription products were run on denaturing 8% acrylamide gels and exposed to X-ray film. Panel A - lanes a, b, and c contain the products of in vitro transcription of supercoiled plasmid DNAs with the indicated 32 P label: lane a - p50AB DNA (a- 32 P-UTP); lane b - pBR322 DNA (a- 32 P-GTP); lane c - pBR322 DNA (a- 32 P-UTP). Lane d contains 32 P labeled Drosophila tRNA. Panel B - restriction fragments from p50AB DNA containing the -43- indicated tRNA genes were transcribed in vitro with a- 32 -P-GTP label: lane a - 588 bp Alu I fragment (tRNA Leu-a ); lane b - 644 bp Alu I fragment (tRNALeu-b); lane c - 674 bp Pvu II fragment (tRNA Ile-d . Ile-e ) ; lane d - 169 bp Pvu II+ Hind III fragment (tRNA ); lane e - 618 bp Hha I fragment (tRNA Ile-a ) ; lane f - 1773 bp Hha I fragment (tRNAile-b,c,d,e). Figure 5. Chase of 137 and 145 base transcripts with in vitro transcription extract. The 137 base and 145 base transcripts (lanes a and b of Figure 4) were excised and eluted. The RNAs were treated with an in vitro transcription extract containing unlabeled UTP. At the indicated times, aliquots were removed and quenched as before. Lanes a-d (137 base transcript): lane a - 60 min; lane b - 10 min.; lane c - l min.; lane d - 0 min., lanes e-f (145 base transcript): lane e - 60 min.; lane f - 10 min.; lane g - l min.; lane h - 0 min. Figure 6. RNAase Tl digestion of the 137 and 145 base transcripts. 137 and 145 base transcripts, which were transcribed from isolated restriction fragments with either a- 32 P-GTP or a- 32 P-UTP label, were digested with RNAase Tl and loaded onto an 8 M urea, 25% acrylamide gel with single stranded DNA length standards: lane a - 137 base transcript (a- 32 P-UTP); lane b - 137 base transcript (a - 32 P-GTP); lane c - 145 base transcript (a- 32 P-UTP); lane d - 145 base transcript (a analysis of this gel. 32 P-GTP). See Table l for The numbers at left are nucleotide positions -44- from a Maxam and Gilbert (1980) sequencing gel reading. Because of the chemical degradation method of sequencing, however, nucleotide position n is actually an oligonucleotide of length n - 1. Thus, the RNA oligonucleotide migrating at position 23 comigrates with DNA oligonucleotides of length 22. Figure 7. Predicted secondary structures of the precursor of a yeast tRNA Leu and the proposed precursors of Drosop h'i l a tRNA Leu 3 Underlines indicate short regions of strong sequence homology • • sequences o f yeast an d Drosop h'l i a tRNA Leu . b etween t h e intervening Nucleotides in parentheses indicate differences between the sequences for p50AB tRNA Leu-b and tRNA Leu-a Heavy arrows indicate predicted locations of splice junctions, and the predicted mature anticodon stem and loop is shown to the right of each precursor. Figure 8. tRNA Comparison of the sequences of yeast tRNA Leu-b . Leu 3 and p50AB Loopouts were allowed in this comparison to maximize homology (looped out nucleotides are opposite-). Matches between the two sequences are indicated by* Figure 9. Homolo gies in the DNA sequences 5' to Drosophila tRNAile genes. (tRNA . . Ile 50 bases preceding each Dm tRNA gene reported here ile-a to e) and by Hovemann, et al. were compared for homologies. homology were (1980) (tRNA Ile-bh) Alignments producing maximum found by a computer program that does not allow -45- loopouts in comparisons. Each alignment is identified by the tRNA genes that follow the compared DNA sequences: tRNA tRNA Ile-a Ile-d b - pSOAB tRNA e - pSOAB tRNA Ile-b Ile-e ; c - pSOAB tRNA Ile-c ; bh - pCIT12 tRNA Ile a - pSOAB ; d - pSOAB . '· -4610 IO q_~ 0 ro en •• _en 10 ~I I{) (\J "" N II . 0. 11 ~ ~ r.. Q) E :::, a ~ ~ (/) 0 .o a. >< -0 Q) a >0 > -:::, Q) a <{ ..c ~- 'lA. ~ E ~ l a (/) :::, ~ t. ' ....... : I. \ O'I 0 .o a. >< a Q) o- -0 ~ -:::, ..c O'I <{ :.= filPU!H IBPU!H + IH wos CD w filPU!H I~0:l3+filPU!H • r~oo3 I~0:>3+IH wos IH wos ~I 11 o- ~ dm IO Figure lA 11 .. . I{) I() ro en ro N 0 (\J IO -47- . . . -. . <q --- LO II) CD l'-11) V II) - C\J- <D . LO I II I I 4'-·-,,.. h, ' ,. ff) E aJnsodxa ,<l\oa4 C "- CJ\ 0 -0 C "0 :, --1 • - aJnsodxa l4D!I _.I I I <t ~ . I t - -- - ·-· - -- - - - - · -- filPU!H + nnl\d IHW08 +Il""d 110s +nn"d I 11 I l = <D . . . . ---- - ~ LO II) (X) LO I'- It'> V C\J . rti V N I I I in rt) - ----- rt) • (\J /Ill aJnsodxa l4D!I "- lIIPU!H + !IDS cnw-1 1Hwos +110s J 1 111 1· .11111 I I rt'> LO V. Figure lB • rt') . rt') . C\J C\J ll l . LO I\.) (D 1-i hj t-'· IQ ~ Scale RI IKB 1-------i A tRNA IKB ~ ile-a H / I I / ~ EA ~ I-'> ~ leu-a ile-b ile-c I- ➔ I-:-➔ ~ 'E D F H~~(T/ F tRNA coding F I-+ ile-d I-+ ile-e ~ leu-b "' "' "" ~ p E ~11 H1ffF ! I TH "'- T / TH f/T F """'-. < ~~~ ~~}-_>➔ ~ ~ i-:--➔ ~--~ ~--, <, ➔ AE I T F,,, F p D S // HP , I \'p E E I IA E A F~ I ~HA H / F\(}1 / ~--i ~-----'-i ~ ~ <- --i SEQUENCING GE LS . . --- ➔ pBR322 / PLASMID p 50 AB/ / Ch4 left arm CHARON 4: Dm50AB M "'-. ~ H MB l I .ts 00 ! :i:, w (D t-'i c lQ hj f-'· -50 -1 20 40 60 GGCCCATTAGCTCAGTTGGTTAGAGCGTCGTGCTAATAACGCGAAGGTCGCGGGTTCGATCCCCTCATGGGCCA 1 SEQUENCES (5 '-3 ') 100 120 ATGAGCGlTCTGGTCCTCTCTGAGGGCGTGGGTTCGAATCCCACTTCTGACA 80 +50 [LEU-BJ AATATTTTTTTAAGCCCAAAGAAATTAACAATGATTTGACAAACAATGCA [LEU-A] AAATTTTTTTAGTGGTTTTGTTTTTGAATGGTTGATAAATTTTTTCTACC [ILE-El GAATAATTTTTTTTTATTACATTTCTAATGCACTTTGAAAATTAAAAAGT [ILE-DJ GATATTTTTTATTTCTGAACATCCTGATTACTTTGAGGTTCAAAGCCTTG [ILE-CJ AACATTCTTTTTTCTTGTTATATACATATTTACAGCTGAATAATATACAT [ILE-BJ GGTGAATTTTTTGTATCATCCCCCCCACAAGGTCTTTTAAAGATACTAAG [ILE-A) GTCGAACTTTTTTTATAATGCTTTACGTTTTTTAGTAGATGCCTAAGGAT +1 3' FLANKING SEQUENCES [LEU-BJ GTCAGGATGGCCGAGCGGTCTAAGGCGCCAGACTCAA~ATTGAAAATCTTACTTTCTGAACGAAAGTGTTTGTTTAATGAGCGlTCTGGTCCTCTCTGAGGGCGTGGGTTCGAATCCCACTTCTGACA [LEU-A) GTCAGGATGGCCGAGCGGTCTAAGGCGCCAGACTCAA~ATTTAAAATCTTACTTTCTGAACGAAAGTGT [ILE) TRNA [LEU-BJ TAGACAATATAATGGCAAACAGAGAACATCCTAATTTATTGGTTCAACGCCCCATTTTGTATATACTTTTATGACACTAGATTTTGGGCGCGGAATCAGT [LEU-A) TGGTTTGACTGCAACTGTTGTATTACGAATAGAATTGTTCTAGTACTGGCACATGCGCTGGCTCGCGCGCTACTACGGAATCGGACACGAGTTTGGCTAT [ILE-El TACGCTCCCAACATAATATACTACTGTTAAATACAACTGTTAACAGATTTATCAGAATTGCTATTTGGTAAAACTGGCATTTTGGCAGCTGTGCATAAAT [ILE-DJ CGTTGAGGTCCTATGCATTCCGAATCTTTGGTTCAGTGACCAATTCTACGGCTGTTCGTCGCATTTACTCTCAAAAAGCGTTTGGCAAAAAAGAACGCAT [ILE-CJ TTTACGGATAGAAATTTATGTCTTTTACACAACTTGTGGATAAAAGCTCAATATTGTGTTTCATTGGCGTAAATGCGTCTTTTGACAGAAATCAGCACAA [ILE-BJ AATTCTATTCGTAATACAACAGTTGCAGTCAAACCAACATGGAAGGTATTGTTAGCTTCGCTATTTAGCGAAAATCGCATTTTGTTAAAATTACAGACAT [ILE-A] TGCCCACTTAAAATTTATTAGGCAAAGTTTTTTGTTTTGCTATGATTTTCAGTTTAGTACGCCTTCCAGTCTGCTACGCCTCTTGCATCCGTAAATACAT -100 5' FLANKING SEQUENCES I ,i,. I I.!) tn w ~ i ., \§) C y (y!~ U u@ I • I I I ® G U-A A GG C-G G-C U•G G-C © A (Q) AAU ©u @ @@© G CG G @ @u-Acucc©©u® A GAl§J© u ®@ (G\ u 5 3' A G-C G-C C-G C-G C-G A-U 1 I. lso leuc ine ( codon AUU) 1 1 UcUGAACG A A A u u Uu A C G u~(UUGUUUA) G A C U U A A G U AA A CG A G I I 1 11 G GCCG GUGGc;U C G I I I I CGG u u A AGGCG Ucc GAG cu C-G Ucu u C-G C A-U G-C / (G) \ CA-Uu' '~GAACU GC uUU G 3 A G-C U-A C-G A-U G-C G•U A-U UAA u CACCC G 5 II. Leucine ( codon UUG) I 0 I - lJ1 -51- --- A a b c B d a b C d e f - • . • . • 145-, 137- • 145- • • 137-9 t 120110100- ,, 90- 80 I 80- 56-t ~ - 4744- i 40-' 47- • 44-.. 40-• Figure 4 -52- abed efg h - 4537- 56- 4744- • 40- Figure 5 -53- a b c d 22- • - 18- 14- -- 10- . .... 8- , -- 6- 54- 3- - • Figure 6 • '"I.1 --.J 1--( (1) 'g I-'· 8=8 D ! G-C UCA-Lt A-U i=~/ /cAi t=H uc A-U UGCGA C GUAUG A--uA--U L--(UUGUUUA) , A--u c . . G '-G--c u ....A A---u u--A u u'A u--A (G-.)U A ~--G C AA U A GA G-C U-A C-G A-U G-C GoU A A-U c Ac r C U A CGA Gu , , ,, , G GG GyyG guGGG UuC U AGGCG uGGG cu A c ccf~u 5' C A ~ 3' Proposed precursors to Drosophila t RNleu ~ l W UA UA c,G GA c_ c,G A, G G'UG C' AG,'u @'Uc A C G' A AAAAU UG A f U-A G-C A-t C'A I G A GGCG C-G U A"U' f3 AA DC DA C-G CG U / C cAR u"' C-G U-A G-C A-iJ;, 'C-G/ ( Venegas , et al., 1979) G-C P G-C U-A U-A G-C U·G U AA u-Auucuc G cGA Gu AAGAGT tC G GCCG CGu A I I I 5' C AoH 3' Leu Precursor to yeast tRNA 3 I II'> I Ul (X) (D ti <Q ~ I-'· "1 [YELEU-3] [DMLEU-B] [YELEU-3] [DMLEU-B] [YELEU-3] [DMLEU-B] 1 * *** •••••••••• ********* ** ****** ******** * ** • 121 AGCAACCA ** TTCTGACA 61 121 •••• ****** * •• ••• • ••••• • • • • AACTGTGGGA ATA------- ---CTCAGGT ATCGTAAGAT -GCAAGAGTT CGAATCTCTT AACGAAAGTG TTTGTTTAAT GCGTTCTGGT CCTCTCTGAG GGCGTGGGTT CGAATCCCAC 1 61 GGTTGTTTGG CCGAGCGGTC TAAGGCGCCT GATTCAAGAA --AAAATCTT GACCGCAGTG * GTCAGGATGG CCGAGCGGTC TAAGGCGCCA GACTCAAGAT TGAAAATCTT --ACTTTCTG I I LT1 LT1 -561 5' 1. 2. 3. 3' GTTAGCTTC GCTATTTAGC GAAAATCGCA TTTTGTTAAA ATTACAGACAT ••• • •••••• ••••••• •• AGTTTAGTAC GCCTTCCAGT CTGCTACGCC TCTTGCATCC GTAAATACAT ATATTGT GTTTCATTGG CGTAAATGCG TCTTlTGACA GAAATCAGCACAA GCTGTTCGTC GCATTTACTC TCAAAAAGC G TTTGG CAAAA AAGAACGCAT d AGTTTA GTAC GCCTTCCAGT CTGCTACGCC TCTTGCATCC GTAAATACAT O ATCAGAATTG CTATTTGGTA AAACTGGCAT TTTGGCAGCT GTG CATAAAT e •• ••••• ••••• • ••••••• 5. •• • •• • •••• • • • • • ••• AGTTTAGTAC GCCTTCCAGT CTGCTACGCC TCTTGCATCC GTAAATA CAT 8. 9. 10. 11. 12. 13. 14. 15. C 0 ••••••••••••• • •• •• •• AGTTTAGTAC GCCTTCCAGT CTGCTACGCC TCTTGCATCC GTAAATA CAT 7. b a •• • • • • • • •••••• ••••• AGTTTAGTAC GCCTTCCAGT CTGCTACGCC TCTTGCATCC GTAAATACAT 4. 6. t RNl % gene homology TTCTAAGC TTCACAAATT TTACTAATAT TTTTTTTCAA TGCATTC CATGG ATATTGTGTT TCATTGGCGT AAATGCGTCT TTTGACAGAA ATCAGCACAA •••••••••••••• ••• • • ••• GTTAGCTTCG CTATTTAGC G AAAATC GCAT TTTGT TAAAA TTA CAGA CAT GCTGTTCGTCG CATTTACTCT CAAAAAGCGT TTGGCAAAAA AGAACGCAT • • ••• • •• • ••• •• • •• • •••• • • GTTAGCTTCG CTATTTAGCG AAAATCG CAT TTTGlTAAAA TTACAGACAT O bh O C b d b ATCAGAAT TG CTATTTGGTA AAACTGGCAT TTTGGCAGCT GTGCATAAAT e GTTAGCTTCG CTATTTAGCG AAAATCGCAT TTTGTTAAAA TTACAGACAT b •••••••••••• ••••••••••••• • ••••• TTCTAAG CTTCA CAAATTTTAC TAATATTTTT TTT CAATGCA TTCCATGG • •••••• • • •• •• • ••• ••••• GTTAG CTTCG CTATTTAGCG AAAATCGCAT TTTGTTAAAA TTACAGACAT bh b GCTGTTC GTC GCATTTACTC TCAAAAAGCG TTTGGCAAAA AAGAACGCAT d ATATTG TG TT TCATTGGCGT AAATGCGTCT TTTGACAGAA ATCAGCACA A C ATCAGAATTG CTATTTGGTA AAACTGGCAT TTTGGCAGCT GTGCATAAAT e • •• •••• • • •••••••••••••• •• • ••• • ••• • • •••• ••• • • • ATATTGTGTT TCATTGGCGT AAATGCGTCT TTTGACAGAA ATCAGCACAA TTCTAAGC TTCA CAAATTTTAC TAATATTTTT TTTCAATGCA TTCCATGG If • •• ••• ATATTGT GTT TCATTGGC GT AAATGCGTCT TTTGACAGAA ATCAGCACAA C AT CAGAATTG CTATTTGGTA AAACTGGCA T TTTGGCAG CT GTG CATAAAT e GCT GT TCGTC GCAT TTA CTC TCAAAAAGC G TTTG GCAAAA AAGAAC GCA T d • •••• • • ••••••• • • •• TTCT AAGC TTCACAAATT TTACTAATAT TTTTTTTCAA TGCATTCCATGG * I • • • ••• •• • ••• GCTGTTCGTC GCATTTACT C TCAAAAAG CG TTTGGCAAAA AAGAA CGC AT ■ ■ ■■ TTCTAAG CTTCA CAAATTTTAC TAATATTTTT TTTCAATGCA TTCCATGG • •• • • • •• •• • ••• •• • ••• ATCAGAATTG CTATTTGGTA AAACTGGCAT TTTGGCAGCT GTGC ATAA AT Figure 9 38 40 40 36 44 48 62 44 46 44 C bh • ••••••••• 38 36 36 bh d 36 bh e 40 -57- APPENDIX I Nucleotide Sequence of Drosophila Sequences of p50AB: Sequence from the Sal I site extending 50 nucleotides beyond the Eco RI site. 10 30 150 20 140 40 50 60 10 80 90 100 110 120 160 170 180 190 200 210 220 230 2 40 260 270 280 290 300 310 320 330 340 350 360 380 390 400 410 420 430 440 450 460 470 480 520 530 540 550 560 570 580 590 740 750 760 770 780 790 800 810 820 830 840 360 870 880 890 900 910 920 930 940 950 960 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 ATACAACAGT TGCAGTCAAA CCAACATGGA AGGTATTGTT AGCTTCGCTA TTTAGCGAAA ATCGCATTTT GTTAAAATTA CAGACATGGC CCATTAGCTC AGTTGGTTAG AGCGTCGTGC TATGTTGTCA ACGTCAGTTT GGTTGTACCT TCCATAACAA TCGAAGCGAT AAATCGCTTT TAGCGTAAAA CAATTTTAAT GTCTGTACCG GGTAATCGAG TCAACCAATC TCGCAGCACG 970 TAAATCTTGA GTCTGG CGCC TTAGACCGCT CGGCCATCCT GACATAGCCA AACTCGTGTC CGATTCCGTA GTAGCGCGCG AGCCAGCGCA TGTGCCAGTA CTAGAACAAT TCTATTCGTA ATTTA GAACT CAGACCGC GG AATCTGGCGA GCCGGTAGGA CTGTATCGGT TTGAGCACAG GCTAAGGCAT CATCGCGCGC TCGGTCGCGT ACACGGTCAT GATCTTGTTA AGATAAGCAT 850 AAATTTATCA ACCATTCAAA AACAAAACCA CTAAAAAAAT TTTGTCAGAA GTGGGATTCG AACCCACGCC CTCAGAGAGG ACCAGAACGC TCATACACTT TCGTTCAGAA AGTAAGATTT TTTAAATAGT TGGTAAGTTT TTGTTTTGGT GATTTTTTTA AAACAGTCTT CACCCTAAGC TTGGGTGCGG GAGTCTCTCC TGGTCTTGCG AGTATGTGAA AGCAAGTCTT TCATTCTAAA 730 61 o 620 630 640 650 660 670 680 690 700 710 720 CATTTTCATA CTGTAATCCC CCTTAAAAAT AAATTTTATA ATTATGTTAT GATTGAACAA CCGCAATTCT GTATTTCTTA AATTTTATTG TAAAATATAT TTTTATAGGT TAGGTAGAAA GTAAAAGTAT GACATTA GGG GGAATTTTTA TTTAAAATAT TAATACAATA CTAACTTGTT GGCGTTAAGA CATAAAGAAT TTAAAATAAC ATTTTATATA AAAATATCCA ATCCATCTTT 510 I 500 600 490 CATAGCAAA A CAAAAAA CTT TGCCTAATAA ATTTTAAGTG GGCATTAATT TAAACAATTT AATATACAAT ACTTGTTAAG TTTTTGCGCG AAATTTGTGG AATAAAGTTA ATAAGTTAGT GTATCGTTTT GTTTTTTGAA ACGGATTATT TAAAATTCAC CCGTAATTAA ATTTGTTAAA TTATATGTTA TGAACAATTC AAAAACGCGC TTTAAACACC TTATTTCAAT TATTCAATCA I lJl OJ GGGGATCGAA CCCG CGAC CT TCGCGTTATT AGCACGACGC TCTAACCAAC TGAGCTAATG GGCCATGTAT TTACGGAT GC AAGAGGCGTA GC AGACTGGA AGGCGTACTA AACTGAAAAT CCCCTAGCTT GGGCGCTGGA AGCGCAATAA TCGTGCTGCG AGATTGGTTG ACTCGATTAC CCGGTACATA AATGCCTACG TTCTCCGCAT CGTCTGACCT TCCGCATGAT TTGACTTTTA 370 GGCCAAGTGT CAGACTGACA AATGATATGA AAGGTCTAAG GACCAAGCCT AAGGGTATTC ATCCTTAGGC ATCTACTAAA AAACGTAAAG CATTATAAAA AAAGTTCGAC TGGCCCATGA CCGGTTCACA GTCTGACTGT TTACTATACT TTCCAGATTC CTGGTTCGGA TTCCCATAAG TAGGAATCCG TAGATGATTT TTTGCATTTC GTAATATTTT TTTCAAGCTG ACCGGGTACT 250 TAAGCGGCCA AGAAATCAAT TTAAGCTAGC TTTAGCCCTT TGTTAATGGG TTATCAAGAT TTACATGCAC GCAAAACGCT TGGTAATTAG TTATCACACA TCTGGATGTC AAAACTGGAA ATTCGCCGGT TCTTTA GT TA AATTCGATCG AAATCGGGAA ACAATTACCC AATA GTTCTA AATGTACGTG CGTTTTGCGA ACCATTAATC AATAGTGTGT AGACCTACAG TTTTGACCTT 130 GTCGACGAGT GGGAAAGCAA CAGAGCAACT CAACATCAAG TGCTTGCCTT GGCGGGGTGG GGCGGGTGGA TTTTGATTTT TGTATTAGCG GGCGGCGGTT GGTTGCCAGA CCGCGGAAAG CAGCTGCTCA CCCTTTCGTT GTCTCGTTGA GTTGTAGTTC ACGAACGGAA CCGCCCCACC CCGCCCACCT AAAACTAAAA ACATAATCGC CCGCCGCCAA CCAACGGTCT GGCGCCTTTC 1100 1220 1090 1210 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1240 1250 1260 1270 1280 1290 1300 1310 1320 1350 1470 1340 1460 1450 1360 1370 1380 1390 1400 1410 1420 1430 1440 1490 1500 1510 1530 1650 1520 1640 1540 1550 1560 1580 1700 1690 1590 1600 1610 1620 1630 1660 1670 1680 1720 1730 1740 1750 1760 1770 1780 1790 1800 1820 1940 1930 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1960 1970 1980 1990 2000 2010 2020 2030 2040 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 AACTAATACG CTCCCAACAT AATATACTAC TGTTAAATAC AACTGTTAAC AGATTTATCA GAATTGCTAT TTGGTAAAAC TGGCATTTTG GCAGCTGTGC ATAAATGGCC CATTAGCTCA TTGATTATGC GAGGGTTGTA TTATATGATG ACAATTTATG TTGACAATTG TCTAAATAGT CTTAACGATA AACCATTTTG ACCGTAAAAC CGTCGACACG TATTTACCGG GTAATCGAGT 2050 TTTCTGAACA TCCTGATTAC TTTGAGGTTC AAAGCCTTGG CTTTCCAATT GCCAACCGCG AGAAAACTAA CTGTTGCAAG CAAAAATTTT TTTTGAATAC ACCGTGTATA ACAGTGCTAC AAAGACTTGT AGGACTAATG AAACTCCAAG TTTCGGAACC GAAAGGTTAA CGGTTGGCGC TCTTTTGATT GACAACGTTC GTTTTTAAAA AAAACTTATG TGGCACATAT TGTCACGATG 1950 TACTCTCAAA AAGCGTTTGG CAAAAAAGAA CGCATGGCCC ATTAGCTCAG TTGGTTAGAG CGTCGTGCTA ATAACGCGAA GGTCGCGGGT TCGATCCCCT CATGGGCCAG ATATTTTTTA ATGAGAGTTT TTCGCAAACC GTTTTTTCTT GCGTACCGGG TAATCGAGTC AACCAATCTC GCAGCACGAT TATTGCGCTT CCAGCGCCCA AGCTAGGGGA GTACCCGGTC TATAAAAAAT 1810 CGAATCCGTT TGCTTGGTAT TGACTAAGAA ATGGGAATTA TCAGGAATTG TCCGACGTTG AGGTCCTATG CATTCCGAAT CTTTGGTTCA GTGACCAATT CTACGGCTGT TCGTCGCATT GCTTAGGCAA ACGAACCATA ACTGATTCTT TACCCTTAAT AGTCCTTAAC AGGCTGCAAC TCCAGGATAC GTAAGGCTTA GAAACCAAGT CACTGGTTAA GATGCCGACA AGCAGCGTAA 1710 AAATAGTTAA CTTGTACATA GGCACACCAT TTTTGTGAAT TTAACAAATG CTAAGAATAC CTAGGGTATT TAAGTCATCA CTAGTTCTTT TTTACCCTAG GAGAGACAAT TTACTGATCA TTTATCAATT GAACATGTAT CCGTGTGGTA AAAACACTTA AATTGTTTAC GATTCTTATG GATCCCATAA ATTCAGTAGT GATCAAGAAA AAATGGGATC CTCTCTGTTA AATGACTAGT 1570 TGTTATATAC ATATTTACAG CTGAATAATA TACATAATTA ATAAATAATA ATAATCCCTC GAAAATAGTT CTCAAGCAGT GATTTCAATA TGCGTACTTA TGAACTCAAT TATTGAGACA ACAATATATG TATAAATGTC GACTTATTAT ATGTATTAAT TATTTATTAT TATTAGGGAG CTTTTATCAA GAGTTCGTCA CTAAAGTTAT ACGCATGAAT ACTTGAGTTA ATAACTCTGT 1480 TAAATGCGTC TTTTGACAGA AATCAGCACA AGGCCCATTA GCTCAGTTGG TTAGAGCGTC GTGCTAATAA CGCGAAGGTC GCGGGTTCGA TCCCCTCATG GGCCAAACAT TCTTTTTTCT ATTTACGCAG AAAACTGTCT TTAGTCGTGT TCCGGGTAAT CGAGTCAACC AATCTCGCAG CACGATTATT GCGCTTCCAG CGCCCAAGCT AGGGGAGTAC CCGGTTTGTA AGAAAAAAGA 1330 AAAAGAATAT GCTGAACGCA TCATTGAAAT CCTTTATGC- TTTTATTTCA TTTTACGGAT AGAAATTTAT GTCTTTTACA CAACTTGTGG ATAAAAGCTC AATATTGTGT TTCATTGGCG TTTTCTTATA CGACTTGCGT AGTAACTTTA GGAAATACG- AAAATAAAGT AAAATGCCTA TCTTTAAATA CAGAAAATGT GTTGAACACC TATTTTCGAG TTATAACACA AAGTAACCGC 1230 TAATAACGCG AAGGTCGCGG GTTCGATCCC CTCATGGGCC AGGTGAATTT TTTGTATCAT CCCCCCCACA AGGTCTTTTA AAGATACTAA GGAAAATCAC CGAATTATAT GATAATTTTG ATTATTGCGC TTCCAGCGCC CAAGCTAGGG GAGTACCCGG TCCACTTAAA AAACATAGTA GGGGGGGTGT TCCAGAAAAT TTCTATGATT CCTTTTAGTG GCTTAATATA CTATTAAAAC I Ul I I.O 2180 2300 2420 2170 2290 2410 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2320 2330 2340 2350 2360 2370 2380 2390 2400 2440 2450 2460 2470 2480 2490 2500 2510 2520 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2660 2670 2680 2690 2710 2830 2700 2820 2720 2730 2740 2750 2760 2790 2910 2780 2900 2890 2800 2810 2840 2850 2860 2870 2880 2930 2940 2950 2960 2970 2980 2990 3000 3030 3150 3020 3140 3040 3050 3060 3070 3080 3090 3100 3110 3120 3160 3170 3180 3190 3200 3210 3220 3230 3240 TCCCTGAATC CAGATTTCAG TCAGGTTAAA AAAGTTGTAT ATTTTTATAT CAATATAAGC CATGTCGGAA GAGCAGCCAT CGAGCTCGTT GCTCAAGCCC ATTCTAATCA TGAAGGATAT AGGGACTTAG GTCTAAAGTC AGTCCAATTT TTTCAACATA TAAAAATATA GTTATATTCG GTACAGCCTT CTCGTCGGTA GCTCGAGCAA CGAGTTCGGG TAAGATTAGT ACTTCCTATA 3130 CCATTGTATT AAATTAATAT ATAAATTCGT GACATATTTT TAGCAGGAAA ACGAAAAACG AAAAACGAAA ACTATCGTAG TAGCATTGAA ACATATAGTG TCAAATTTAG TTCTTATCAA GGTAACATAA TTTAATTATA TATTTAAGCA CTGTATAAAA ATCGTCCTTT TGCTTTTTGC TTTTTGCTTT TGATAGCATC ATCGTAACTT TGTATATCAC AGTTTAAATC AAGAATAGTT 3010 AACAATGCAA AATTATTAAA TAATCAAATA TATATTTGCG TATACTTTTG AAAGATCTCT CTTTTGGGTT CACCTATATA AATACGTGAC CAATAAATAA AATGGTAACA AATACATTTG TTGTTACGTT TTAATAATTT ATTAGTTTAT ATATAAACGC ATATGAAAAC TTTCTAGAGA GAAAACCCAA GTGGATATAT TTATGCACTG GTTATTTATT TTACCATTGT TTATGTAAAC 2920 TACTTTCTGA ACGAAAGTGT TTGTTTAATG AGCGTTCTGG TCCTCTCTGA GGGCGTGGGT TCGAATCCCA CTTCTGACAA ATATTTTTTT AAGCCCAAAG AAATTAACAA TGATTTGACA ATGAAAGACT TGCTTTCACA AACAAATTAC TCGCAAGACC AGGAGAGACT CCCGCACCCA AGCTTAGGGT GAAGACTGTT TATAAAAAAA TTCGGGTTTC TTTAATTGTT ACTAAACTGT 2770 CCTAATTTAT TGGTTCAACG CCCCATTTTG TATATACTTT TATGACACTA GATTTTGGGC GCGGAATCAG TGTCAGGATG GCCGAGCGGT CTAAGGCGCC AGACTCAAGA TTGAAAATCT GGATTAAATA ACCAAGTTGC GGGGTAAAAC ATATATGAAA ATACTGTGAT CTAAAACCCG CGCCTTAGTC ACAGTCCTAC CGGCTCGCCA GATTCCGCGG TCTGAGTTCT AACTTTTAGA 2650 CTTCTCCGCG TGTGAGGTAT CTAATTGCTT GGCAATCAAG CTAAACGGTT TATTGAACGA TCTTATCTTC GTAACGAGTT GAAAATGCTT TTAGACAATA TAATGGCAAA CAGAGAACAT GAAGAGGCGC ACACTCCATA GATTAACGAA CCGTTAGTTC GATTTGCCAA ATAACTTGCT AGAATAGAAG CATTGCTCAA CTTTTACGAA AATCTGTTAT ATTACCGTTT GTCTCTTGTA 2530 TCACATAAAG CCGACAAGGA TGATCTAACG AGGTCTATTT CTCGCAAGGC GGCTAAGTGA AATGTCAATT CAATTTACCA TCAAGGATGA TTGAATTTCC CGTCCCTTTA GCCGACCCAA AGTGTATTTC GGCTGTTCCT ACTAGATTGC TCCAGATAAA GAGCGTTCCG CCGATTCACT TTACAGTTAA GTTAAATGGT AGTTCCTACT AACTTAAAGG GCAGGGAAAT CGGCTGGGTT 2430 TTGATGAGAA CGTGTCCCGC AAGCTTTTTG TACAAACCTA GATAAGCGAA GCCAATTATG GACGGCTGCT AATGTTATCT CATGCCGTGC ATGCTAGGAC AGTGAGTACC TGCGATGATG AACTACTCTT GCACAGGGCG TTCGAAAAAC ATGTTTGGAT CTATTCGCTT CGGTTAATAC CTGCCGACGA TTACAATAGA GTACGGCACG TACGATCCTG TCACTCATGG ACGCTACTAC 2310 GTTGGTTAGA GCGTCGTGCT AATAACGCGA AGGTCGCGGG TTCGATCCCC TCATGGGCCA GAATAATTTT TTTTTATTAC ATTTCTAATG CACTTTGAAA ATTAAAAAGT TAGTATAGAT CAACCAATCT CGCAGCACGA TTATTGCGCT TCCAGCGCCC AAGCTAGGGG AGTACCCGGT CTTATTAAAA AAAAATAATG TAAAGATTAC GTGAAACTTT TAATTTTTCA ATCATATCTA I 0 I (j\ 3260 3380 3250 3370 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3400 3410 3420 3430 3440 3450 3460 GGCGCCTTAT GTCCGACAAC GACTTGGTAG GTACAGAAAC ACCACAGGCA TGAATTCCCC ATTGATACGG TCTGTGGGCT TTTCAGCGCC AGAGCATGCC GA CCGCGGAATA CAGGCTGTTG CTGAACCATC CATGTCTTTG TGGTGTCCGT ACTTAAGGGG TAACTATGCC AGACACCCGA AAAGTCGCGG TCTCGTACGG CT 3390 CGATTTGGAC GGAGCAGGTG ATGGCATCGG TAAGGAGTCC TCGAAGACAA AGAAGCATGT AACCGTTCAA CCGGATGGTG GAGTATTATA CCTACTCGGA AACTTTGAGC AGCTGGAATA GCTAAACCTG CCTCGTCCAC TACCGTAGCC ATTCCTCAGG AGCTTCTGTT TCTTCGTACA TTGGCAAGTT GGCCTACCAC CTCATAATAT GGATGAGCCT TTGAAACTCG TCGACCTTAT I I O"'I I-' -62- Appendix II Sequence Organization of Drosophila tRNA Genes [Reprint from ICN-UCLA Symposium on Eucaryotic Gene Regulation, R. Axel and T. Maniatis, eds. (Academic Press, New York), 1979.] -63- EUCARYOTIC GENE REGULATION SEQUENCE ORGANIZATION OF DROSOPHILA tRNA GENES 1 Pauline Yen, N. Davis Hershey, Randy R. Robinson, and Norman Davidson Department of Chemistry, California Institute of Technology Pasadena, CA 91125 ABSTRACT The tRNA gene cluster at region 42A of chromosome arm 2R of the Drosophila melanogaster genome has been mapped on a number of recombinant DNA molecules with overlapping Drosophila inserts. The cluster extends over a region of 46 kb and confains at least 18 tRNA qenes. It contains several tRNA2 YS, tRNA 2arg, and tRNAasn genes that are mutually interspersed and irregularly spaced. A preliminary account of experience with BentonDavis screening for A plaques with inserts carrying tRNA genes is given. INTRODUCTION Saturation hybridization experiments indicate that there are 600-800 tRNA genes in the haploid genome of Drosophila melanogaster. (l,2,3) There are about 90 resolvable peaks when total l:An tRNA is fractionated by RPC-5 chromatography(4). From an analysis of the kinetics of tRNA-genomic DNA hybridization, Weber and Berger estimate that l:An tRNA is made up of about 59 kinetic families (3). These data suggest that there are approximately 60-90 different tRNA sequences (i.e., species) in Drosophila and an average reiteration frequency for any one species of six to 13. Steffensen and Wimber (5) and later Elder, Szabo and Uhlenbeck (6) have mapped the sites on polytene chromosomes to which total labeled l:An tRNA hybridizes. In the latter study, 54 sites were mapped by hybridization of 125 !-labeled tRNA to polytene chromosomes. Of these 26 were estimated by grain counts to be strong sites with 4 or more gene copies, and 28 were weak with 1-3 gene copies. These sites are listed in Table l. The authors noted that other sites, such as those with small numbers of tRNA genes, those with tRNA genes of low 1This work was supported by a grant GM 10991 from the United States Public Health Service. 133 CC>p)'fllb1 • 1979 by A<acienuc P-, Inc. All riplt of reproduction in any (orm rnerved. ISBN 0-1 :M>61350-4 -64- 134 13. PAULINE YEN et al. abundance, or those on portions of the genome that are underreplicated in polytene chromosomes (e. g ., the Y chromosome) may not have been detected. Several laboratories have carried out in situ studies on purified tRNAs. Some of these results are also reported in Table l (7,8,9,10). The overall conclusions from these studies are that most of the tRNA genes of Drosophila are clustered at a limited Table 1 Orosophila 4S RNA Sites• .! ll. ?.E lh ~ i 30 22DE 41CO 610 Met3 84A Met2 none JF 23EF *4 2A Asn Arg2, Lys2 •6 2A Lys2 -Glu4 840 Va13b 84F Arg2 5F6A 240E 42( Lys2 63A 11 A *27D *4JA ~ 878C .:fil 280 44EF 640E Val 3a 87F88A 898C Val4 28FzgA 46A Met) 668 290 48AB Metz 678 90C Va13b 48C~ 69F70A 900( • 34A 49A8 70BC Va14 * 91C 35A8 ~ 700E 92A8 Va13b *5 08C Lys2 72F * 73A Met2 93A 52F53A Glu4 79F Asp2 29E 95F96A 54A 97CO ;40 99EF 55EF 560 Val4 * 56F Glu4 570 58A8 60E •The l ocus assignments in hea vy type were made by Elder et al . (f ) using total tRNA. Sites that were heavily labeled are unoerlined. of the tab·le are ass ignments made using purified tRNA's a ssignments for recombinant Charon laboratory. Elde r labeled Entries to th e side of the main columns (5,6,7,8,9,10). Asterisks indicate plaques that give strong tRNA signals, isolated in our Entries in italics are in sJt:u assignments that may be different from those of et ol. (6) . -65- EUCARYOTIC GENE REGULATION 135 number of sites, perhaps 54 to 60, on the polytene chromosomes; that some of these clusters contain more than one species of tRNA gene; and that for some tRNA species there are genes at 2 or more sites. We have previously described our initial studies of the sequence arrangement of the tRNA genes on a cloned fragment of Om tRNA of length 9 kb (11). This fragment was shown by in situ hybridization to map at region 42A of chromosome 2R. In si tu studies with labeled total Dm tRNA had shown that 42A is one of the richest tRNA gene clusters in the Drosophila melanogaster genome (5). In the present communication, we describe the present status of our further studies of the sequence organization of tRNA geQes in cloned DNA derived from this region of the chromosome. We also give a preliminary account of our experience in screening for recombinant \ plaques with Drosophila tRNA genes. EXPERIMENTAL A recombinant "library" of nuc_lear Dm DNA inserted into the modified A bacteriophage Charon 4 (12) has been constructed. High molecular weight nuclear Dm DNA was partially digested with EcoRl to varying extents (5%, 7.5%, 14%, 20%, 31 % and 57 %) of total digestion. Fractions of length 22±4 kb were isolated from each digest by sucrose gradient velocity sedimentation. Equal masses of sized DNA from each digest were combined and then ligated to annealed EcoRl ends of Charon 4 DNA. The ligation products were packaged i n vi tro (13,14) to yield 2 x 10 6 recombinant plaque forming units. The library contains inserts ranging in size from 12 to 20 kb, and contains less than 1% Charon 4 contamination. Library D'n DNA is representative of the single copy D'n genome as demonstrated by its ability to drive 95~; of single copy tracer into duplex with a cot½ of 280, compared to 270 for nuclear [An DNA driver. The other experimental methods used here are all standard, and are referred to where nece s sary in the Results section. RESULTS a) The Gene Cluster at 42 A. The plasmid pCIT12 described in our initial study (11) contains a Dm DNA segment of length 9.3 kb fused to the vector Col El. Fig. l includes a map of the Eco Rl cleavage sites and identified positions of tRNA genes on this insert. The methods by which the tRNA genes have been mapped and identified will be discussed later. -66- 136 13 . PAULINE YEN et al. .... <> q ~ ~ <> C q <t z ~:"~~~i ~~ "' - - --- -- ...J <l<l.....J_J...J<l<l -10 I I l li 0 <t ;~; <l<l<l'. 10 11 20 HI I iii I A 8 •9 . . . . . . - - - - ' " x,-1-3.-15--;:_ , ----=--~ l~Z=•-b~.=: CA z "' 30 I JJ i 40 ~ li 50 I 0CJ1 12 '=-========'=: ~ Al2 .1 4 I - - - - - - - < 19111. b 16 8 .1 1 1 - - - - - - - - < X59 ,___ _ _-=-,E X35. 5 4 FIGURE 1. Om inserts in Charon 4 phage covering the region 42A. The scale is in kilobases (kb). ! denote EcoRl clevage sites. Capital letters denote EcoRl restriction fragments referred to in the text. Note that fragment A of pCIT12 contains the Col El vector as well as segments on both ends of the insert. Positions of tRNA genes were determined by blotting experiments with labeled total or purified tRNA probes as described in the text. It seemed probable from the strong i n si t u hybridization of total Om tRNA to locus 42A that the 9.3 kb segment of pCIT12 does not include the entire gene cluster at locus 42A. This inference was confirmed by our initial studies of Charon 4 recombinant molecules with inserts that overlapped with pCIT12, and by the studies of P. Gergan and P. Wensink who have independently isolated a Om plasmid which partially overlaps with pCIT12 but extends further to the right (given the arbitrary orientation of the map of Fig. 1) and includes additional tRNA genes. We therefore wished to detennine the total extent of the tRNA gene cluster of band 42A which includes pCIT12. For this purpose we have engaged in the procedure of "walking down the chromosome". Initial attempts to isolate recombinant molecules with adjacent sequences from the Charon 4 library using pCIT12 DNA as a probe gave many plaques with inserts derived from other regions of the genome. This was due to the presence of repeated sequences in the EcoRl fragment C of pCIT12. Therefore, a DNA segment consisting of the 2 Rl segments A and B of pCIT12 (which in addition to the [)n segment of the A fragment indicated in Fig. 1 includes the -67- EUCARYOTIC GENE REGULATION 137 6.7 kb of the vector ColEl) was subcloned. This DNA was labeled by nick translation and used as a probe in a BentonDavis screen (15) of the Charon 4 library. Note that this probe includes segments from the two ends of pCIT12 but excludes the internal segments. With the probe used, the phages Al6, A8, Al7, A9, All, Al3, A15, A12 und A14 of Fig. 1 were isolated. It was shown from the restriction patterns with several enzymes (data not shown in Fig. 1) t hat these inserts overlapped with pCIT12 as indicated in Fig. 1. A17 has a length of 18.8 kb, extends 16 kb beyond pCIT12, and overlaps it for about 2.8 kb. The restriction map of Al7 was determined. The rightmost EcoRl fragment, 17C, of length 8.7 kb was shown by chromosomal blots to contain mainly single copy sequences. It was subcloned and used as a probe to isolate an additional group of phage from the library. The restriction patterns of these phage were determined. Those that did not contain the EcoRl fragments 17D and 17F were selected for further study. These include A59, A35, and A54 . These three phage all end at a point 8 kb to the right of A17. The process was repeated using the 1 .6 kb fragment 35E and phage extending to the right selected. The phage A62 extends 9 kb beyond A35. • In the same way phage extending to the left of pCIT12 were selected. The phage All has a Dm DNA insert of length 18.4 kb and extends 13.3 kb beyond pCIT12. In a series of two additional steps which are obvious by inspection of Fig. 1, the phage A63 was isolated. Its end point is about 41 kb beyond the left end of pCIT12. Thus, the set of recombinant molecules cover a region of length 83 kb at locus 42A . .Preliminary tRNA gene assignments on some of the cloned segments have been made by Southern blotting experiments, using several different kinds of probes. Total Dm 4S RNA has been purified from Drosophila pupae as previously described (11) and labelled with 32 P either at the 5' end by T4 polynucleotide kinase or at the 3' end as (5'- 32 P)pCp with T4 RNA ligase (16). The specific activities achieved ejther way are approximately 2x 10 7 cpm/µg tRNA. However, the tRNA is less degraded by the 3' end labeling procedure. Specific genes have been identified with probes prepared by l abeling purified Dm t RNA species. These latter preparations were generous gifts from the laboratory of Dr. Dieter S~ll . Since the tRNAs are not always completely purified and contain other tRNA components as minor contaminants, and since the hybridizations are carried out in vast tRNA excess, care must be taken to carry out hybridizations for times such that only the major species gives strong spots in the autoradier graphs. Weak signals which are probably due to minor tRNA impurities have been disregarded in the tRNA gene assignments -68- 138 13. I • PAULINE YEN et al. •- • -• -• FIGURE 2. Blotting experiments with purified tRNA probes on appropriate restriction digests of the Eco Rl fragments C and D of Al7 (see Fig. 3) recloned in pBR322, as well as of a Hind III digest of \ll. The tRNAser probe was heavily contaminated with tRNA 2 lys and further experiments with purified tRNA 2 lys show that the positive signals are due to this tRNA (D. Soll, personal communication). Because of impurities in the tRNAs, only strong autoradiographic signals are interpreted as positive for the main tRNA component. in Figs. l and 3. An example of such a Southern blot experiment with several purified tRNA species is given in Fig. 2. The tRNA gene assignments given in Figs. l and 3 have been made, on the basis of experiments like those of Fig. 2 in our laboratory, in that of Dr. Dieter Soll (17), and by P. Gergan and P. Wensink (personal coITITiunication). Figs. land 3 show that the gene cluster at region 42A on chromosome arm 2R of the CATI genome contains multiple -69- EUCARYOTIC GENE REGULATION 139 . ... . ~ ..J ~; ~ ~ ~S...!!......!:... 7777777 1 ll :· ·:• l Eco R I IO .I 'T l 'r l l l f n° 25 I 1 222222 f Hi nd m ! Hpo I FIGURE 3. Restriction enzyme map and tRNA assignments for the DNA phage A17 from blotting experiments such as illustrated in Fig. 2. copies of tRNA genes for tRNA/rg, tRNA 2 lys, and tRNAasn. At least one tRNAtyr gene seems to be present. On the map in Fig. 1, there are two segments of DNA, one extending from 25 to 28 kb and one from -17 to -20 kb, which hybridize with a total RNA probe; experiments with specific tRNAs have not yet been performed. The hybridization experiments are not quantitative and the possibilities exist that: a) several genes for a particular species are present on a restriction fragment where only one has been assigned; b) there is a restriction endonuclease site sufficiently close to the center of a gene so that two restriction fragments hybridize to the tRNA probe even though there is only one gene; c) other as yet unidentified tRNA species, for which purified probes were not available, are also present. The map of pCIT12 (11,17, P. Gergan and P. Wensink, personal communication) and the present mapping studies of A17 (Fig. 3) show that the several species of genes are interspersed and irregularly spaced. At the level of resolution achieved at present, there is no evidence of extensive sequence homology in the regions flanking identical genes. It is apparent from these studies that there is a segment of DNA of length 47 kb in the region 42A on chromosome 2R of the Om genome which contains at least 18 tRNA genes. For a region of at least 14 kb on the right and 23 kb on the left there are no additional tRNA genes so that it is possible that this segment represents the complete tRNA gene cluster at region 42A. By in situ hybridization experiments, Tener et al. (7) have estimated that there are approximately 18 tRNA 2 1YS genes -70- 140 13. PAULINE YEN et al. in the haploid genome of Dn, and that these map at the sites 42A, 42E, 50B, 62A and 63B. The tRNA 2 arg genes have been assigned to chromosomal locations of 42A and 84F. It thus appears that at least for some of the repeated tRNA gene families of Drosophila, genes are located at several widely spaced loci; within each locus, the genes are irregularly spaced and interspersed with other tRNAs. The functional significance of this pattern remains an intriguing, unsolved problem. b) Screening for tRNA genes. It may be useful to describe our preliminary experiences in screening a Charon 4 recombinant library for tRNA genes. Fig. 4 is an example of hybridizations of A plaques adsorbed on to duplicate nitrocellulose filters by the Benton-Davis procedure (15). Hybridizations were carried out with 5' 32 P labeled total pupal tRNA. The plate in Fig. 4 contains about 1700 plaques. Of these, 29 gave apparent duplicate positive signals. These positive p1aques were pi eked and rep 1a ted. Seventeen gave FIGURE 4. Duplicate Benton-Davis (15) screens of the Charon 4 Drosophila library. Each plate contained about 1700 plaques. Hybridizations with 5' 32 P labeled tRNA were conducted with O. 15 µg/ml tRNA ("'2 x 10 7 cpm/µg) for 15 hrs at 68°C in 1.0 M NaCl, 0.050 MTris, pH 8; 1 mM EDTA, 10 x Denhardt's solution, 0.1 % SOS, 0.1 % sodium pyrophosphate, and 20 µg/ml Om rRNA. -71- EUCARYOTIC GENE REGULATION 141 positive plaques on at least one rescreen; thirteen were positive on duplicate rescreens. Nine of the strongest spots were selected for further study. Similar results were obtained in screening the entire library (10 plates). Comparable results were obtained using 125 I labeled tRNA probes. A number of the plaques which gave strong signals were purified and characterized by hybridization, with the results recorded in Table l. At the present time, we do not know the sensitivity of the screening procedure. We suspect however that, with improvements in labeling and hybridization procedures, plaques with 3 or 4 tRNA genes can be identified. ACKNOWLEDGMENTS We are indebted to Ors. Dieter Soll, Olke Uhlenbeck, and Pieter Wensink for several personal communications. The purified tRNA's used were a generous gift from the laboratory of Dr. Dieter Soll. Department of Chemistry Contribution #5997. REFERENCES 1. Ritossa, F.M., Atwood, K.C. and Spiegelman, S. (1966). Genetics. 54, 663. 2. Tartof, K.D. and Perry, R.P. (1970). J. Mol. Biol. 98,503. 3. ~Jeber, L. and Berger, E. (1976). Biochem. 15, 5511. 4. White, B.N., Tener, G.M., Holden, J. and Suzuki, D.T. (1973). Dev. Biol. 33, 185. 5. Steffensen, D.M. and Wimber, D.E. (1971). Genetics. 69, 163. 6. Elder, R., Szabo, P. and Uhlenbeck, 0. (1979). Cold Spring Harbor Symposium on tRNA. in press. 7. Tener, G.M., Hayashi, S., Dunn, R., Delaney, A., Gillam, I.C., Grigliatti, T.A., Kaufman, T.C. and Suzuki, D.T. (1979). Cold Spring Harbor Symposium on tRNA. in press. 8. Dunn, R., Hayashi, S., Gillam, I.C., Delaney, A.O., Tener, G.M., Grigliatti, T.A., Kaufman, T.C. and Suzuki, D.T. (1979). J. Mol. Biol. in press. 9. Kubli, E. and Schrr.idt, T. (1978). Nucl. Acid Res. 5, 1465. 10. Schmidt, T., Egg, A.H. and Kubli, E. (1979). Molec. Gen. Genet. in press. 11. Yen, P.H., Sodja, A., Cohen, M., Conrad, S.E., Wu, M., Davidson, N. and Ilgen, C. (1977). Cell. 11, 763. 12. Blattner, F.R., Williams, B.G., Blechi, A.E., Thompson, K.D., Faber, H.E., Furlong, L.A., Grunwald, D.J., Kiefer, 0.0., Moore, 0.0., Schumm, J.W., Sheldon, E.L. and Smithies, 0. (1977). Science. 196, 161. -72- 142 13. PAULINE YEN et al. 13. Maniatis, T., Hardison, R.C., Lacy, E., Lauer, J., O'Connell, C., Quon, D., Sim, G.K. and Efstratiadis, A. ( 1978) . Ce 11 . 15, 687. 14. Sternberg, N., Tiemeier, D. and Enquist, L. (1977). Gene. l , 255. 15. Benton, i·i.D. and Davis, R.W. (1977). Science. 196, 180. 16. England, T.E. and Uhlenbeck, O.C. (1978). Nature. 275,560. 17. Schmidt, 0., Mao, J.-I., Silverman, S., Hovemann, B. and Soll, D. (1978). Proc. Natl. Acad. Sci. USA. 75, 4819. -73- APPENDIX III Recombinant DNA Studies of DNA Sequence Organization Around Actin and tRNA Genes of Drosophila melanogaster [Reprint from RNA Polymerase, tRNA and Ribosomes: Their Genetics and Evolution, S. Osawa, H. Ozeki, H. Uchida, and T. Yura, eds. (University of Tokyo Press), in press.] -74- RECOMBINANT DNA STUDIES OF DNA SEQUENCE ORGANIZATION AROUND ACTIN AND tRNA GENES OF DROSOPHILA MELANOGASTER Norman Davidson Eric A. Fyrberg N. Davis Hershey Karen Kindle Randy R. Robinson Ann Sodja* Pauline Yen Department of Chemistry California Institute of Technology Pasadena, California 91125 USA *Department of Biology Wayne State University Detroit, Michigan 48202 USA Running Title: Actin and tRNA Genes of Drosophila -75- Abstract The construction and characterization of a Drosophila recombinant DNA library with inserts of length 12-20 kb in the lambda vector Charon 4 is described. The library represents 95 :!:_ 5% of the Drosophila genane. A recombinant clone containing a Drosophila actin gene has been selected and mapped. The actin gene consists of a 5' proximal exon of length 60-100 nucleotides, an intervening sequence (intron) of length 1.6 kb, and a main exon of length 1.6 kb. The tRNA gene cluster around locus 42A of the Drosophila chromosome has been characterized. There are at least 14 tRNA genes in a region of length 50 kb, flanked on each site by segments of length 20 kb with no tRNA genes . At least 5 different tRNA species are present, and they are distributed in an irregular, interspersed pattern. -76- Introduction We wish to describe several applications of recombinant DNA methodology to study the organization of expressed genes and their flanking sequences in the DNA of a higher eukaryote. The examples considered are the actin genes and one particular subset of tRNA genes in Drosophila melanogaster. We also discuss the problem of preparing a set of recombinant clones which includes almost all of the sequences in the Drosophila genome. The Drosophila Library If random fragments of the genomic DNA from a particular organism are cloned in a bacterial host, and if the number of fragments is sufficient so that a substantial fraction of the total genome of the organism is included, this collection of clones is called a "library" (l) . . A library of Drosophila recombinant DNA molecules cloned in the vector Charon 4 (2) has been prepared. Fig . l 8 to 22 kb. This particular vector has a cloning capacity of The procedure for preparing the library is depicted in Fig. l. In brief, high molecular weight nuclear Om DNA was partially digested with EcoRl to varying extents (5%, 7.5%, 14%, 20%, 31%, and 57%) of total digestion. Fractions of lengths 22 :!:_ 4 kb were isolated from each digest by sucrose gradient velocity sedimentation. Equal masses of size fractionated DNA from each digest were combined and then ligated to cohered EcoRl arms of Charon 4 DNA. The ligation products were packed in vitro (3,4) to yield 2 x 106 recombinant plaque forming units. In spite of the effort to obtain only larger inserts by the size fractionation, we observe that the library actually contains inserts ranging in length from 12-20 kb. Less than 1i of plaque forming phage do not contain Drosophila inserts. 2 -77- Given a suitable radioactiv~ probe for a given gene, bacteriophage libraries can be successfully screened for those recombinant DNA molecules containing the gene by the rapid in situ plaque hybridization procedure of Benton and Davis (5). These technical accomplis~ments are described in detail by Maniatis et al., (1). A question of crucial important if one wishes to find a particular gene is that of the representation of the library, that is, the fraction of all sequences from the organisms's genome that is present in the library DNA. This problem admits a precise solution if the insert fragments are prepared by perfectly random shear. For this case, let L be the average length of the insert, G the haploid genome length, and N the number of independently formed bacteriophage in the library. The probability of not finding a given nucleotide in the library is then simply given as [1-(L/G)]N = exp (-NL/G) Thus, if L = 18 kbp (kilobase pairs) as for Charon 4 and G = 1.8 x 10 5 kbp as for Drosophila, approximately 40,000 independently derived bacteriophage should be screened to give a 98% probability of finding a particular sequence in the library. The extent to which an endonuclease partial digest library mimics a random shear library is not known. This probability depends on the extent and randomness of partial digestion, on the minimum insert length which is to be cloned, and on the length of the cloning window, that is the difference in length between the maximum and minimum inserts which can be cloned. This problem has been studied theoretically but a reliable numerical approximation to the theoretical equations is not available (6). 3 -78- A brief discussion of our experimental test of the representation of the library and of the parameters which, according to theory, influence the representation is given later in this article . The Actin Genes Actin is a major prote i n in both muscle and non-muscle cells. In vertebrates,protein sequence studies show that there are at least 6 distinct polypeptide sequences for actin extracted from skeletal muscle, cardiac muscle, smooth muscle (2 sequences) and non-muscle (2 sequences) cells (7). There must be at least one gene, but possibly more, coding for each actin polypeptide. In Dictyostelium the reiteration frequency of actin gene sequences has been estimated at 15-20, and there appear to be at least 2 different polypeptide sequences (8). Actin is an abundant protein in both muscle and non-muscle cells. However, unlike the globin and ovalbumin genes of vertebrates, there is no tissue or system in Drosophila from which it is practical to purify actin mRNA in sufficient purity to use it directly as a probe for selecting actin genes from the recombinant library. However, the similarities and properties in amino acid compo- sition of actin throughout the animal kingdom suggest that it is a highly conserved protein (9). Therefore it seemed probable that an actin nucleic acid probe isolated from some other animal would be useful for selecting Drosophila actin genes. The procedure that was used for isolating a Drosophila actin gene from the Charon 4 library was as follows. + Total poly A RNA was extracted from Drosophila larval cuticles in connection with a screen for abundantly expressed genes, in general. The larval cuticle cells contain significant amounts of 4 -79- actin protein and therefore presumably of actin mRNA. It was anticipated that actin mRNA would be present at a level of 0.5 -5% in such a preparation. A 32 P-labeled cDNA probe was prepared from this RNA, and used to perform a Benton-Davis in situ plaque hybridization screen (5) on 25,000 plaques from the library. Many plaques which gave positive signals of detectable intensity were observed; 20 which gave very strong signals were selected. screening procedure was carried out by Dr . Jay Hirsh. The above Phage were plaque purified from these 20 plaques and rescreened using a poly A+ mRNA preparation from chick embryo ~uscle that had been enriched for actin mRNA by sucrose velocity centrifugation . Three positive plaques were then selected. One of these gave a positive signal with a probe prepared from the cloned Dictyostelium actin gene (8). This bacteriophage contains the Drosophila actin ADmA2 recombinant molecule described below. A map of the Drosophila insert on the cloned DNA of ADmA2 is given in Fig. 2. Fig. 2 The positions of various restriction endonuclease sites, as well as of the sequences complementary to actin mRNA, are depicted. The actin gene has a total length of 3.3 kb . It consists of two regions coding for sequences present in actin mRNA (that is, two exons) separated by an intervening sequence (an intron) which is not present in the mature mRNA. The 5' proximal exon is a very short leader sequence of estimated length 60100 nt. This is followed (to the right in Fig. 2) by a 1.6 kb intron, which is in turn followed by the 1.6 kb exon which constitutes the main body of the actin mRNA. Actin polypeptides have a total length of approximately 375 amino acids . Thus the translated sequences in the mRNA are about 1.1 kb in length . The remaining sequences in the 1.7 kb mRNA are untranslated. The map in Fig. 2 has been established by electron microscopic mapping of R loop hybrids formed by hybridization of actin mRNA (present in total Drosophila s -80- RNA) to ADmA2 DNA under appropriate conditions (10). Several such micrographs demonstrating the presence of an intervening sequence and the RNA:DNA hybrid region, are shown in Fig. 3. Fig. 3 In addition to the electron microscopic mapping, the position of the main coding sequence within the two central Sal I fragments shown in Fig. 2 has been demonstrated by the now standard technique of Southern (11) - that is, gel electrophoresis of a restriction digest followed by transfer of the denatured DNA to nitrocellulose filters, and hybridization with suitable probes. In this case, the probes used have been either cDNA from total poly A+ larval RNA or the nick translated Dictyostelium actin plasmid. Figure 4 illustrates an application to this particular gene of a method Fig. 4 for assigning the 5' to 3' polarity of an RNA by restriction endonuclease digestion, gel electrophoresis, Southern blotting, and hybridization with suitable probes. The method depends on the fact that ~DNA 111i1de from mRNA by reverse transcription with an oligo (dT) primer has a preponderance of sequences from the 3' end of the RNA whereas cDNA made with a random calf thymus primer (12) has a uniform representation of all of the sequences in the RNA. The principle is that if the coding part of a gene extends across a restriction endonuclease site (in this case a Sal I site), then the ratio of hybridization intensities of the segment containing the 3' end of the gene to that of the segment containing the 5' end of the gene will be lower for the random primed cDNA than for the oligo (dT) primed cDNA. Further details of the experiment are explained in the legend to the figure. The number of actin genes in the genome has been determined by hybridizing Southern blots of genomic DNA digested by various restriction enzymes to actin probes (for example, the 1.8 kb Hind III fragment shown in Fig. 2 that contains the bulk of the actin coding region of ADrnl\2). 6 When such digests are compared -81- to control lanes in which genome equivalents of the cloned restriction fragments have been electrophoresed, it becomes clear that there are 6 actin genes in the haploid Drosophila genome. These 6 distinct genes are located at S sites on the polytene chromosome as determined by in situ hybridization (13). These sites are: chromosome, S7A on 2R, 87E and 88E on 3R, and 79B on 3L. SC on the X Present evidence indicates that, at the position SC on the X chromosome, there are actually 2 distinct genes which are close enough to each other so that they are not resolved at the level of in situ hybridization (that is 100-200 kb). However, preliminary analysis of cloned DNAs indicates that these two genes are separated by greater than 10 kb. Thus, we have shown at the present state of our studies that there are 6 distinct actin genes at 6 distinct chromosomal sites. We have not yet established whether or not these 6 genes differ in the amino acid sequences for which they code. However, there are several different actin mRNAs of different molecular lengths in Drosophila (our preliminary results) just as in vertebrates (14). There are several electrophoretic variants of the protein in Drosophila (15,16). It is therefore a plausible hypothesis that in Drosophila, as in vertebrates, . there are different nucleic acid sequences coding for several different muscle types of actin and for one or several non-muscle actins. Thus, the actin genes are an interesting multigene system for further investigation. In a particular type of muscle tissue, it may be presumed that other specific muscle protein genes will be coordinately expressed with a particular actin gene. Identification of the structural factors which regulate this coordinate expression is a problem remaining for future studies. On the other hand, different actin genes expressed at different stages of development must be controlled by different regulatory elements. 7 -82- Drosophila tRNA Genes Saturation hybridization experiments indicate that there are 600-800 tRNA in the haploid genome of Drosophila melanogaster (17,18,19). There are about 90 resolvable peaks when total Om tRNA is fractionated by RPC-5 chromatography (20). Fr001 an analysis of the kinetics of tRNA-genomic DNA hybridization, Weber and Berger estimate that Dm tRNA is made up of about 59 kinetic families (19). These data suggest that there are approximately 60-90 different tRNA sequences (i.e., species) in Drosophila and an average reiteration frequency for any one species of six to 13. Steffensen and Wimber (21) and later Elder, Szabo and Uhlenbeck (22) have mapped the sites on polytene chromosomes to which total labeled Om tRNA hybridizes. In the latter study, 54 sites were mapped by hybridization of 125 1-labeled tRNA to polytene chromosomes. Of these 26 were estimated by grain counts to be strong sites with 4 or more gene copies, and 28 were weak with 1-3 gene copies. These sites are listed in Table 1. The authors noted that other sites, such as those with small numbers of tRNA genes, those with tRNA genes of low abundance or those on portions of the genome that are underreplicated in polytene chromosomes (e.g., the Y chromosooie) may not have been detected. Several laboratories have carried out .ii!. situ studies on purified tRNAs. Some of these are also reported in Table 1 (23,24,25,26,27). Table l The overall conclusions from these studies are that most of the tRNA genes of Drosophila are clustered at a limited number of sites, perhaps 54 to 60, on the polytene chromosooies; that sooie of these clusters contain more than one species of tRNA gene; and that for some tRNA species there are genes at 2 or more sites. 8 -83- We have previously described our initial studies of the sequence arrangement of the tRNA genes on a cloned recombinant plasmid pCIT 12 (28). This plasmid contains a Drosophila DNA insert of length 9.3 kb fused to the vector Col El. A map of the distribution of restriction sites and tRNA genes on this insert is shown in Fig. 5. In the original study, the tRNA genes were mapped by electron microscopy of ferritin labeled tRNA and by the Southern blotting, hybridization procedure using total 3H labeled tRNA as a probe. These studies revealed that the insert contains 3 genes that are either identical or closely related in sequence, labeled tRNA-2, tRNA-3, and tRNA-4 and a Fig. 5 different gene, tRNA-1, all as shown in Fig. 5. When single strands of the DNA were mounted for electron microscopy, several secondary structure features consisting of a duplex stem, usually separated by a single-stranded loop, were observed at reproducible positions. The positions of the stem sequences and their inverted complements are marked as c, c'; a, a', etc., in Fig. 5. More refined mapping has been accomplished by hybridization of partially purified individual tRNA probes (29,30; P. Wensink, P. Gergan, Brandeis University, personal communication) and most decisively by direct DNA sequencing (30). These studies show that there are actually 9 tRNA genes on the Drosophila insert of pCIT12, as indicated in Fig. 5. The sequencing data show that the several inverted repeat segments actually tRNA genes present in two copies on opposite strands. are Obviously, the presence of a pair of closely spaced complementary DNA segments that can hybridize with each other on a single strand of DNA c001plicates the problem of one segment hybridizing to a complementary tRNA probe. 9 -84- The insert on pCIT12 was shown by in situ hybridization to map at region 42A of chromosome 2R . 1.!l situ studies with labeled total Drosophila tRNA had shown that 42A is one of the richest tRNA gene clusters in the Drosophila melanogaster genome (21). It therefore seemed probable that the 9.3 kb segment of pCIT12 does not include the entire gene cluster at locus 42A. This inference was confirmed by our initial studies of Charon 4 recombinant molecules with inserts _that overlapped with pCIT12, and by the studies of P. Gergan and P. Wensink who have independently isolated a Drosophila plasmid which partially overlaps with pCIT12 but extends further to the right {given the arbitrary orientation of the map of Fig. 5) and includes additional tRNA genes. We therefore wished to detennine the total extent of the tRNA gene cluster of band 42A which includes pCIT12. For this purpose we have engaged in the procedure of "walking down the chromosome". Initial attempts to isolate recombinant molecules with adjacent sequences from the Charon 4 library using pCIT12 DNA as a probe gave many plaques with inserts derived from other regions of the genome. This was due to the presence of repeated sequences in the EcoRl fragment C of pCIT12. Therefore, a DNA segment consisting of the EcoRl segments A and B of pCITl2 {which in addition to the Om segment of the A fragment indicated in Fig. 5 includes the 6.7 kb of the vector ColEl) was subcloned. This DNA was labeled by nick trans l ation and used as a probe in a Benton-Davis screen (5) of the Charon 4 library. Note that this probe includes segments from the two ends of pCIT12 but excludes the internal segments. With the probe used, the phages A16, AB, A17, A9, All, Al3, A15, A12 and A14 were isolated. It was shown from the restriction patterns with several enzymes {data not shown) that these inserts overlapped with pCIT12 as indicated in Fig. 6. Fig. 6 Al7 has a length of 18.8 kb, extends 16 kb beyond pCIT12, and overlaps it for about 2.8 kb. The 10 -85- restriction map of A17 was detennined. The rightmost EcoRl fragment, 17C, of length 8.7 kb was shown by chromosomal blots to contain mainly single copy sequences. It was subcloned and used as a probe to isolate an additional group of phage from the library. The restriction patterns of these phage were determined . Those that did not contain the EcoRl fragments 170 and 17F were selected for further study. These include A59, A35, and A54. These three phage all end at a point 8 kb to the right of A17. The process was repeated using the 1.6 kb fragment 35E and phage extending to the right selected. The phage A62 extends 9 kb beyond A35. The right most Rl fragment of A62 was used as probe and A85, 86 and 88 were selected. The phage A88 extends 10 kb beyond A62. In the same way phage extending to the left of pCIT12 were selected. The phage All has a Om DNA insert of length 18.4 kb and extends 13.3 kb beyond pCIT12. In a series of two additional steps which are obvious of Fig. 1, the phage A63 was isolateg. the left end of pCIT12. by inspection Its end point is about 41 kb beyond Thus, the set of recombinant molecules cover a region of length 94 kb at locus 42A. Preliminary tRNA gene assignments on some of the cloned segments have been made by Southern blotting experiments, using several different kinds of probes. Total Dm 4S RNA has been purified from Drosophila pupae as previously described (28) and labeled with 32 P either at the 5' end by T4 polynucleotide kinase or at the 3' end as (5'- 32 P)pCP with T4 RNA ligase (31). The specific activities achieved either way are approximately 2 x 10 7 cpm/~g tRNA. However, the tRNA is less degraded by the 3' end labeling procedure. Specific genes have been identified with probes prep~red by labeling purified Om tRNA species. These latter preparations were generous gifts from the laboratory of Dr. Dieter Soll. 11 Since the tRNAs are not always -86- completely purified and contain other tRNA components as minor contaminants, and since the hybridizations are carried out in vast tRNA excess, care must be taken to carry out hybridizations for times such that only the major species gives strong spots in the autoradiographs. Weak signals which are probably due to minor tRNA impurities have been disregarded in the tRNA gene assignments. The hybridization experiments are not quantitative and the possibilities exist that: a) several genes for a particular species are present on a restric- tion fragment where only one has been assigned; b) there is a restriction endonuclease site sufficiently close to the center of a gene so that two restriction fragments hybridize to the tRNA probe even though there is only one gene; c) other as yet unidentified tRNA species, for which purified probes were not available, are also present. On the map in Fig. 6, there is a segment of DNA extending from -17 to -20 which hybridizes with a total tRNA probe, however, it does not hybridize with purified tRNA lys,' arg or asn probes. Therefore it contains different tRNA's By i!)_ situ hybridization experiments, Tener et al. (23) have estimated that there are approximately 18 tRNA 2 lys genes in the haploid genome of Drosophila and that they map at the sites 42A, 42E, SOB, 62A and 63B. The tRNA 2 arg genes have been assigned to chromosomal locations of 42A and 84F. It thus appears that at least for some of the repeated tRNA gene families of Drosophila, genes are located at several widely spaced loci; within each locus, the genes for any one tRNA species are irregularly spaced, occur on both strands, and are interspersed with other tRNA genes. The functional significance of this pattern remains an intriguing, unsolved problem. One further interesting result, bearing on the representation problem disucssed in the next section, is shown in Fig. 6. 12 The bacteriophage with -87- numbers below 100 that extend either to the left or to the right of pCIT12 were all discovered in the Charon 4 partial Rl library . However, no bacterio- phage with an insert extending both to the left and the right of the 9 kb insert of pCIT12 was discovered in spite of extensive screening. screened the random shear library prepared by J. Lauer (1). We therefore This resulted in the discovery of the phages with 100 numbers spanning this region, as shown in Fig. 6. The Representation Problem We wished to determine as accurately as possible what fraction of the total Drosophila genome is present in our partial Rl library . The problem was studied by the methods described by Galau et al. (32). single copy Drosophila HAP chromatography. We first prepared nuclear DNA by suitable cycles of reassociation and This DNA was labeled with 3H by a Tepair reaction on the frayed ends and gaps with DNA polymerase. The representation of single copy Drosophila DNA sequences in the library was determined by comparing the kinetics and extent of the reassociation reaction of this tracer with total nuclear DNA and with library DNA as drivers. From the reassociation curves (Fig. 7), we see that the observed extents of reaction are 86 + 2% and 83 + 2%, Fig. 7 respectively, indicating that the library contains 96 ::_ 5% of the single copy sequences of Drosophila. The observed cot •s of genome and library DNA 112 are 270 and 280 mole sec liter- , respectively. Thus, the bulk of Drosophila 1 single copy DNA is present in the library in the same relative proportion as in the genome. Unfortunately, the accuracy of the reassociation kinetics method for detennining representation is limited. It would be particularly illlJortant to know whether the library represents 93%, 98% or 99.5% (for example) of 13 -88- Drosophila sequences. There is no straightforward experimental method with sufficient accuracy for making this detennination. As stated above and as shown in Fig. 6, a segment completely overlapping that of pCIT12 in the region 42A could not be discovered in the partial Rl library but was found in the random shear library prepared by J. Lauer (1). (Note, however, that all of the sequences of pCIT12 were found in non-overlapping inserts in the Charon 4-partial Rl library.) The absence of this segment in the partial Rl library probably indicates that one or several of the 5 closely clustered EcoRl sites in the middle of pCIT12 (Fig. 5) is particularly sensitive to cleavage and is almost always cut even under condition of partial digestion. Nevertheless, in our hands, the partial Rl library has proven to be useful for isolation of a number of single copy genes. Different recombinant inserts probably affect the burst size and replication time of the bacteriophage differently. Faster 9rowing,phage will tend to displace slower growing ones when the library is amplified, and thus the representation of the library will be decreased. It is important to determine conditions for amplifying the library without loss of representation. The relatively large amount of library DNA needed as a driver for the experiment of Fig. 7 was prepared by two cycles of growth of phage from the primary library on a bacterial lawn on nutrient plates, thus minimizing (but not eliminating) competition between fast and slow growers. However, as shown in Fig. 7, when the primary library is anplified by two cycles of growth in liquid culture, the resulting samples contain only about 50% of the single copy sequences present in genomic DNA. Thus amplification by growth as plate stocks is superior to growth in liquid culture for preserving sequence representation. 14 -89- The theoretical problem of the representation of sequences in a partial digest library has been studied by B. Seed (6). An exact mathematical expression for the fraction of sequences totally missing from the library has been derived. However, this expression is too complex for a satisfactory numerical approximation. Nevertheless, the analysis shows clearly that the longer the insert, the wider the window (the difference between maximum and minimum insert lengths) and the greater the frequency of restriction endonuclease sites, the more representative the library, provided that the conditions for partial digestion are properly chosen. Acknowledgments We are indebted to Drs. Dieter Soll and Peter Wensink for several personal colTTTlunications. The purified tRNAs used were a generous gift from the laboratory of Dr. Dieter Soll. The contribution of Dr. Jay Hirsh in the isolation of the actin gene clone is noted in the text. This research has been supported by gra nts GM 10991 and GM aJ9 27 from the United States Public Health Service. 15 -90- References 1. Maniatis, T., Hardison, R.C., Lacy, E., Lauer, J., O'Connell, C., Quon, D., Sim, G.K., Efstratiadis, A. (1978) Cell,!~, 687-701. 2. Blattner, F.R., Williams, B.G., Blechi, A.E., Thompson, K.D., Faber, H.E., Furlong, L.A., Grunwald, D.J., Kiefer, D.0., Moore, D.O., SchullJ!l, J.W., Sheldon, E.L., Smithies, 0. (1977) Science, !~~~. 161-169. 3. Sternberg, N., Tiemeier, D., Enquist, L. (1977) Gene, !, 255-280. 4. Hohn, B., Murray, K. (1977) Proc. Natl. Acad. Sci. USA, 74, 3259-3263. 5. Benton, W.D., Davis, R.W. (1977) Science, !~~~. 180-182. 6. Seed, B. (1979). 7. Vandekerckhove, J., Weber, K. (1978) J. Mal. Biol., !~~• 783-802. 8. Kindle, K.L., Firtel, R.A. (1978) Cell, !~, 763-778. 9. Pollard, T.D., Weihing, R.R. (1974) CRC Crit. Rev. Biochem., 2, 1-65. 10. Kaback, D.B., Angerer, L.M., Davidson, N. (1979) Nuc . Acid. Res., Ph.D. Thesis, California Institute of Technology. ~, 2499-2517. 11. Southern, E.M. (1975) J. Mal. Biol., ~§, 503-517. 12. Taylor, J.M., Illmensee, R., Surmiers, S. (1976) Biochem. Biophys. Acta, ~~~. 324-330 . 13. Gall, J.G., Pardue, M.L. (1971) Methods in Enzymology,~}~, 470-480. 14. Hunter, T., Garrells, J.I. (1977) Cell, g, 767-781. 15. Storti, R.V., Horovitch, S.J., Scott, M.P., Rich, A., Pardue, M.L. (1978) Cell,~. 589-598. 16. Fyrberg, E.A., Donady, J.J. (1979) 17. Ritossa, F.M., Atwood, K.C., Spiegelman, S. (1966) Genetics,?~• 663- 18. Tartof, K.D., Perry, R.P. (1970) J. Mol. Biol., 98, 503- 19. Weber, L., Berger, E. (1976) Biochem., 15, 5511- Rl Devel. Biol.,~~. 487-502. -91- 20. White, B.N., Tener, G.M., Holden, J., Suzuki, D.T. (1973). Dev. Biol., 33, 185- 195. 21. Steffensen, D.M., Wimber, D.E. (1971) Genetics, 69, 163- 178. 22. Elder, R., Szabo, P., Uhlenbeck, 0. (1979) In Transfer RNA (Soll, 0., Abelson, J., Schinmel, P. eds.) Cold Spring Harbor Laboratory, in press. 23. Tener, G.M., Hayashi, S., Dunn, R., Delaney, A., Gillam, I.C., Grigliatti, T.A. Kaufman, T.C., Suzuki, O.T. (1979) In Transfer RNA (Soll, D., Abelson, J., Schinmel, P., eds) Cold Spring Harbor Laboratory, New York, in press. 24. Dunn, R., Hayashi, S., Gillam, I.C., Delaney, A.O., Tener, G.M., Grigliatti, T.A., Kaufman, T.C., Suzuki, D.T. (1979) J. Mol. Biol., in press. 25. Kubli, E., Schmidt, T. (1978) Nuc. Acid. Res., 5, 1465-1478. 26. Schmidt, T., Egg., A.H., Kubli, E. (1979) Malec. Gen. Genet., in press. 27. Dunn, R., Delaney, A.O., Gillam, I.C., Hayashi, S., Tener, G.M., Grigliatti, I T., Misra, V., Spurr, M.G., Taylor, D.M., Miller, R.C., Jr. (1979) Gene, in press. 28. Yen, P.H., Sodja, A., Cohen, M., Conrad, S.E., Wu, M., Davidson, N., Ilgen, C. (1977) Cell, 11, 763-777. 29. Schmidt, 0., Mao, J.-I., Silvennan, S., Hovemann, 8., Soll, D. (1978) Proc. Nat. Acad. Sci. USA, 75, 4819-4824. 30. Hoevemann, 8., Schmidt, 0., Yamada, H., Silvennan, S., Mao, J.-1., DeFranco, D. , Soll, D. (1979) In Transfer RNA (Soll, O., Abelson, J., Schinmel, P., eds.) Cold Spring Harbor Laboratory, New York, in press. 31. England, T.E., Uhlenbeck, O.C. (1978) Nature, 280-281. 32. Galau, G.A., Klein, W.H., Davis, M.M., Wold, 8.J., Britten, R.J., Davidson, E.H. (1976) Cell, :• 487-505. R2 -92- Tablt 1 0,-osophi 11 45 RNA Situ tt ! £h i!. lb. ~ 30 22~E 41C0 610 llet3 !!!_ llet2 3F llll_ Ser-4,7 ~ :~;2, Lys2 5F6A £ill. fil Lys2 *6ZA Lys2 --&lu4 63A fil Val3b !!£. Arg2 11A •21c •1&1 ll! 878C !ill, Ser-4 ,7 280 44EF 640E YalJa 87F88A 28F29A 46A llet3 ll! !!!£. Va114 290 29£ Asp2 48A8 lletZ 678 !Q£ Yal3b 48C0 ~ !IOOE ill! 708C Va14 •nc *34A ill! ~ ~ ~ ValJb ~Lys2 72F*73A llet2 93A fillli &lu4 ill. ! none ~ 54A , 97C0 540 99£F lill. 560 Va 14 *56F Glu4 570 S8A8 60E tlfh• locus usi9-nts in he1¥y type .,.re .. d• by Elder •t al . (22) using total labtled tRHA . Sites thlt .,.re heavily hbeled are underlined . Entries to the side of the Nin coh•ns of the table are usi9-nts ■ade using purified tRltA's (21,22 ,23,24 ,25,26,27) . Asttri sts indicatt 1ssign- aents for rec..,b i nant Charon p hQues th1t give strong tRNA sign1 h, ho hted in our laboratory . Entries in italics are~ .!.i!!!. usi-nts th1t ..Y bt different from those of Eloer et al. (22) . T1 -93- Leoends Figure 1. Construction of an EcoRl partial digest eukaryote library, with Charon 4 as a vector, as described in the text. Figure 2. Restriction endonuclease map of the Drosophila insert of ADmA2 bearing an actin gene. In the lower figure, the solid bars indicate the regions present in Drosophila actin mRNA. Figure 3. Electron micrographs of R-loops of Drosophila actin mRNA hybridized to ADmA2 by the method of Kaback et al. (10). Bis an interpreted tracing of the R-loop region in mfcrograph A. Dis an enlargement of the important region in C, and E is an interpreted tracing. Figure 4. Restrictio~ endonuclease digests and Southern blots of the 8.7 kb EcoRl fragment of A[)riA2 (Fig. 2) subcloned in pBR322. The plasmid DNA was digested with restriction endonucleases as indicated, and subjected to gel electrophoresis on a 1.0% agarose slab gel. Panel A shows the ethidium bromide staining pattern of the gel, and thus displays all of the restriction fragments from the map of Fig. 2 (plus those of the vector). For panels Band C, identical gels were run in parallel and the DNA blotted In panel B, the 32 P labeled on to nitrocellulose paper. cDNA probe was prepared by reverse transcription of total poly(A+) larval RNA with a calf thymus digested primer (12). In panel C, the same RNA was reverse transcribed using an oligo (dT) primer. Ll In either case, the -94- only component of the RNA which gives detectable hybridization with ADTIA2 DNA is the actin sequences. The probe for panel Bis unifonnly representative of the entire actin mRNA; that for panel C is biased towards the first few hundred nucleotides on the 3' side of the message. With the representative probe, the 0.8 kb Sal fragment hybridizes more strongly than the 1. 1 kb fragment. With the 3' biased probe, the 1. 1 kb fragment gives the stronger signal. These observations lead to the 5' to 3' orientation of the actin gene shown in Figure 2. The relative intensities of hybridization to the 1.8 and l.~ kb Hind III fragments confinn the interpretation. Figure 5. Map of the pCIT12 plasmid showing the locations of the restriction sites, the inverted repeats and the tRNA geT1es. Only the Drosophila region is presented. The bars for the genes for tRNA-1, -2. and -4 represent the standard deviation of electron microscope measure- ments. The tRNA-3 gene was identified and mapped only by Southern blotting with restriction fragments. Restriction fragments with tRNA genes are indicated as solid bars. is adapted from Yen et al. (28). This part of the figure The mapping data for the 9 tRNA genes shown at the top of the graph are from the sequencing studies reported by Hovemann, et. al. (30). The inverted repeat stem c is a tRNAite gene, the stems a, a' and c' are for tRNALys genes, whereas b2 , b1, and b' are tRNAAsn genes. Directions of transcription as detennined by sequencing are shown. map of OM Figure 6. OM inserts in Charon 4 phage covering the region 42A. The scale fs in kilobases (kb). 1 denote EcoRl cleavage sites. Capital L2 -95- letters denote EcoRl restriction fragments referred to in the text. Note that fragment A of pCIT12 contains the Col El vector as well as segments on both ends of the insert. Positions of tRNA genes were detennined by blotting experiments with labeled total or purified tRNA probes as described in the text. The bacteriophage with numbers greater than 100 were obtained by screening the random shear library prepared by J. Lauer (1); all other inserts were obtained from the partial Rl library. Figure 7. Detennination of the complexity of the Drosophila DNA sequences in the partial Rl library. 3H labeled single copy Drosophila DNA was prepared by the procedure of Galau et al. (32) as follows. Sheared Drosophila pupal nuclear DNA at a concentration of 0.37 mg/ml was incubated in 0.41 M phosphate equivalent buffer (0.41 MPB, Na+= 0.62 M (32)) at 67° for 9.5 hr (Cot= 200) and passed over a HAP column in 0.12 MPB at 60°. The single stranded fraction was isolated, reacted to a Cot of 100 and again passed over HAP. The resulting single stranded material was incubated to a Cot of 5000; the double stranded fraction was isolated and labeled by gap translation to a specific activity of approximately 106 cpm/~g. Time points were taken by incubating driver DNA at concentrations of 0.1 to 10 mg / ml in 0.41 M PB at 67° for times up to 50 hrs. Single and double stranded fractions were assayed by HAP chromatography. The horizontal axis on the figure is equivalent Cot (in 0.12 MPB). We use a salt correction from 0.41 MPB of 5.0; we assume that the average mass fraction of Om D~A in total library DNA is 0.35. L3 -96- Amplified plate stocks of library phage were prepared from ten 150 l11TI plates, each with 10 4 phage from the primary library, plated on to a bacterial lawn of KH 802. From the resulting phage, 106 were plated onto 10 new plates from which 900 µg of DNA was isolated. For the liquid culture experiments 10 5 phage were adsorbed onto 10 8 bacteria in l ml, then diluted and grown in 10 ml, following the general PDS procedure (1). approximately 1.3 x 10 11 phage. The yield was 4 x 10 7 phage were then reinocu- lated into 4 x 10 10 bacteria and grown in one litre of culture by the previous methods, yielding approximately 1000 µg of DNA. L4 ~ .,, ~ left mm I righl in vitro package ■ zazz•zzzz ■ z z z z z z■ ! left left ligate 1111.. I right right m m m m I =- cleaved site ~ I R I digest size '1, fractionate = Eco RI site cohere ends ••• l Ill.. m' right essential "1111 m Charon 4 DNA ■ ~22222222 ■ 22222222222~ ~ 7 ■ ✓- Z Z Z 7 za Z 7 7 7 7 4lt.. partial RI digest, {, size fractionate I :~t;;:a;:;t1iaz'.~&:g~) left essential I I ...J ID N ,, IVZVZZ//VZZZZZ2) f½?VZZ:½0'/41 ~-Left EcoRil Sal h I I EcoRil 4.2 5 I 10 3' I I I rII I Hirdm Sal I H 15 I rBam HI 1 4.6 EcoRI I Hind ill Hind ill Sal I I 1.6 Ki lo bases 5' f-H Hind Sal !7 ml Sall~ 1.8 8.7 .-, 020V/4½01 (Zj;~~ EcoRI I \!) I CX> -99- I )( - Cl) Cl ::, 0 I <I <I z z 0 0 V> V> F3 ~ ..., 'I .-, ,, • ; ... : · 1 i'.•I · , , . ''., , ·: { l S~ '. .,~. ' : ":-'. ;."il.: ~: . ,·', .· : ,. S;.··._.',., ,_,,', · .. .. , r- ,. :. :r •• - ,. ' ':' ••~1 J;i~: :rJ • . •• 1•1 · 1, ' ·'" '.,' •'\~, •~)f r'. ~'J ~F ',;-·.,·r: ', '·t•~ f ,l ~ t ~. 1- i' , ,.,,•••_. . ·,·•..,•.~-·· . 11■~1'11•-t~■lilk, \,~ i;i-,-f ~f•.r'~;~it\/ ,_. ' • :l ·/ •:;J~;._.i~ ~t-~';- ~i "ti~i'.:!.. i • :-.': < ~•;~\,\~: :,' ~,,,.l 1 '· •tl '" 1:· ·.,; 't,,_ ,.:f,-.: '.: l • ,.., f ~i •,-. I + + H3 + + + + H3 Sol Sat ~ •J Sal Sal ,. 1t ... -· - ·u-, .... . --~ . ...... --- .. . .,. .,.,, -- H3 RI Sot RI H3 RI '111•; 'I. , · ~ B H3 RI Sol RI H3 RI I I • ( ( • ~' t,- , (, !Li'' ', ,< • ' •;/';•, • ,. ' , 036 '.,. ) :·;-, . ,\ . ;,.,~-\~ , ~ ; ~ ~j1· ·1 --11iai•ii:~ .. ~., ; ~_t' :f.~~\11-, .,,., , (·" .', · Q34 \ If ; • !• 1f ' H:,t,: l~il!z;kt.t~~:.~t ·: ' ,{.,!~ ~ :i;f, ~'!¥' ~ '111'1t~•·i •1!ll'lt'·f111~, .. ,;.';'iJ1 !., • I.I 08 • 07 0.57 Q 53 1.8 1.6 8.7 I • + + . Sol Sal H3 H3 RI Sal RI H3 RI + • ..--• . . .. ~.:..:>··:\: ·•, _;~-• ---• • ~ ~ " ,, ~ - .. ,•· ,,\ 1 I 1 .... a •• a as . , aue • • ·~ •. --. . re ,__ I 0 ....0I t.n .,, tRNA regions Hindfil+RI Hpo I+ RI HpoI+Hindfil Smo Eco RI Hindfil Hpo I ~ - rr A A A t--t - G E I 2 .0 I I 1.0 c:::::J- G A c:::::J- H A c::::::J- D A tRNA - I E I 1.5 I Arg E D C 8 I 3.0 B c:::::::::J F c:::==::i E B c:====i I ~7 C F D D F 8 H C::=J H c::::::Jr E Distance (kb) 5.0 I ' 6.0 OO □ c::::::J-C::=Jr JIK D K a Oc::::::=::J K F a o t----2--. , ' 6 .0 tRNA-3 Oc::::::=::J F tRNA - 2 A B C 4 .0 I , I' 4 .5 4 .9 4.8 co --- ) i I IP- C C C 8 7.0 T l A 8 .0 I ,...--- G I JA I JA CJ □ C c:::::i □ c C DB A DEA CJD ■ tRNA-4 t--t ,I A 9.0 I -□□■ T ',I I 01,9.09.I c'b 2 b1b' f', Asn Asn I ....0 ....I -102- ~ IO - er, IO IO,.-, ,<. ,<. (X) C.O IO (X) (X) w co I'- ,<. ,<. ,<. u,-_ -co OJ"v''SAl I ,<. ,< N U) ,<. .J:J C\J .¥ ..... O"> u OJ"v''US"v' ! ~ US"v' US"v''SA7 I SA7~: nI1' ustt' I f>Jtt s A7 I 0 . Q. ;1 0 ,< J1§ - ~_::st_ ,< f"')N O"> = ~~ ,< ,< "v'Nc:H I ,..., c.o ,< 0 ,..., I 0 ~ I F6 -1.D ,< ,< 0 ..,....., '+-- u 0 ..... - 0 C .0 0 C :::, -0 0 - I <( a.. 1.0 0.5 0.0 • Om DNA DRIVER CHARON 4 Dm LIBRARY ~, \A. ~' 10- 2 101 10 2 ~ ' Equivalent Cot (M x sec) 10° PLATE STOCK DNA DRIVER ,o-' o----6 o----o LIQUID CULTURE DNA· DRIVER t • D ~ o'SQ. -~,, \ ''b 10 3 \\ • \ 6. '~ 10 4 '°''o.- □', I w ....0I