Directed Evolution of Biosynthetic Pathways to Carotenoids with Unnatural Carbon Backbones Citation Tobias, Alexander Vincent (2006) Directed Evolution of Biosynthetic Pathways to Carotenoids with Unnatural Carbon Backbones. Dissertation (Ph.D.), California Institute of Technology. doi:10.7907/WF0Q-2J98. https://resolver.caltech.edu/CaltechETD:etd-08232005-174620 Abstract Over the course of evolution, nature continually discovers new small molecules through the alteration of biosynthetic enzymes and pathways by mutation and gene transfer. Hundreds of these natural products have proven indispensable to medicine, culture, and technology, greatly contributing to increases in the length and quality of human lives. Chemists have found that the "chemical space" surrounding natural products is especially rich in functional molecules, and synthesis of natural product analogs has uncovered many with new or improved properties. Inspired by nature's search algorithm, we and others have conducted our own evolution of carotenoid biosynthetic pathways in the laboratory. Chapter 1 comprehensively reviews the motivations, accomplishments, and challenges of this research area as of early 2005, and describes in detail how biosynthetic routes to dozens of new carotenoids have been established. To expand the number of carotenoid backbones beyond the C 30 and C 40 carbon scaffolds that give rise to the ~700 known natural carotenoids, we subjected a carotenoid synthase, the enzyme responsible for carotenoid backbone synthesis, to directed evolution. Chapter 2 describes the evolution of the C 30 carotenoid synthase CrtM from Staphylococcus aureus for the ability to synthesize C 40 carotenoids. This work also resulted in novel carotenoids with C 35 backbones. We later found that some of the CrtM mutants generated in this laboratory evolution experiment, as well as several second-generation variants, are also capable of synthesizing unnatural C 45 and C 50 carotenoid backbones when supplied with appropriate prenyl diphosphate precursors. Chapter 3 describes the creation of full-fledged pathways to carotenoid pigments based on the C 45 and C 50 scaffolds. Coexpression of the carotenoid desaturase CrtI from Erwinia uredovora resulted in the biosynthesis of at least 10 new C 45 and C 50 carotenoids with different systems of conjugated double bonds. We also present evidence of an unnatural asymmetric C 40 carotenoid pathway beginning with the condensation of farnesyl diphosphate (FPP, C 15 PP) and farnesylgeranyl diphosphate (FGPP, C 25 PP). In addition to clarifying how CrtM and CrtI achieve their product specificities, this work also sheds light on the molecular mechanisms used by evolution to access new chemical diversity and the selective pressures that have shaped natural product biosynthesis. Item Type: Thesis (Dissertation (Ph.D.)) Subject Keywords: carotenoid biosynthetic pathways; directed evolution; enzyme engineering; metabolic pathway engineering; natural products Degree Grantor: California Institute of Technology Division: Chemistry and Chemical Engineering Major Option: Chemical Engineering Minor Option: Biology Thesis Availability: Public (worldwide access) Research Advisor(s): Arnold, Frances Hamilton Thesis Committee: Arnold, Frances Hamilton (chair) Asthagiri, Anand R. Newman, Dianne K. Hsieh-Wilson, Linda C. Defense Date: 19 August 2005 Record Number: CaltechETD:etd-08232005-174620 Persistent URL: https://resolver.caltech.edu/CaltechETD:etd-08232005-174620 DOI: 10.7907/WF0Q-2J98 ORCID: Author ORCID Tobias, Alexander Vincent 0000-0002-5866-5254 Default Usage Policy: No commercial reproduction, distribution, display or performance rights in this work are provided. ID Code: 3201 Collection: CaltechTHESIS Deposited By: Imported from ETD-db Deposited On: 25 Aug 2005 Last Modified: 12 Dec 2025 21:33 Thesis Files Preview PDF (00-Tobias_Whole_Thesis.pdf) - Final Version See Usage Policy. 5MB Preview PDF (01-Tobias_Title_Section.pdf) - Final Version See Usage Policy. 46kB Preview PDF (02-Tobias_Chapter_1.pdf) - Final Version See Usage Policy. 1MB Preview PDF (03-Tobias_Chapter_2.pdf) - Final Version See Usage Policy. 1MB Preview PDF (04-Tobias_Chapter_3.pdf) - Final Version See Usage Policy. 1MB Preview PDF (05-Tobias_Appendix_A.pdf) - Final Version See Usage Policy. 762kB Repository Staff Only: item control page

Directed Evolution of Biosynthetic Pathways to Carotenoids with Unnatural Carbon Backbones Thesis by Alexander Vincent Tobias In partial fulfillment of the requirements for the degree of Doctor of Philosophy California Institute of Technology Pasadena, California 2006 (Defended August 19, 2005) ii © 2006 Alexander Vincent Tobias All Rights Reserved iii ACKNOWLEDGMENTS The opportunity to attend graduate school at Caltech has been a precious gift that I will treasure for the rest of my life. Working at this world-class institute with such talented, intelligent, motivated, and conscientious colleagues has contributed to my professional and personal development in ways I could never have imagined at the outset. To my advisor, Frances Arnold, thank you for giving me the guidance and opportunities to develop and mature as a scientist. I have never encountered anyone who can cut directly through to the essence of an idea or concept the way you can, and I hope that some of your keen scientific vision and insight has rubbed off on me. Thank you also for always being truthful. It wasn’t easy knowing that something I said, did, or wrote didn’t satisfy you or come across the right way, but on the other hand, when you told me that my work was “excellent” or “just right,” I knew you meant it and that really made me feel like I had succeeded. To my other committee members, Anand Asthagiri, Linda Hsieh-Wilson, and Dianne Newman, thank you all for serving on my candidacy and thesis committees and for your insightful questions and comments. I would like to thank the Natural Sciences and Engineering Research Council of Canada for the two postgraduate scholarships I was awarded, and the United States National Science Foundation for a grant supporting this research. I am appreciative not only of the financial contributions from these organizations, but also for the associated expressions of belief in the value of this research. I would not have gotten very far in characterizing the carotenoids my cultures have synthesized without the dedicated assistance of Mona Shahgholi and Nathan iv Dalleska. Thank you both for the hours of time you spent helping me with mass spectrometry, for answering my questions and critiquing my hypotheses, and most of all, for helping me to collect key data for this thesis. Manish Raizada and Hyman Hartman contributed valuable comments that helped us to make the review paper reproduced in Chapter 1 significantly more focused and lucid. Gerhard Sandmann deserves many thanks for supplying me with valuable experimental guidance and eminently appropriate literature at just the right moments. I am also grateful to George Britton for his expert advice on the extraction and analysis of carotenoids from biological material. Shinichi Takaichi provided helpful assistance with the naming of the new carotenoids reported in Chapter 3. Most of my fondest memories of Caltech involve the many wonderful students, postdocs, and visitors who have spent time in the Arnold group during my tenure here. I want to thank every one of these group members for contributing to the Arnold lab’s wonderful atmosphere of interdisciplinary collaboration, for advice and ideas, and for good times at parties and other social functions. In particular, I am indebted to Daisuke Umeno, who was my mentor and collaborator on the carotenoids project and who taught me how to clone genes, build plasmids, and “do” directed evolution. Daisuke, I am ever so grateful for your friendship, instruction, camaraderie, supportiveness, and truly unique sense of humor. I wish to specially acknowledge several other members of the Arnold group: to Adam Hartwick, thank you for your friendship and for your ability to discuss carotenoids and their biosynthesis with me as only someone with your experience could. To Michelle Giron and Brenda Parker, thank you both for your contributions to the carotenoids v subgroup and for being such great students to mentor. To Joff Silberg, thank you for your friendship, advice, and the numerous conversations we had about everything from science and politics to family and food. To Michelle Meyer, thank you for being a wonderful officemate, for your friendship, and for all our conversations over the years. To Matt Peters, thank you for being so willing to answer (or attempt to answer) my almost incessant barrage of chemistry-related questions. To Jorge Rodriguez, thank you for your friendship and our many discussions of scientific and personal import. To Allan Drummond, thank you for your contagious passion for science and our fruitful and enlightening discussions. And to Geethani Bandara, thank you for keeping the lab running smoothly, for all your friendly and helpful advice, and for hosting such great parties at your home. In contrast to my final year, my first four years at Caltech were not spent entirely in the lab. I am grateful to the members of the Caltech Beavers hockey team for their camaraderie and constant supply of memorable moments on and off the ice. In particular, I thank Adam Olsen and David Jenkins for their friendship and hundreds of hours of stimulating banter on the way to and from Sylmar. I would also like to thank my colleagues who served with me on the Caltech Graduate Student Council. My “GSC education” was highly complementary to my research education at Caltech, and I am appreciative of my fellow board members for helping me to improve my “soft” and leadership skills. When I think about the path of my professional life, two of my teachers stand out as having profoundly influenced my choice to pursue a career in engineering. Charles Ledger and Fraser Simpson, my junior high school mathematics teachers, were truly in a vi class of their own. They ignited my passion for math and problem-solving with their contagious enthusiasm and love for the subject as well as their innovative teaching methods (dissatisfied with the textbooks of the day, they designed their own curriculum and somehow convinced the school board to let them teach it). I might have pursued the same career path had I not been taught by Mr. Simpson and Mr. Ledger, but I doubt I would have done so with quite the same vigor. To J.R., I am much obliged to you for your sage guidance and for improving my self-awareness. Your attentive ear and knowledgeable advice have assisted me through many of life’s trials and have helped me to tame my worries. I am no doubt a better person to myself and others because of you. My parents, Lili and David Tobias, deserve special recognition for their love and guidance and for encouraging me to explore my curiosity about the world in myriad ways. Mom and Dad, the lessons you worked so hard to teach me have served me well: finish your homework before you play, do it right the first time, respect other people and their property, help others in need, and wait for things to go on sale. Thank you for giving me just the right amount of freedom and responsibility when I was growing up so that I could learn to be independent but not get into too much trouble. To Mikael, thank you for being the best brother anyone could ask for. I think part of our special bond is rooted in our choice of careers, which are quite different but also appealing to both of us. This allows us to live vicariously through each other, so that I get a taste of the life of a musician and you can experience a bit of life as a scientist. Although we haven’t lived in the same city for some time now, I can’t imagine life without you and I am grateful for our e-mails, telephone calls, and visits. vii To my dearest Jill, thank you for your boundless love, compassion, understanding, and support. I feel the bond of our marriage grow stronger every day, and to be your husband is the ultimate privilege. Thank you for cheering me up when my experiments weren’t working, for bringing me dinner at the lab when I could take only a short break, and for waiting for me all those times when I needed “just another 15 minutes” before I could come home. Thank you also for celebrating my successes and milestones with me, but more importantly, for insisting that these moments be celebrated when I didn’t feel up to it at first. For all you have contributed, I feel like we have completed this thesis together. As we embark on the next chapter of our lives, I look forward to all the new experiences, moments, and memories that I will have the honor of sharing with you. viii ABSTRACT Over the course of evolution, nature continually discovers new small molecules through the alteration of biosynthetic enzymes and pathways by mutation and gene transfer. Hundreds of these natural products have proven indispensable to medicine, culture, and technology, greatly contributing to increases in the length and quality of human lives. Chemists have found that the “chemical space” surrounding natural products is especially rich in functional molecules, and synthesis of natural product analogs has uncovered many with new or improved properties. Inspired by nature’s search algorithm, we and others have conducted our own evolution of carotenoid biosynthetic pathways in the laboratory. Chapter 1 comprehensively reviews the motivations, accomplishments, and challenges of this research area as of early 2005, and describes in detail how biosynthetic routes to dozens of new carotenoids have been established. To expand the number of carotenoid backbones beyond the C30 and C40 carbon scaffolds that give rise to the ~700 known natural carotenoids, we subjected a carotenoid synthase, the enzyme responsible for carotenoid backbone synthesis, to directed evolution. Chapter 2 describes the evolution of the C30 carotenoid synthase CrtM from Staphylococcus aureus for the ability to synthesize C40 carotenoids. This work also resulted in novel carotenoids with C35 backbones. We later found that some of the CrtM mutants generated in this laboratory evolution experiment, as well as several secondgeneration variants, are also capable of synthesizing unnatural C45 and C50 carotenoid backbones when supplied with appropriate prenyl diphosphate precursors. ix Chapter 3 describes the creation of full-fledged pathways to carotenoid pigments based on the C45 and C50 scaffolds. Coexpression of the carotenoid desaturase CrtI from Erwinia uredovora resulted in the biosynthesis of at least 10 new C45 and C50 carotenoids with different systems of conjugated double bonds. We also present evidence of an unnatural asymmetric C40 carotenoid pathway beginning with the condensation of farnesyl diphosphate (FPP, C15PP) and farnesylgeranyl diphosphate (FGPP, C25PP). In addition to clarifying how CrtM and CrtI achieve their product specificities, this work also sheds light on the molecular mechanisms used by evolution to access new chemical diversity and the selective pressures that have shaped natural product biosynthesis. x TABLE OF CONTENTS ACKNOWLEDGMENTS ........................................................................................... iii ABSTRACT............................................................................................................... viii TABLE OF CONTENTS...............................................................................................x LIST OF TABLES AND FIGURES ......................................................................... xiii CHAPTER 1—Diversifying Carotenoid Biosynthetic Pathways in the Laboratory Summary........................................................................................................................2 Introduction....................................................................................................................3 Overview of carotenoid biosynthetic pathways.......................................................5 Carotenoids as a model system for laboratory pathway evolution ..........................8 Evolvable pathways and enzymes .........................................................................11 Approaches to engineering novel biosynthetic pathways............................................14 Engineering pathways by gene assembly ..............................................................14 Engineering pathways by directed enzyme evolution ...........................................17 Probing the evolvability of carotenoid biosynthetic enzymes and pathways ..............19 Directed evolution of key carotenoid biosynthetic enzymes .................................19 Creation of pathways to carotenoids with new carbon scaffolds...........................37 Discussion and future directions..................................................................................43 Revised view of carotenoid biosynthetic pathways...............................................43 Future challenge: specific pathways ......................................................................44 Prospects and challenges for diversifying other pathways by laboratory evolution ............................................................................................................47 Conclusions..................................................................................................................53 References....................................................................................................................75 xi CHAPTER 2—Evolution of the C30 Carotenoid Synthase CrtM for Function in a C40 Pathway Summary......................................................................................................................92 Introduction..................................................................................................................93 Results and Discussion ................................................................................................95 Constructing pathways for C30 and C40 carotenoids ..............................................95 Functional analysis of CrtM and CrtB swapped into their respective foreign pathways ............................................................................................................97 Screening for synthase function in a foreign pathway...........................................99 Evolution of 4,4'-diapophytoene synthase (CrtM) for function in a C40 pathway............................................................................................................100 Carotenoid production of evolved CrtM variants ................................................101 Direct product distribution of CrtM variants in the presence of GGPP (C20PP) .............................................................................................................102 Comparison of the C40 and C30 performance of CrtM variants ...........................103 Analysis of mutations ..........................................................................................104 Structural considerations: mapping mutations onto human squalene synthase............................................................................................................104 Evolution of phytoene synthase (CrtB) in a C30 pathway....................................106 Conclusions................................................................................................................108 Materials and Methods...............................................................................................109 Materials ..............................................................................................................109 Plasmid construction............................................................................................110 Error-prone PCR mutagenesis and screening ......................................................110 Pigment analysis ..................................................................................................112 References..................................................................................................................127 xii CHAPTER 3—Taking Natural Products to New Lengths: Biosynthesis of Novel Carotenoid Families Based on Unnatural Carbon Scaffolds Summary....................................................................................................................132 Introduction................................................................................................................133 Results........................................................................................................................136 CrtI desaturates unnatural C45, C50, and asymmetric C40 carotenoid backbones, resulting in the biosynthesis of numerous novel carotenoids .......136 E. coli expressing only BstFPSY81A and a variant of CrtM accumulate hydroxylated carotenoid backbones.................................................................140 In vitro desaturation experiments with CrtI.........................................................142 Carotenoid biosynthesis in cultures expressing the C25PP synthase from Aeropyrum pernix ............................................................................................146 The distribution of carotenoids synthesized by cells expressing BstFPSY81A is strongly influenced by Idi overexpression and physiological state .............148 Attempted creation of a C60 carotenoid biosynthetic pathway ............................149 Discussion..................................................................................................................151 Determination of desaturation step number by Erwinia CrtI ..............................151 Evidence of an asymmetric C40 carotenoid biosynthetic pathway ......................154 Potential utility of novel desaturated C45 and C50 carotenoids ............................156 Origins of in vivo-hydroxylated carotenoids .......................................................158 Properties of nascent biosynthetic pathways—lessons for biology and metabolic pathway engineering .......................................................................161 Challenges for achieving new pathway specificity..............................................166 Conclusions................................................................................................................172 Materials and Methods...............................................................................................173 Genes and plasmids .............................................................................................173 Bacterial cultures and carotenoid extraction........................................................175 Separation and analysis of carotenoids................................................................177 Acetylation of hydroxylated carotenoid backbones.............................................178 In vitro desaturation of carotenoid backbones.....................................................179 Iodine-catalyzed photoisomerization...................................................................180 xiii Thin-layer chromatography and autoradiography analysis of isoprenyl diphosphate synthase reactions........................................................................180 References..................................................................................................................205 APPENDIX A—Plasmid Sequences and Maps ........................................................210 LIST OF TABLES AND FIGURES Figure 1.1. Natural carotenoid biosynthetic pathways can be organized in a tree-like hierarchy ..............................................................................55 Figure 1.2. Selected examples of gene assembly leading to novel carotenoids in E. coli....................................................................................................57 Figure 1.3. “Matrix” pathway resulting from the coexpression of carotenoid biosynthetic enzymes with broad specificity ............................................59 Figure 1.4. Chain elongation reactions catalyzed by natural all-E IDSs .....................60 Figure 1.5. Product length determination by CrtM and mutants thereof.....................62 Figure 1.6. Extension of laboratory-evolved pathways to 3,4,3',4'tetradehydrolycopene and torulene by coexpression of downstream carotenoid modifying enzymes..................................................................64 Figure 1.7. The step number of the C30 desaturase CrtN is readily modified by mutation …………………………... ........................................................66 Figure 1.8. Cyclization of carotenoids………………………….................................68 Figure 1.9. Alteration of product specificity of the β,β-carotene hydroxylase from Arabidopsis thaliana ........................................................................70 Figure 1.10. Several carotenoid cleavage enzymes display localized specificity .................................................................................71 Figure 1.11. Generation of a C35 carotenoid pathway by gene assembly and directed enzyme evolution ...............................................................73 Figure 1.12. Biosynthesis of C45 and C50 carotenoid backbones .................................74 xiv Table 2.1. Mutations found in sequenced CrtM variants...........................................115 Figure 2.1. Natural carotenoid biosynthetic pathways...............................................116 Figure 2.2. C30 and C40 production systems used in this work ..................................118 Figure 2.3. Typical plate with E. coli XL1-Blue colonies expressing a mutagenic library of CrtM together with CrtI and CrtE ..........................120 Figure 2.4. HPLC-photodiode array analysis of carotenoid extracts of E. coli transformants carrying plasmids pUC-crtE-crtB-crtI, pUC-crtE-crtM-crtI, and pUC-crtE-M8-10-crtI ........................................122 Figure 2.5. Direct product distribution of CrtM and its mutants in the presence of CrtE (GGPP supply) .............................................................124 Figure 2.6. Pigmentation produced by CrtM variants in C40 and C30 pathways ........125 Figure 2.7. Reaction schemes for SqS and CrtM.………………………………......126 Table 3.1. Properties of novel desaturated carotenoids synthesized by XL1-Blue(pUCmodII-crtMF26A,W38A-crtI-bstFPSY81A) .............................183 Table 3.2. Names of numbered carotenoid structures depicted in Figures 3.2-3.4.………………………………... .................................184 Table 3.3. Results of in vitro desaturation experiments with XL1-Blue(pUCmodII-crtI) lysate on various carotenoid backbones ......185 Figure 3.1. Six carotenoid biosynthetic pathways from three prenyl diphosphate precursors ............................................................................186 Figure 3.2. Desaturation in the C45 pathway..............................................................187 Figure 3.3. Desaturation in the C50 pathway ..............................................................188 Figure 3.4. An asymmetric C40 pathway ....................................................................190 Figure 3.5. Hydroxylation and subsequent in vitro desaturation of carotenoid backbones.................................................................................................192 Figure 3.6. UV-visible absorption spectra of novel carotenoids biosynthesized by recombinant E. coli ....................................................194 Figure 3.7. HPLC trace of carotenoid backbones extracted from a culture of XL1-Blue(pUCmodII-crtMF26L-bstFPSY81A)…………………………....196 xv Figure 3.8. Relative molar quantities of the carotenoid backbones produced by recombinant XL1-Blue cultures expressing BstFPSY81A and a CrtM variant..........................................................................................197 Figure 3.9. APCI mass spectra of unmodified, hydroxylated, and acetylated carotenoid backbones.............................................................................198 Figure 3.10. Relative molar quantities of the carotenoid backbones produced by recombinant XL1-Blue cultures expressing ApFGS and CrtMF26A,W38A .........................................................................................200 Figure 3.11. Idi overexpression and physiological state strongly influence the distribution of carotenoid backbones in recombinant XL1-Blue cells expressing BstFPSY81A and CrtMF26A,W38A ...................201 Figure 3.12. Product specificity of M. luteus hexaprenyl diphosphate synthase (HexPS)...................................................................................203 1 CHAPTER 1 Diversifying Carotenoid Biosynthetic Pathways in the Laboratory Material from this chapter appears in Diversifying Carotenoid Biosynthetic Pathways by Directed Evolution, Daisuke Umeno‡, Alexander V. Tobias‡, and Frances H. Arnold, Microbiology and Molecular Biology Reviews, 69(1): 51-78 (2005) and is reprinted with permission from the American Society for Microbiology. ‡ Co-first authors 2 SUMMARY Microorganisms and plants synthesize a diverse array of natural products, many of which have proven indispensable to human health and well-being. Although many thousands of these have been characterized, the space of possible natural products—those that could be made biosynthetically—remains largely unexplored. For decades, this space has largely been the domain of chemists, who have synthesized scores of natural product analogs and have found many with improved or novel functions. New natural products have also been made in recombinant organisms via engineered biosynthetic pathways. Recently, methods inspired by natural evolution have begun to be applied to the search for new natural products. These methods force pathways to evolve in convenient laboratory organisms, where the products of new pathways can be identified and characterized in highthroughput screening programs. Carotenoid biosynthetic pathways have served as a convenient experimental system with which to demonstrate these ideas. Researchers have mixed, matched, and mutated carotenoid biosynthetic enzymes and screened libraries of these “evolved” pathways for the emergence of new carotenoid products. This has led to dozens of new pathway products not previously known to be made by the assembled enzymes. These new products include whole families of carotenoids built from backbones not found in nature. This chapter details the strategies and specific methods that have been employed to generate new carotenoid biosynthetic pathways in the laboratory. The potential application of laboratory evolution to other biosynthetic pathways is also discussed. 3 INTRODUCTION Nature is a masterful and prolific chemist. The ever-expanding catalog of natural products from plants and microbes currently stands at more than 170,000 different compounds (35). This collection has profoundly influenced human well-being. Natural products have been used to treat pain, infections, and disease for thousands of years; their equally ancient and diverse uses as colorants, spices, fragrances, aphrodisiacs, cosmetics, and toxins have been fundamental to human culture and development. This trend shows no signs of subsiding. Of the 877 new small-molecule pharmacological entities introduced worldwide between 1981 and 2002, 61% can be traced to natural products (142). A similar proportion (59%) of the 137 small molecules in phase II or III clinical trials for cancer treatment (as of June 2003) are natural products or closely related compounds (172). Natural products and their derivatives therefore remain an essential component of the pharmaceutical industry (172). Given the wealth of functional small molecules in nature, it is perhaps not surprising that so much effort today goes into prospecting for new ones or modifying existing ones. Academic and industrial laboratories, often in massive screening programs, continue to isolate and characterize promising new compounds from biological extracts. In addition, molecular scaffolds inspired by natural products are increasingly being used as the basis for synthesizing combinatorial chemical libraries that can be screened for protein-binding or other biochemical activities (30). Although impressive in number, the known products of natural biosynthetic pathways account for but a tiny fraction of the structures that could be produced. This essentially infinite space of possible functional molecules represents an irresistible 4 frontier for those seeking new, bioactive compounds. For example, only 1/10 of the 877 new small-molecule pharmacological entities mentioned above are bona fide natural products—most are derivatives of natural products, synthetic compounds with natural product-derived moieties, or natural-product mimics (142). The chemical space surrounding natural products is particularly rich in biologically functional molecules, and structurally related compounds can serve human purposes even better than natural products themselves. Researchers are now beginning to explore some of these “nearly natural” products by mixing, matching, and mutating biosynthetic genes from diverse sources in organisms such as Escherichia coli and screening for production of novel metabolites. In this chapter we illustrate how pathways can be “evolved” rapidly in the laboratory to generate new natural products. Used in this way, directed laboratory evolution is a powerful tool for discovering new pathways and for in vivo combinatorial chemistry of natural products, i.e., “combinatorial biosynthesis.” In addition to providing access to novel metabolites, laboratory evolution studies can offer insights into the natural evolution of metabolic pathways and their constituent enzymes. Comparative studies of homologous enzymes can readily identify similarities such as conserved residues and folds. However, identifying the exact genetic changes responsible for differences in the specificity, stability, or other properties of related enzymes is much more difficult. When comparing sequences that have diverged over millions of years, it is almost impossible to distinguish the handful of adaptive mutations from the plethora of differences that reflect evolutionary drift. In contrast, evolution in the laboratory allows us to capture new metabolic pathways in the act of emerging and permits the identification and analysis of the molecular events that gave rise to the new 5 product distributions. With carotenoid biosynthesis as our model, we describe how pathway engineers have used laboratory evolution experiments to diversify biosynthetic pathways and what they have learned from those efforts. This work has demonstrated the remarkable ability of carotenoid biosynthetic enzymes to evolve and acquire new specificities and has illuminated pathway features that facilitate the creation of new natural products based on “unnatural” molecular scaffolds. Although evolutionary pathway engineering is in its infancy, we show that it is capable of generating whole new families of natural product analogs. Some of these compounds may await discovery in nature, while others will probably never be found by natural evolution. Overview of carotenoid biosynthetic pathways The carotenoids are a subfamily of the isoprenoids and are among the most widespread of all natural products. Carotenoids are responsible for many of the colors of animals, plants, and microorganisms and play important biological roles as accessory light-harvesting components of photosynthetic systems, photo-protecting antioxidants, and regulators of membrane fluidity. As a whole, the natural C30 and C40 carotenoid biosynthetic pathways can be organized in a tree-like hierarchy (Figure 1.1), with the trunk representing the initial, universal step of backbone synthesis catalyzed by a carotenoid synthase and the outward-emanating branches and sub-branches collectively denoting the various downstream modification steps seen in different species (8). The hundreds of known carotenoid biosynthetic enzymes fall into relatively few classes, based on the types of transformation they catalyze (isoprenyl diphosphate synthases, carotenoid synthases, desaturases, cyclases, etc.). The enzymes responsible for various 6 versions of a basic transformation are related by evolution (111, 163, 176): the pathways diverged upon accumulation of mutations that altered enzyme specificity. Thus, a small number of basic transformations, subtly modified in different species, collectively lead to a large number of different products, although only a handful of carotenoids (usually a few and almost always fewer than ~10) are made by any one organism. C40 carotenoids are made in thousands of plant and microbial species, starting with the synthase-catalyzed condensation of two molecules of geranylgeranyl diphosphate (C20PP) to form phytoene (Figure 1.1). (Most phytoene synthases produce the 15Z isomer of phytoene (87).) Different types and levels of modification of this C40 backbone account for the majority of known carotenoids. C30 carotenoid pathways starting with the condensation of two molecules of farnesyl diphosphate (C15PP) to form (15Z)-4,4'-diapophytoene (also called dehydrosqualene) are much less widespread, having been found only in a small number of bacteria such as Staphylococcus, Streptococcus, Heliobacterium, and Methylobacterium species (56, 100, 101, 129, 130, 198, 205, 206). These initial C30 and C40 condensation products are dehydrogenated in a stepwise manner by desaturase enzymes, which represent the next important branch points for pathway diversification (70). In bacteria and fungi, a single desaturase catalyzes the entire sequence of carotenoid desaturation steps (32). Carotenoid desaturation in plants, algae, and cyanobacteria (not covered in this chapter) is accomplished by two distinct desaturases and a carotenoid isomerase (7, 31, 72, 86, 131). Desaturases from bacteria such as Pantoea spp. (referred to in this chapter by their former Erwinia species names, which are more commonly used than the current approved names in the carotenoid field) also catalyze isomerization of the carotenoid’s central 7 double bond, giving all-E (trans) desaturated products (65). With a few notable exceptions (157, 200), the desaturation level of the carotenoid backbone is well defined for each organism. In many organisms, desaturation is followed by cyclization, catalyzed by a β- or ε-cyclase and leading to carotenoids with one or two cyclized ends. A variety of further enzyme-catalyzed transformations that can include ketolation, hydroxylation, glycosylation, and oxidative cleavage act on substrates derived from the C30 or C40 backbones to produce the catalog of more than 700 known carotenoids (82). Some organisms synthesize modified C40 carotenoids with additional or fewer isoprenyl units. For example, Corynebacterium glutamicum synthesizes “homocarotenoids” such as flavuxanthin (C45) and decaprenoxanthin (C50) via enzymatic prenylation of lycopene (Figure 1.1) (109, 112). In contrast, several fungi produce C35 “apocarotenoids” such as neurosporaxanthin via oxidative cleavage of monocyclic C40 carotenoids (Figure 1.1) (12, 14, 164, 215). Despite their non-C40 structures, these natural homo- and apocarotenoids are, from a biosynthetic perspective, part of the C40 family, since their biosynthesis proceeds via the C40 carotenoid backbone phytoene. Isoprenoids and isoprenyl diphosphate building blocks are found in all organisms. E. coli has three isoprenyl diphosphate synthases: a farnesyl diphosphate (C15PP) synthase (67, 68), an octaprenyl diphosphate (C40PP) synthase (154), and a Z-type (see below) undecaprenyl diphosphate (C55PP) synthase (94). A C30 carotenoid pathway can be built in E. coli branching directly from the organism’s endogenous C15PP supply (226). However, since E. coli lacks a C20PP synthase function, a geranylgeranyl diphosphate (C20PP) synthase gene must be heterologously expressed along with the other carotenoid biosynthetic genes in order to make C40 carotenoids in this organism. 8 Most of the enzymes involved in carotenoid biosynthesis are membrane associated, and the hydrophobic intermediates and products of carotenoid pathways partition to cytoplasmic or organelle membranes, depending on the type of organism (29). It is not known whether the carotenoid biosynthetic enzymes associate into complexes. Over the years, evidence for the existence of multienzyme complexes that function as “assembly lines” for carotenoid synthesis has been presented (summarized in reference (32)). Some of the most convincing evidence has come from experiments performed in the laboratory of Cerdá-Olmedo with the fungus Phycomyces blakesleeanus (6, 40, 58, 138). On the other hand, the fact that carotenoid enzymes from different organisms are readily combined to generate functional pathways in heterologous hosts is evidence that the formation of a specific enzyme complex is not a prerequisite for carotenoid biosynthesis. Throughout this chapter, we refer to carotenoid-synthesizing enzyme complexes when they provide a possible alternative explanation for particular observations from our laboratory and others’. Carotenoids as a model system for laboratory pathway evolution Carotenoid biosynthesis is particularly well suited as an experimental system for studying pathway evolution in the laboratory. Claudia Schmidt-Dannert recognized that the following features would facilitate such experiments when she first proposed to evolve these pathways as a visiting researcher in this laboratory in 1998. Carotenoids are diverse, and their biosynthetic pathways are representative of other secondary metabolic pathways. Hundreds of carotenoids are known in nature. They are made using a few basic transformations, the earliest of which are highly conserved. The reactions involved in these early steps, such as backbone formation by carotenoid 9 synthases and cyclization by carotenoid cyclases, are mechanistically similar to other reactions in isoprenoid biosynthesis. Modification steps later in the carotenoid pathways cover a wide range of biotransformations, many of which appear in other natural products. Thus, experience with carotenoid pathway evolution can be applied to diversifying other biosynthetic pathways. Carotenoid biosynthetic enzymes are highly portable. The carotenoid pathway emerges directly from the central isoprenoid pathway that exists in all organisms. Thus, in principle, any organism can supply the precursors required for an engineered carotenoid pathway. Carotenoid biosynthetic genes can be expressed in a wide range of organisms to extend or redirect an existing pathway (69, 70, 105). For instance, a bacterial phytoene desaturase (CrtI) introduced into cyanobacteria (227) and tobacco plants (136) elevated their resistance to the herbicide norflurazon (known to block plant-type phytoene desaturases). Plastid-targeted introduction of an algal β,β-carotene ketolase resulted in transgenic tobacco plants that accumulated astaxanthin and changed the color of the plant’s nectory tissue from yellow to red (128). The highly publicized introduction of the β,β-carotene pathway into rice resulted in substantial β,β-carotene levels in the normally carotenoid-free endosperm and therefore greater nutritional value for this food staple (234). Phytoene-producing human cells (HeLa, NIH 3T3, etc.) were created by the addition of a bacterial phytoene synthase and showed increased tolerance to oxidative shock as well as a slower rate of H-ras-induced carcinogenesis (143, 144, 179). Almost all carotenoid biosynthetic genes cloned to date, including those from plants, can be functionally expressed in E. coli (119, 175, 177, 180), as can animal oxidative cleavage enzymes (98, 123, 158, 220, 231). The “portability” of these enzymes greatly facilitates 10 the assembly and evolution of novel biosynthetic pathways. Evolution of carotenoid pathways can be tracked visually. Carotenoids are natural pigments, and their characteristic colors are ideal for product-based high-throughput screening. Scientists have made good use of this feature throughout the history of carotenoid research. Experiments involving the generation and analysis of mutant strains exhibiting altered colors have elucidated biosynthetic routes in various organisms (12, 15, 18, 41, 66, 73, 113, 120, 130, 155, 162, 173, 178, 196, 201, 216). Many carotenoid biosynthetic genes were cloned based on their ability to confer or alter color development in E. coli (53, 55, 133, 134, 160, 197). Carotenoid titers are an indicator of precursor levels and can be used to evaluate and tune upstream (isoprenoid) pathways (189, 223, 224). The colors generated in E. coli colonies provide a facile screen for new pathway products in a laboratory evolution experiment. Carotenoids are valuable in their own right. The polyene chromophores of carotenoids, which absorb light in the 400-550 nm range, provide the basis for their characteristic yellow-to-red colors and their ability to quench singlet oxygen (5, 74, 79, 95, 103, 137, 218, 230). Carotenoids act as antioxidants in vivo (170, 183, 210), and many beneficial effects of carotenoids on human health have been reported, ranging from cancer prevention and tumor suppression to upregulation of immune function, reduction of the risk of coronary heart disease or age-related degeneration, and cataract prevention (19, 21, 43, 48, 83, 108). As natural pigments, carotenoids are used as colorants in foods, cosmetics, and flowers (117, 128, 209). Given these diverse and important properties of known carotenoids, we can assume that novel compounds of this family will also possess interesting biological or chemical functions. 11 Evolvable pathways and enzymes The diversity of carotenoids and biosynthetic enzymes that exists in nature demonstrates the success of evolution in discovering and optimizing new pathways. Carotenoid pathways are evolvable and understanding the features that lead to this evolvability will allow us to design directed evolution experiments to accomplish the same goals. We define an evolvable pathway as one that can produce many new metabolites after limited genetic change. New metabolites are made following recruitment of new enzymes or functional alteration of existing ones. Such events are rare, and evolvable pathways must be particularly effective at exploiting these rare events. In general, evolvable pathways appear to contain enzymes that are “locally specific” (32). These enzymes are not unspecific; rather, they recognize a particular structural motif common to a variety of possible substrates. Thus, if a change upstream of a locally specific enzyme generates a novel compound, there is a good chance that the enzyme will metabolize this compound further (as long as it retains the required motif) and generate a new derivative. More such enzymes further downstream will accept the new derivative(s) and produce yet more new metabolites. A carotenoid desaturase, for example, might need at most a few mutations in order to catalyze double-bond formation on a new carotenoid-like backbone. Locally specific modifying enzymes further downstream would, with high probability, accept these desaturated substrates, generating still more new compounds. Pathway structure also contributes to evolvability: highly branched pathways can propagate discoveries along many routes. Pathway branches occur where one substrate is potentially converted to multiple products by the action of one or more enzymes. The 12 existence of nested branches geometrically increases the number of new products that can be synthesized from a new metabolite produced upstream, provided that the downstream enzymes accept the new substrates. Evolvable and consequently diverse, carotenoid pathways are “bushy,” with multiple products possible from each basic transformation. Product possibilities are dictated by the nature of the chemical reaction and substrate, and ultimately by the specificity of the enzyme that controls that branch point. For example, desaturation of a carotenoid backbone can produce a number of different products—the one(s) produced by any given organism reflect the specificity of its particular desaturase in its environment. That specificity can change upon mutation and can open new pathway branches. Pathways constructed entirely of locally specific enzymes would not serve a host organism well in terms of regulation and production of tried-and-true metabolites. Thus, we expect evolvable pathways to contain more specific enzymes as well. To maximize the ease of exploring new pathways while preserving key metabolic processes, we would expect these specific enzymes to be located at the earliest steps of a pathway. Here, they can serve as molecular gatekeepers, allowing only certain primary metabolites to enter but not impeding the discovery of new structures within the pathway. Manipulating these gatekeeper enzymes to admit different substrates should be an effective way to generate whole new families of natural products. Thus, features contributing to the evolvability of a biosynthetic pathway include the use of locally specific enzymes and biotransformations that contribute to pathway branching. More-specific gatekeeper enzymes limit what flows through the pathway, providing necessary insurance against chemical chaos. In the end, however, pathways are 13 evolvable because their component enzymes are themselves evolvable, changing properties such as substrate and product specificity readily upon mutation. Evolvable enzymes should also exhibit multiple mutational routes to a given altered phenotype and may be comparatively robust to mutation. The former property increases the chances that new phenotypes will emerge, while the latter property allows “scanning” of similar sequences without loss of function. Perhaps surprisingly, it is still an open question whether promiscuous or locally specific enzymes are more evolvable than enzymes that are highly specific. As we detail in this chapter, as little as a single amino acid substitution can change the specificity of highly specific carotenoid biosynthetic enzymes. An evolvable pathway, then, would consist of an evolvable gatekeeper enzyme (or set of enzymes) coupled with locally specific downstream enzymes. Such an arrangement maximally exploits mutations in the gatekeeper enzyme, converting a single newly discovered molecule into a potentially large number of new metabolites. Several lines of evidence support the view that the enzymes involved in carotenoid biosynthesis are highly evolvable and are embedded in pathways with such evolvable structures. This chapter represents the first attempt at gathering together this evidence, which collectively paints a picture of carotenoid biosynthetic pathways as dynamic systems capable of exploring a diversity of product structures much greater than is seen in nature. We now examine the various ways in which this evolvability has been exploited in the laboratory to explore and extend the product diversity of these pathways. 14 APPROACHES TO ENGINEERING NOVEL BIOSYNTHETIC PATHWAYS New biosynthetic pathways can be created by recruiting foreign catalytic machinery that adds a new branch; such enzyme recruitment happened frequently during the evolution of natural-product pathways (20, 27, 116). A pathway can also diversify when the function of an existing enzyme is altered by mutation or other genetic change. The wide functional diversity that exists within the evolutionarily related carotenoid pathways is evidence that enzyme evolution has played a central role in creating chemical diversity, primarily through modification of substrate and product specificity. In the laboratory, researchers can now employ the same strategies of enzyme recruitment and modification to create new biosynthetic pathways. In this chapter, we refer to coexpressing genes from different sources in a recombinant organism as gene assembly. This approach can be distinguished from directed evolution of the component enzymes (or their regulation), where libraries of mutant alleles are expressed along with other pathway genes in host cells, which are then screened or selected for desired properties. These two approaches generate novel compounds by mimicking the major modes of natural pathway evolution: gene transfer and divergence. Thus, the two approaches complement one another, and we consider both to fall under the umbrella of laboratory pathway evolution. In this section, we discuss efforts to create new carotenoid biosynthetic pathways by using gene assembly, directed enzyme evolution, and combined approaches. Engineering pathways by gene assembly Assembling carotenoid biosynthetic genes from different organisms and expressing these “hybrid” pathways in a recombinant host has generated functional routes 15 to rare or novel carotenoids (Figure 1.2) (4, 5, 13, 69, 105, 118, 192, 199, 211). Where gene assembly alone successfully yielded a new pathway branch or extension, the recruited enzyme(s) usually catalyzed transformations later in the pathway. These downstream enzymes are locally specific and can accept a range of substrates. Various unusual acyclic carotenoids were obtained by assembling carotenogenic genes from Pantoea ananatis (Erwinia uredovora) and Rhodobacter capsulatus (4, 5). Coexpression of the C20PP synthase CrtE and the phytoene synthase CrtB from E. uredovora along with various combinations of three different carotenoid desaturases, a carotenoid hydratase, a β-cyclase, and a hydroxylase resulted in the production of four previously unidentified carotenoids, including 1-OH-3',4'-didehydrolycopene with potent antioxidant activity (5). In another example, addition of CrtW, a β-end ketolase from Paracoccus sp. strain MBIC1143 (“Agrobacterium aurantiacum”), extended the zeaxanthin β-D-diglucoside pathway from Erwinia, leading to synthesis of novel compounds, astaxanthin β-Ddiglucoside and adonixanthin 3'-β-D-glucoside (Figure 1.2) (235). As we show in later sections, other downstream carotenoid-modifying enzymes are also locally specific and should be similarly useful for “combinatorial biosynthesis” of novel carotenoids by gene assembly. We predict that systematic combinatorial assembly of these genes will result in the biosynthesis of many hundreds of new carotenoids. Assembling locally specific enzymes in a recombinant organism can sometimes result in an interconnected “matrix” pathway that leads to numerous carotenoid structures, as illustrated in Figure 1.3 (135). However, many of the intermediates or end products may not be accessible due to imbalances in enzyme expression, activity, or specificity. Thus, a few dominant compounds may be produced, while other (possible) ones remain 16 hidden (but poised to appear under different conditions). Furthermore, it can be difficult to predict the relative abundances of the different metabolites. For example, various attempts to construct a pathway for astaxanthin synthesis in a heterologous host resulted in quite different proportions of astaxanthin and intermediates (76, 135). In another example, introduction of the carotenoid biosynthetic enzymes CrtB, CrtI, CrtY, and CrtZ from Pantoea agglomerans (Erwinia herbicola) into a desaturase-deleted mutant of Rhodobacter sphaeroides merely restored desaturation activity and failed to alter the range of carotenoids produced (85). This occurred despite the introduction of a β-cyclase (CrtY) and a β-end hydroxylase (CrtZ) into a host lacking these catalytic functions. Only when the endogenous neurosporene hydroxylase gene (crtC) was deleted was a functional pathway to cyclized and hydroxylated carotenoids realized (69, 70). In this case, the endogenous CrtC in R. sphaeroides may have been so active that the desaturase CrtI, cyclase CrtY, and β-end hydroxylase CrtZ introduced from E. herbicola could not compete with it for neurosporene. Another possible explanation is that incorporation of CrtC into a carotenoid biosynthetic enzyme complex blocked the additional inclusion of CrtY, CrtZ, and more than three desaturase subunits. These examples illustrate the importance of properly coordinating pathway enzymes in order to create a specific pathway to a desired product. This problem of miscoordination makes it exceedingly difficult to systematically explore all the possible metabolites of a given set of enzymes solely by gene assembly. A major task of pathway engineers will be to coordinate assembled components in order to unmask hidden metabolites. This can be accomplished by directed evolution. 17 Engineering pathways by directed enzyme evolution Nature has generated a vast number of biosynthetic genes by mutation, recombination, and natural selection. Variations in properties such as desaturation step number or synthase specificity contribute enormously to the diversity of carotenoid structures seen in nature. In the previous section, we presented examples of how gene assembly alone can lead to novel or unusual carotenoids. However, we can also consider creating enzyme variants with desired specificities (or other properties such as expression level or stability) by evolving them in the laboratory. This approach circumvents the need to find a specific function in nature and reproduce that function in a heterologous host. Instead, enzymes with the desired properties are found by screening libraries of mutants of an enzyme that performs the same type of chemical transformation. Some enzyme specificities not available in nature become readily available by evolution in the laboratory, opening pathways to new metabolites. Decoupled from the biological constraints imposed by the need to fulfill a particular function throughout the course of evolution, a pathway can in principle explore all chemically accessible products, not just those that are biologically relevant (10). Thus, directed evolution gives us the ability to explore the space of possible chemical products much more rapidly and also more thoroughly than does natural evolution. By evolving biosynthetic enzymes, we can anticipate the discovery of large numbers of new natural products, on the benchtop in convenient laboratory hosts. Although each directed evolution project is unique, all involve two main steps: making a library of mutants and searching that library for desired properties. The mutant library is typically generated in an error-prone PCR amplification reaction (39, 124) 18 tuned to generate a certain average point mutation rate or by DNA shuffling, a method that makes new point mutations and recombines existing mutations (193) (many methods are available for making libraries of mutant genes for directed evolution; useful protocols are given in reference (9)). The library of mutated DNA molecules is then subcloned into an appropriate vector for expression with other pathway genes in a convenient host organism such as E. coli. Hundreds or thousands of clones are screened in search of (typically) rare ones expressing favorably altered enzymes. A powerful aspect of this process is that it can be iterated—improved variants can be subjected to further rounds of mutagenesis and screening, often leading to further improvements. A sensitive, reliable screen is key to a successful directed evolution experiment: the screen allows the researcher to identify the typically rare mutants with new and interesting properties. Different strategies exist for evolving metabolic pathways in the laboratory. In an early study, multiple genes in an arsenate degradation pathway were subjected to mutagenesis and recombination all at once (50). This “fully blind” approach makes the most sense when little is known about which genes or non-coding regions (such as ribosomal binding sites) should be mutated to obtain a desired phenotype. However, a significant disadvantage of this approach is that the combinatorial complexity (the size of the library) increases concomitantly with the length of DNA targeted for mutation. Consequently, more clones must be screened to find the rare ones with improved properties. Therefore, when possible, it is attractive to target individual genes for mutation and then screen those mutants in the context of the whole pathway; this can be thought of as a “partially blind” approach. Carotenoid biosynthetic pathways are sufficiently well characterized that investigators generally know which enzyme to target 19 for mutagenesis in order to achieve a new product distribution; however, the specific mutation(s) needed is unknown. Accordingly, researchers have thus far chosen to extend carotenoid pathway branches in a stepwise manner by evolving one gene at a time and expressing the library of variant alleles together with other wild-type or previously laboratory-evolved pathway genes. Schmidt-Dannert et al. demonstrated the effectiveness of this approach for diversifying the range of carotenoid structures accessible from a given set of enzymes (181). PROBING THE EVOLVABILITY OF CAROTENOID BIOSYNTHETIC ENZYMES AND PATHWAYS In the Introduction, we reasoned that highly evolvable pathways would be assembled from locally specific downstream enzymes and (a small number of) more specific “gatekeeper” enzymes. Furthermore, the enzymes themselves should readily alter specificity upon mutation. Modifying a gatekeeper enzyme, accompanied by fine-tuning of downstream enzymes where needed, could allow whole new families of natural products to emerge. In this section, we assess the evolvability of carotenoid biosynthetic pathways and enzymes in view of the (laboratory) data now available. Directed evolution of key carotenoid biosynthetic enzymes Isoprenyl diphosphate synthases. Isoprenyl diphosphate synthases (IDSs) catalyze the consecutive condensation of five-carbon isopentenyl diphosphate with allylic diphosphates to generate the precursors to all isoprenoid compounds. A variety of IDSs supply the building blocks for the >33,000 known isoprenoids (89) ranging in size from C5 to C~2,500 (49, 146). IDSs catalyze the 1'–4 condensation of an allylic diphosphate 20 (C5nPP) with isopentenyl diphosphate, producing the next incremental isoprenyl diphosphate (C5(n+1)PP) (Figure 1.4). This process continues until the growing isoprenoid chain reaches a certain length, at which point the reaction terminates and the product is released from the enzyme. There exist E-type IDSs that synthesize products with precise all-E (trans) double-bond stereochemistry as well as Z-type IDSs that catalyze the formation of cis-double bonds in the growing isoprenyl chain. IDS enzymes are quite specific in their product size and are often classified on this basis. Elucidating the molecular mechanisms of chain length control has been a major scientific interest in the study of this class of enzymes; for reviews, see references (97, 122, 145, 225). Although IDSs make specific products, minor modifications can change this specificity. Ohnuma et al. randomly mutated the farnesyl diphosphate (C15PP) synthase gene from Bacillus stearothermophilus (bstFPS), coexpressed this mutant library along with phytoene synthase (crtB) and phytoene desaturase (crtI) genes in E. coli, and looked for colonies that produced the red C40 carotenoid, lycopene (152). Most of the colonies were colorless because they lacked the C20PP precursor needed by CrtB to make carotenoids. However, a small fraction of the colonies were pink due to lycopene production; these harbored mutant C15PP synthases capable of synthesizing C20PP. In further work, the same group generated additional variants of BstFPS that made even longer products (150). Some of the double and triple mutants of this enzyme yielded products as large as C>100PP. In another study, Ohnuma et al. converted an archaebacterial C20PP synthase into C25PP and C30PP synthases by mutagenesis coupled with complementation screening in a yeast strain deficient in C30PP synthesis (148). In all the above cases, analysis of mutants making larger products revealed substitutions for 21 smaller amino acids at a position 5 residues upstream of the first aspartate-rich motif (FARM) of the enzyme (151). Aided by the crystal structure of Gallus gallus (chicken) C15PP synthase (204), Tarshis et al. independently found a similar result with this enzyme (203). Site-directed mutagenesis at the fifth (F112) and fourth (F113) residues upstream of the FARM showed that smaller amino acids at these positions yielded enzymes that produce longer products. Subsequent work also demonstrated the converse: replacement of chain-length determining residues just upstream of the FARM with larger amino acids leads to shorter products. For example, Sulfolobus acidocaldarius C20PP synthase was rationally converted into a C15PP synthase using this approach (149). The C15PP synthases from B. stearothermophilus and G. gallus were converted to geranyl diphosphate (C10PP) synthases by the same strategy (61, 141). This strategy of substituting residues just upstream of the FARM with smaller or larger amino acids has also been applied to a plant short-chain (C20PP) IDS (104), heterodimeric medium-chain (C30PP and C35PP) IDSs (78, 81, 238), as well as long-chain (C40PP-C50PP) synthases (75, 153) to alter the product chain length. In several cases, substitution of residues lining the substrate binding pocket but distant from the FARM (or even located on the opposite subunit in heterodimeric enzymes) has also modified the product chain length (75, 77, 80, 92, 96, 148, 152, 238, 239). Many of these substitutions enhance the effects of mutations upstream of the FARM, leading to even greater changes in the product chain length. Several C15PP synthases have some degree of substrate tolerance (57, 107) and can be used for stereospecific synthesis of various insect hormones and related analogs (102, 106, 126). BstFPS was found to accept a number of nonnatural substrates (140), 22 and its substrate range was further broadened by substitutions at Y81, previously described as a chain length-determining residue (151) (see above). The Y81A variant of BstFPS, for example, accepts various isoprenyl diphosphate analogs with ω-oxygen atoms in their prenyl chains as substrates, leading to the enzymatic synthesis of butterfly hair pencil pheromone and analogs (125). In theory, all of these isoprenoid diphosphate analogs could serve as building blocks for the enzymatic synthesis of carotenoid analogs. IDSs from diverse species have exhibited evolvability in the laboratory. Although the wild-type IDSs are quite specific with respect to product size, minor genetic changes were found to profoundly alter the number of elongation steps and therefore the size of the products formed by these enzymes. The residues that were found to change the specificity of these IDSs upon mutation form a key part of the reaction pocket that accommodates the elongating isoprenoid chain, and it appears that product specificity is largely dependent on the size of this pocket (61, 203). Inspection of the data from the reports describing the modification of product specificity reveals that, in general, the mutant IDSs have a broadened rather than a shifted product range. In most cases, mutants synthesize multiple new products as well as the old one. In contrast, wild-type IDSs, although related by evolution, are very specific with respect to the length of their products. We now know that a single amino acid substitution can broaden the product range of an IDS. However, we do not know the degree of genetic change required to completely shift IDS product specificity such that it synthesizes only isoprenyl diphosphates of a new length. Carotenoid synthases. Carotenoid synthases catalyze the synthesis of a carotenoid backbone from isoprenyl diphosphate precursors. Various phytoene (C40) 23 synthases have been isolated from organisms ranging from bacteria to higher plants. Only one C30 carotenoid synthase has been cloned and sequenced to date: crtM from Staphylococcus aureus (226). It has long been recognized that the enzyme-catalyzed reaction leading to formation of the carotenoid backbone is very similar to the reaction catalyzed by squalene synthase (SqS), the first committed enzyme in cholesterol biosynthesis (32). Carotenoid synthases and SqS employ the same mechanism, and SqS produces the C30 carotenoid backbone if deprived of NADPH (88, 202, 237). Carotenoid synthases and SqS also share several highly conserved domains, and it is likely that the two have a common evolutionary origin (176). The biosynthesis of carotenoid backbones (and squalene) has proven to be a complex process (22, 88, 89) (Figure 1.5a). The reaction proceeds in two distinct steps. The first consists of abstraction of a diphosphate group from a prenyl donor followed by 1-1' condensation of the donor and acceptor and loss of a proton to form a stable cyclopropyl intermediate. In the second step, the cyclopropyl intermediate is rearranged, the second diphosphate group is lost, and the resultant carbocation is quenched after the loss of another proton (Figure 1.5a). Biochemical (156) and structural (159) studies have shown that these two subreactions occur in physically distinct sites in the enzyme (Figure 1.5b). Carotenoid synthases are quite specific with respect to product size, which reflects a strong preference for prenyl diphosphate substrates of a particular length. The C40 carotenoid synthase CrtB does not detectably accept C15PP as a substrate, while the C30 synthase CrtM accepts two molecules of C20PP to form C40 carotenoids much less 24 efficiently than it accepts two molecules of C15PP to form C30 carotenoids (163, 214). Even though various longer and shorter isoprenyl diphosphates are made by different organisms (146), no known carotenoids are derived from them. Terpene synthases also utilize specific precursors (42), although product specificity can be quite modest (190). Carotenoid synthases, positioned early in the biosynthetic pathway and possessing the ability to discriminate between isoprenyl diphosphate substrates with different numbers of isoprene units, appear to play the role of pathway gatekeeper, particularly in organisms in which multiple potential substrates are available. Indeed, as we illustrate, downstream carotenoid biosynthetic enzymes are less specific than the synthases and appear to recognize only a particular motif of the substrate. In the Introduction, we reasoned that gatekeeper enzymes should be attractive targets for pathway diversification. If carotenoid synthases could be engineered to accept different prenyl substrates and synthesize carotenoid backbones from them, the locally specific downstream enzymes might accept these new backbones and generate the corresponding metabolites. This would give rise to whole new pathway families. Compared to the IDSs, however, little is known about the molecular basis for the substrate and product specificity of carotenoid synthases. Following the lead of those who studied the IDSs (96, 122, 125, 141, 147, 148, 150-152, 203, 238, 239), we probed the evolvability of size specificity in the carotenoid synthases by looking for mutants that complement a non-native pathway. Using errorprone PCR to perform random mutagenesis, expressing the mutant genes with the remaining genes necessary to produce lycopene in E. coli, and screening to find red colonies, we identified single amino acid substitutions in the S. aureus C30 carotenoid 25 synthase CrtM (F26L or F26S) that confer the ability to make the C40 backbone just as efficiently as CrtB (Chapter 2, (214)). Repeating this experiment using a PCR method designed to guarantee that the libraries would be free from mutation at F26 allowed us to uncover two additional amino acid substitutions, W38C and E180G, that also confer C40 function on CrtM (213). Mapped onto the crystal structure of human squalene synthase (SqS, see Figure 1.5b), F26 and W38 appear in helices B and C, respectively, and the side chains of both residues point into the pocket that accommodates the second halfreaction (rearrangement of the cyclopropyl intermediate). Replacement of these amino acids with smaller ones significantly increased the C40 synthase activity of CrtM (Figure 1.5c). Conversely, the C30 synthase performance was the highest for wild-type CrtM and decreased with decreasing size of the amino acid residues at these positions. This analysis led to our proposal that wild-type CrtM is able to perform the rate-limiting first halfreaction of phytoene synthesis—condensation of two molecules of C20PP to form the cyclopropyl intermediate, prephytoene diphosphate—but the second half-reaction is prevented from going to completion by steric inhibition of the normally fast rearrangement step. Unable to convert into phytoene in wild-type CrtM, prephytoene diphosphate either remains stuck in the enzyme, departs, or undergoes other types of rearrangement to yield noncarotenoid products. (A similar phenomenon is well known for SqS; in the absence of NADPH, which is required to convert presqualene diphosphate to squalene, SqS produces a complex mixture of non-squalene compounds including rillingol, 10-hydroxybotryococcene, and 12-hydroxysqualene (22, 89).) However, in CrtM mutants where F26 or W38 is replaced with a smaller or more flexible amino acid, the prephytoene diphosphate formed from two molecules of C20PP is efficiently 26 rearranged to form phytoene. Thus, the F26 and W38 mutations apparently modify the product specificity, not the substrate specificity of CrtM: they do not act by allowing the enzyme to bind and accept GGPP as a substrate but, rather, allow the intermediate prephytoene diphosphate to be converted to phytoene. Gain of C40 function by mutagenesis of CrtM usually came at a cost to the original C30 synthase activity. For example, some enzymes doubly mutated at F26 and W38 showed only negligible C30 synthase activity. However, other modes of obtaining C40 synthase activity were possible. The E180G substitution increased performance in both the C30 and C40 contexts (212). Mapped onto the SqS structure, E180G is positioned outside the reaction pocket but close to the site of the first half-reaction. We think this mutation accelerates the rate-limiting first half-reaction. Several such activating mutations were found by random mutagenesis of CrtMF26S in a successful search for improved or restored C30 function (D. Umeno, unpublished results). All of these activating mutations were rather far from the reaction center (Figure 1.5b, indicated in yellow) and enhanced both C30 and C40 synthase activity. These mutations could be increasing expression level, stability (half-life in vivo), or specific activity. Like IDSs, carotenoid synthases appear to be specific, but at least in the case of CrtM, that specificity is readily altered by mutation. Furthermore, there are multiple mutational routes to the same altered phenotype. In contrast, in similar experiments with CrtB, we were unable to find any mutations that conferred C30 carotenoid synthase function. We are tempted to speculate that CrtM, by virtue of the fact that it does not need to select C15PP from C20PP in its natural host (C20PP is not made in C30 carotenoidproducing organisms), is inherently more evolvable toward accepting C20PP than is CrtB 27 toward accepting C15PP because CrtB has always had to select C20PP over C15PP (the latter is present in all organisms). CrtM can in fact accept C20PP in a hybrid reaction: when supplied with both C15PP and C20PP, wild-type CrtM can condense one molecule of each to synthesize a C35 carotenoid backbone (see below). CrtM has thus proven to be an evolvable enzyme, while CrtB has not, at least with respect to the specific tasks of accepting a larger (CrtM) or smaller (CrtB) substrate. As was the case with the IDSs, a single amino acid substitution was sufficient to increase the size of the products synthesized by CrtM. Furthermore, as we describe below, the mutants of CrtM that function in a C40 carotenoid biosynthetic pathway are also capable of synthesizing even larger carotenoid backbones when supplied with the appropriate precursors. Carotenoid desaturases. Phytoene and 4,4'-diapophytoene, the (colorless) products of the natural carotenoid synthases, have three conjugated double bonds in the center of their backbones. Formation of carotenoid pigments requires extension of this conjugated double-bond system. The photochemical properties of a carotenoid (including its color) depend strongly on the size of the chromophore and therefore on the number of desaturation steps catalyzed by the desaturase enzyme(s). A C40 backbone can accommodate up to 15 conjugated double bonds, corresponding to six sequential desaturation steps. C30 carotenoids can undergo at most four desaturation steps (11 conjugated double bonds). In general, bacterial C40 desaturases are functional on C30 carotenoids and vice versa. It is proposed that carotenoid desaturases recognize only a portion of the substrate molecule common to both C30 and C40 carotenoid backbones (163, 174). Subsequent carotenoid-modifying enzymes are also often locally specific (see below). Because each 28 of the desaturation intermediates represents a branch point for further diversification by downstream enzymes, altering and controlling the desaturation step number is key for creating extensive molecular diversity (70). Nature has done this: many different carotenoid desaturases are known in C40 pathways, each with its specific step number. Carotenoid desaturases that primarily catalyze two, three, four, and five desaturation steps are known; one-step and six-step desaturated carotenoids have been reported only as minor products in natural carotenogenic organisms. The ability of carotenoid desaturases to accept different substrates was demonstrated when C30 and C40 desaturases were tested in each other’s pathway (163, 214). C40 desaturases from Erwinia (four-step enzymes), Rhodobacter (three-step), and Anabaena (two-step) are all active on C30 substrates. Similarly, the C30 desaturase CrtN showed measurable activity in a C40 pathway. The localized specificity of these desaturases has been exploited in engineered pathways (211) (see below). The desaturase step number can be inferred from the color (or color change) of the carotenoids produced in vivo. This provides an excellent basis for screening mutant desaturases in the laboratory for the ability to accept new substrates or for changes in product specificity. Using this principle, Schmidt-Dannert et al., working in this laboratory, readily isolated desaturase variants with altered step number in a C40 pathway (181). Starting from a library made by DNA shuffling of two closely related four-step phytoene desaturases (crtI from Pantoea agglomerans [E. herbicola] and crtI from Pantoea ananatis [E. uredovora]), they isolated one four- to six-step variant, CrtI14 (Figure 1.6), as well as 20 variants that catalyze fewer than four desaturation steps on phytoene. Wang and Liao conducted similar experiments with the three-step desaturase 29 from Rhodobacter sphaeroides (222). Two rounds of random mutagenesis by error-prone PCR and color screening resulted in variants that accumulated the four-step product, lycopene. At least five different mutations increased the step number of this desaturase. Furthermore, some combinations of mutations resulted in yet higher production of lycopene (222). We recently investigated the ability of the C30 desaturase CrtN from S. aureus to alter its product specificity upon mutation. CrtN is a three-step desaturase in S. aureus (226). E. coli colonies expressing this enzyme together with the C30 synthase CrtM develop a yellow-orange color due to the production of 4,4'-diaponeurosporene (three steps) and 4,4 '-diapolycopene (four steps). When E. coli were transformed with a library of crtN mutants made by error-prone PCR, the variation in the colors of the colonies (Figure 1.7), from pale to weakly fluorescent, lemon, yellow, orange, and red, was striking. To our surprise, approximately 30% of the colonies were lemon or yellow in color, different from the wild type. A random subset of these clones was shown to produce the rare C30 carotenoids 4,4'-diapophytofluene (one-step desaturation) and 4,4'diapo-ζ-carotene (two steps). We also isolated a large number of red mutants, which were found by high-performance liquid chromatography (HPLC) analysis to produce mainly 4,4'-diapolycopene (four desaturation steps) (Figure 1.7). Multiple experiments have thus shown that bacterial carotenoid desaturases are evolvable. The high frequency of color variants in the mutant libraries suggests that there are multiple mechanisms by which the step number can change upon mutation. It is possible that most (if not all) mutants with altered desaturation step number have acquired this change in product specificity by up- or down-regulating total desaturase 30 activity rather than by altering intrinsic enzyme specificity, which we would expect to occur only rarely. The higher frequency of mutants with a lower desaturation number compared to mutants with an elevated desaturation number supports this idea because there are many more paths downward with respect to a property such as activity or expression level. Many mutant desaturases with elevated step numbers turned out to have mutations near a putative flavin adenine dinucleotide (FAD)-binding domain (181, 222), indicating that FAD access might be a source of step number control. Carotenoid desaturases tend to exhibit more well-defined product specificity in their natural hosts than when (over)expressed in a heterologous host. For instance, CrtN appears to be a three-step enzyme and produces almost exclusively 4,4'diaponeurosporene in S. aureus (226). In a heterologous host, however, its desaturation step number is less distinct. Several groups have reported that CrtN produces the fourstep 4,4'-diapolycopene as a major product in an E. coli system (118, 163, 211, 214). Desaturase step number can also be altered by manipulation of enzymes further downstream in the carotenoid pathway (69). It is not surprising that altering the environment of a desaturase can alter its product specificity. If downstream enzymes that normally remove certain desaturation products are not present, the desaturase may have an opportunity to catalyze further desaturation steps. In addition, if these enzymes associate in complexes, expression of a desaturase with other carotenoid biosynthetic genes from different organisms could yield complexes with altered or suboptimal substrate transfer properties, which could affect the desaturation step number. Further research should shed light on the source of desaturase specificity and on the ways in which specificity can be altered. 31 Carotenoid cyclases. Cyclization is another important branch point for carotenoid diversification. Cyclic carotenoids are produced in plants, algae, and photosynthetic bacteria, and enzymes catalyzing the formation of different cyclic products have been characterized (11, 53, 55, 84, 109-111, 194). A given cyclase usually produces only one kind of ring structure (32). However, an exception was recently reported by Stickforth et al., who showed that the enzyme CrtL-e from the cyanobacterium Prochlorococcus marinus is both a β- and an ε-cyclase (194). The cyclases share nearly identical mechanisms, differing only in the final rearrangement step (Figure 1.8a). Although lycopene, with its two ψ-ends, is the natural substrate for most known cyclases, studies have shown that some cyclases can act on a wider range of substrates (Figure 1.8b). An ability to convert different substrates was reported for Arabidopsis εend lycopene cyclase, which can cyclize the ψ-end of neurosporene to form αzeacarotene (54, 55). Britton noted that the only apparent requirement for recognition and catalysis by carotenoid cyclases is that the substrate have a ψ-end (Figure 1.8b) (32). However, Takaichi et al. showed that bacterial and plant lycopene cyclases can cyclize the 7,8-dihydro-ψ-end of ζ-carotene and neurosporene (199). Recently, we showed that E. uredovora β-cyclase and a plant ε-cyclase can efficiently cyclize nonnatural carotenoids with a C35 backbone (211). Similarly, Lee et al. reported that the C30 carotenoid 4,4'diaponeurosporene can be cyclized by Erwinia β-cyclases, leading to the novel cyclic C30 carotenoid diapotorulene (118). Another interesting enzyme is capsanthin-capsorubin synthase (CCS) from Capsicum annuum. The primary natural function of CCS is to rearrange the epoxidized cyclic carotenoids antheraxanthin and violaxanthin into the cyclopentyl κ-end products capsanthin and capsorubin. When expressed in E. coli, 32 however, CCS was shown to also possess lycopene β-cyclase activity, cyclizing both ends of lycopene to yield β,β-carotene (84). All known β-cyclases, except one recently discovered in a marine bacterium (207), create rings at both ends of lycopene. In contrast, known ε-cyclases except those from Lactuca sativa (lettuce) and the flower Adonis aestivalis generate monocyclic carotenoids (53). In an attempt to manipulate the ring number and understand how it is determined, Cunningham and Gantt constructed a series of single-crossover chimeras of one-step (Arabidopsis thaliana) and two-step (Lactuca sativa) ε-cyclases (53). Analysis revealed a region of six amino acids involved in ring number determination. Further mutagenesis experiments identified single-amino-acid substitutions that alter ring number specificity: in the lettuce two-step cyclase Dy4, substitution of H457 with leucine converted the enzyme into a monocyclase; the corresponding L448H mutation in Y2, the Arabidopsis monocyclase, resulted in an enzyme that forms two rings. Thus, ring number specificity can be modulated with a single amino acid substitution. The authors of this study suggested that the residues they identified may play a role in dimer formation (53). Lycopene may be oriented in the plasma membrane such that one of its ends is more accessible to the cyclase than the other. Only when cyclase dimers are formed does binding of the more accessible end bring the less accessible end close enough to the other subunit for it to be cyclized as well. An alternative but similar explanation for the above observations is that the mutations alter the cyclase oligomerization state within a carotenoid-synthesizing complex. For example, when one cyclase subunit is present in each complex, carotenoid products are cyclized on only one end whereas complexes with two cyclase subunits would cyclize carotenoids at both ends. Association of cyclase 33 monomers in a complex would depend on their interactions with each other and the other constituents of the complex, and a single amino acid substitution could be sufficient to disrupt (or promote) this association. It is also possible that the single amino acid substitutions described above alter the enzyme’s intrinsic preference for the carotenoid substrate that has already been cyclized on one end. The H457L mutation may reduce the preference of Dy4 for the monocyclic substrate, while the L448H mutation increases the ability of Y2 to cyclize it. CrtI14 is a four- to six-step desaturase, and E. coli cells expressing this variant along with CrtE (a C20PP synthase) and CrtB (a C40 carotenoid synthase) can synthesize 3,4,3',4'-tetradehydrolycopene (Figure 1.6) (181). When CrtY, the β-cyclase from Erwinia, was coexpressed with these enzymes, the cells synthesized exclusively β,βcarotene—the same product made by cells expressing wild-type CrtE, CrtB, CrtI, and CrtY. Directed evolution, however, could create a pathway leading to a new cyclized product: after performing DNA shuffling to make a library of CrtY variants and coexpressing these with CrtI14 and CrtE, Schmidt-Dannert et al. identified clones that accumulated the monocyclic carotenoid torulene (Figure 1.6) (181). Pigment analysis from cells harboring the CrtY mutants including CrtY2 (Figure 1.6) revealed torulene together with lycopene, 3,4,3',4'-tetradehydrolycopene, β,ψ-carotene, and β,β-carotene. Torulene-producing variants were also discovered when the CrtY library was created by error-prone PCR (D. Umeno, unpublished results). These mutants made up 2 to 5% of the library. This high frequency of torulene-producing mutants suggests that the torulene pathway emerged by down-regulation of cyclase activity. Mutants of CrtY with decreased catalytic activity would compete less efficiently with CrtI14 for the ends of the carotenoid 34 substrate, with the result that only one end is cyclized while the other is desaturated, leading to torulene. Alternatively, the CrtY mutants found in the torulene-producing clones may be compromised in their ability to form dimers, either as part of larger carotenoid enzyme complexes or not. Although the underlying mechanisms for the changes in cyclase step number remain obscure, it is clear that carotenoid cyclases are evolvable: their phenotype can change dramatically with a small number of mutations, and there appear to be multiple pathways to a particular phenotype. As we show in the next section, combining evolved carotenoid desaturases and cyclases with locally specific enzymes further downstream allows an even larger natural product space to be sampled. To date, carotenoid cyclases have not been evolved in the laboratory for altered product specificity, for example to convert a β-cyclase to an ε-cyclase or vice-versa. These cyclases have very similar chemical mechanisms (Figure 1.8a), and we predict that cyclase product specificity will be easily modified by mutation. Enzymes catalyzing further modifications. Numerous enzymes catalyzing hydroxylation, epoxidation, glycosylation, O-methylation, acyl transfer, prenyl transfer, oxidative cleavage, and other reactions on cyclic and acyclic carotenoids have been cloned and expressed in E. coli (for reviews, see references (175) and (180)). Misawa et al. made an early demonstration of the localized specificity of these modifying enzymes (135). Introduction of the β-end 3-hydroxylase CrtZ and the β-end 4-ketolase CrtW into E. coli harboring a β,β-carotene pathway led to the accumulation of as many as nine carotenoids (Figure 1.3). Recent work has revealed that many carotenoid-modifying enzymes act on a range of substrates (5, 16, 118, 191, 197). Lee et al. exploited the catalytic promiscuity of a number of 35 carotenoid- modifying enzymes in an E. coli system to extend laboratory-evolved pathways to 3,4,3',4'-tetradehydrolycopene and torulene, generating biosynthetic routes to several carotenoids not identified in nature (118) (Figure 1.6). CrtA, an oxygenase from Rhodobacter capsulatus that normally acts on the methoxy carotenoid spheroidene, was found to insert one keto group into ζ-carotene, neurosporene, and lycopene, and to insert two keto groups into tetradehydrolycopene. Monocyclic torulene, synthesized via the pathway constructed using the laboratory-evolved desaturase and cyclase (181), served as a substrate for CrtO, a β,β-carotene ketolase from Synechocystis sp. strain PCC 6803; CrtU, a β,β-carotene ring desaturase from Brevibacterium linens; and CrtZ, a β,βcarotene hydroxylase from E. herbicola. In addition, 3-hydroxytorulene, the product of the action of CrtZ on torulene, was further metabolized by CrtX, a zeaxanthin glycosylase from E. herbicola, leading to the synthesis of torulene-3-β-D-glucoside (Figure 1.6). In this work, the pathway to torulene generated by directed evolution of two upstream carotenoid biosynthetic enzymes was extended in several different directions by adding genes for further transformations. Owing to their intrinsic localized specificity, coexpression of these downstream modifying enzymes with the foreign torulene pathway resulted in a series of novel torulene derivatives. There are no reports yet of directed evolution of carotenoid oxygenases or postcyclase carotenoid-modifying enzymes. Work by Sun et al. (197), however, provides an interesting example of how modifying the sequence of a carotenoid hydroxylase can alter the enzyme’s product distribution. The β,β-carotene hydroxylase from A. thaliana catalyzes two hydroxylation steps, converting β,β-carotene to zeaxanthin (>90%) in A. 36 thaliana and when expressed in E. coli (Figure 1.9). Noticing that this enzyme had an Nterminal extension of more than 130 amino acids compared with other known β,βcarotene hydroxylases, Sun et al. expressed in E. coli a truncated version of the Arabidopsis hydroxylase lacking the N-terminal 129 amino acids. The truncated enzyme primarily catalyzed only one hydroxylation step, and β-cryptoxanthin (Figure 1.9) accumulated as the main product (>75%) (197). The molecular basis for this altered hydroxylation step number is not known; the authors speculated that truncation yielded an enzyme deficient in the ability to form dimers. Carotenoid cleavage enzymes comprise an important class of carotenoidmodifying enzymes. Enzymatic oxidative cleavage of carotenoids in both carotenogenic and non-carotenogenic organisms creates diverse “apocarotenoid” structures, many of which are highly biologically significant (71). Well-known products of carotenoid cleavage enzymes include retinol and retinoic acids (mammalian hormones) (220), abscisic acid (a plant growth regulator) (186, 236), and the plant pigment bixin (28). The localized specificity of several carotenoid cleavage enzymes has recently been demonstrated. One important cleavage enzyme is β,β-carotene-15,15'-monooxygenase (βCM, formerly named β,β-carotene-15,15'-dioxygenase before the enzyme was shown to employ a monooxygenase mechanism (121)), which converts β,β-carotene into retinal (Figure 1.10a) (158, 165, 219, 231, 232). βCM cleaves substrates other than β,βcarotene, such as α-carotene (228) and β-cryptoxanthin (Figure 1.10a) (123, 228). The enzyme has a strong preference for substrates with at least one unsubstituted β-end (123, 228) and appears to always cleave a substrate’s central 15-15' double bond (115). Recently discovered homologs of βCM catalyze the asymmetric cleavage of carotenoids 37 (28, 98, 186). One murine oxygenase cleaves β,β-carotene at the 9'-10' double bond (Figure 1.10b), yielding β-apo-10'-carotenal (C27) and β-ionone (C13) (98). This enzyme also catalyzes the cleavage of lycopene, resulting in the formation of apolycopenals (Figure 1.10b) (98). Another carotenoid cleavage enzyme from A. thaliana was shown to cleave an impressive array of different substrates in vitro (Figure 1.10c) (185). Thus, carotenoid cleavage enzymes are quite versatile and their localized specificity may be exploited to generate diverse new carotenoid derivatives in the laboratory. Creation of pathways to carotenoids with new carbon scaffolds Given the proven evolvability of different enzymes involved in carotenoid biosynthesis, we investigated the possibility of creating routes to whole new families of carotenoids built on scaffolds other than the symmetric C30 and C40 backbones seen in nature. We reasoned that if carotenoid synthases could be engineered to accept different substrates and synthesize unnatural carotenoid backbones, locally specific downstream enzymes might accept and modify these backbones, leading to whole new families of carotenoids. The downstream enzymes could also be evolved to produce still more novel products or to function more efficiently on their new substrates. Compared to increasing the diversity of known C30 or C40 carotenoids by altering the specificity of downstream pathway enzymes, generating entire new pathway families by focusing on upstream enzymes has a much greater capability to explore new carotenoid structures. The entire space of carotenoids built on non-C30 or non-C40 backbones, for example, is uncharted. Generating novel chain length carotenoids can also be viewed as a rigorous test of carotenoid pathway evolvability. A particularly exciting goal is to generate carotenoids with chromophores or 38 physico-chemical properties not possible in carotenoids based on natural backbones. Millions of years of evolution gave rise to the ~700 carotenoids known in nature. Laboratory evolution of new carotenoid pathways based on unnatural backbones has the potential to at least double or triple this diversity. If significant numbers of new products can be generated, laboratory pathway evolution would be validated as an important tool for preparing large natural product libraries from which compounds with valuable properties and biological activities can be discovered. A C35 carotenoid pathway. We recently discovered that the C30 synthase CrtM could assemble a 35-carbon backbone when supplied with C15PP and C20PP precursors (211). When transformed with crtE from E. uredovora (encoding a C20PP synthase) and crtM from S. aureus, E. coli cells accumulate 4-apophytoene, an asymmetrical C35 carotenoid formed via heterocondensation of C15PP and C20PP (Figure 1.11). This novel backbone comprised 40 to 60% of total carotenoids, with C30 4,4'-diapophytoene and C40 phytoene as minor components. We found that the C35 backbone was further metabolized by various C40- and C30carotenoid biosynthetic enzymes, creating a family of new C35 carotenoids (Figure 1.11). Carotenoid desaturases from C40 (Erwinia CrtI) or C30 (Staphylococcus CrtN) pathways efficiently converted the C35 backbone to yield acyclic carotenoids with different levels of desaturation (211). It is interesting to note that the C30 desaturase CrtN showed a higher step number (four or five steps) in the C35 pathway than in its native C30 pathway (three or four steps) or in a C40 pathway (two or three steps). Thus, E. coli cells expressing CrtN develop an intense red color only when they produce the C35 substrate. The larger number of desaturation steps catalyzed on a C35 substrate may reflect a 39 tradeoff between the enzyme’s substrate preference and the number of desaturation steps the substrate can possibly undergo. CrtN most probably prefers its native C30 substrate, but the C40 substrate can undergo more desaturations. With a C35 substrate, a balance of these two factors can yield the high observed step number if, for example, the enzyme (or enzyme complex) binds the “C30-like” end of the C35 substrate strongly and catalyzes one or more additional desaturation steps on the “C40-like” end compared with a C30 substrate. Other scenarios can also plausibly lead to the same result. Assembling the enzymes for the new backbone (CrtE and CrtM) with wild-type desaturases provided some of the possible C35 desaturation products. The remaining desaturation products were obtained by directed evolution. Random mutagenesis of carotenoid desaturases expressed in E. coli synthesizing the C35 carotenoid backbone generated colonies having a spectrum of colors, which reflected desaturase mutants with altered step numbers (211). In fact, individual clones that produced each of the possible acyclic C35 carotenoids as the main product were identified (Figure 1.11). Addition of the β-cyclase CrtY from E. uredovora or the ε-cyclase Dy4 (L. sativa) further diversified the C35 pathway, yielding at least four new monocyclic C35 carotenoids (Figure 1.11). As discussed in the Introduction, some fungi naturally accumulate carotenoids with 35 carbon atoms (12, 14, 164, 215). All of these are monocyclic oxygenated carotenoids (xanthophylls) and are believed to result from the action of an unidentified oxidative cleavage enzyme on C40 carotenoids such as torulene. Disruption of cyclase activity in Neurospora crassa resulted in the biosynthesis of an acyclic C35 xanthophyll (12). These C35 xanthophylls and the biosynthetic routes leading to their formation are qualitatively different from laboratory-generated C35 carotenoids biosynthesized via 40 heterocondensation of C15PP and C20PP. Notably, the direct route to the C35 carotenoid backbone 4-apophytoene opens many possibilities for further pathway diversification by downstream enzymes (desaturases, cyclases, etc.) whereas many fewer options exist for diversifying the already desaturated, cyclized, and oxygenated C35 carotenoids found in fungi. Because C35 carotenoids have asymmetric backbones, each desaturation step can potentially yield more than one product, depending on the direction of the desaturation step (and the previous steps). Thus, acyclic C35 carotenoids with 3, 5, 7, 9, 11, and 13 conjugated double bonds can assume 1, 2, 3, 3, 2, and 1 (a total of 12) possible structures, respectively. In this sense, the C35 pathway is inherently more complex and explores a much larger “structure space” than do pathways based on the symmetric C30 and C40 carotenoid backbones. Cyclization and other modifications of the backbone can further increase the number of possible C35 carotenoids. Considering their broad substrate tolerances, we expect that other carotenoid-modifying enzymes will also be functional in this C35 pathway and that one could make many hundreds of new carotenoids. The generation of a new, full-fledged C35 carotenoid biosynthetic pathway in the laboratory is a convincing demonstration of the evolvable nature of carotenoid biosynthetic enzymes and pathways and serves as an excellent illustration of how gene assembly coupled with directed evolution can rapidly access diverse chemical structures. Carotenoids with longer backbones. The C25PP isoprenoid precursor farnesylgeranyl diphosphate and the C30PP hexaprenyl diphosphate serve as components of archaebacterial membrane lipids and quinone side chains, respectively. They have never been found to be incorporated into carotenoids. However, these longer analogs of 41 the C40 carotenoid precursor C20PP could in principle be used in the biosynthesis of carotenoid backbones having 45, 50, 55, or 60 carbon atoms. Similarly, the monoterpene precursor geranyl diphosphate (C10PP) could, in theory, be used to construct C20, C25, or asymmetric C30 carotenoids. All these backbone structures would be possible, provided that there were synthases capable of condensing these substrates. Although carotenoid synthases with these activities are not known in nature, we reasoned that an existing synthase could be engineered to make at least some of these new backbones. As discussed above, we had probed carotenoid synthase evolvability by screening for mutants of CrtM that function as a C40 synthase and mutants of CrtB that function as a C30 synthase. CrtM and CrtB diverged long ago and have only 30% amino acid sequence identity. Nonetheless, CrtM was readily converted to a C40 synthase (Chapter 2, (214)). Sequencing confirmed that multiple single-substitution pathways leading to this phenotype were possible (213). We then tested whether one or more of these CrtM mutants might be able to synthesize even larger backbones. To supply a C25PP substrate in E. coli, we constructed and expressed the Y81A variant of the C15PP synthase from B. stearothermophilus (BstFPSY81A). This variant was shown by Ohnuma’s group to produce C25PP as the main product in vitro (150, 151). When coexpressed with BstFPSY81A, the single mutants CrtMF26L and CrtMF26S discovered in our original C40 pathway screening experiment (Chapter 2, (214)) synthesized 16-isopentenylphytoene (the C45 carotenoid backbone, C20+C25) and 16,16'diisopentenylphytoene (the C50 backbone, C25+C25) (Figure 1.12). Site saturation mutagenesis at residues 26, 38, and 180 (also discovered to play a role in conferring C40 function on CrtM (213)) resulted in several double and triple mutants with improved 42 ability to synthesize C45 and C50 carotenoid backbones (212). These carotenoid backbones have never been reported in nature. Interestingly, some of the new CrtM-based C45 and C50 synthases showed almost no activity in the original C30 pathway (212). Thus, carotenoid synthases, although highly substrate-specific in their natural pathways, can both broaden and shift specificity with minimal genetic change. It would be interesting to see whether these variants can be engineered further to become producers of C50 carotenoids exclusively (i.e., no smaller side products) or to generate even larger carotenoids, with 60- or even 70-carbon chains. Although such long structures may not be biologically relevant (and may even be toxic), it might be possible to make them in an engineered pathway in E. coli. When co-transformed with crtI (phytoene desaturase), E. coli harboring the C45 and C50 pathways accumulated several novel desaturated C45 and C50 carotenoids (see Chapter 3). Given the proven evolvability of carotene desaturases and cyclases and the localized specificity of the carotenoid-modifying enzymes further downstream, we envision that it will be possible to generate many new carotenoids based on these backbones. Whereas the fully desaturated, red C40 carotenoid 3,4,3',4'-tetradehydrolycopene has a chromophore consisting of 15 conjugated double bonds, C45 and C50 carotenoid backbones can accommodate 17 and 19 conjugated double bonds, respectively. Extension of a conjugated system increases the wavelength(s) of light absorbed by a molecule and predictably changes the molecule’s color as observed under white light (33). Dodecapreno-β-carotene, a chemically synthesized analog of β,β-carotene with 19 conjugated double bonds, was reported to absorb light at wavelengths longer than 600 nm 43 and to possess bordeaux red to blue-violet pigmentation, depending on the solvent (93). Two of this molecule’s conjugated double bonds are contributed by the two stericallyhindered β-ionone groups. Therefore, just as lycopene with 11 all-trans-conjugated double bonds absorbs longer-wavelength light than β,β-carotene with 9 trans plus 2 beta double bonds, a linear, all-trans carotenoid with 19 conjugated double bonds would absorb even longer-wavelength light and would possess even further blue-shifted pigmentation than dodecapreno-β-carotene. Carotenoids with 19 all-trans double bonds would have possible uses as colorants and might possess interesting or unique antioxidant properties. DISCUSSION AND FUTURE DIRECTIONS Revised view of carotenoid biosynthetic pathways Carotenoid biosynthetic pathways have been described as having a tree-like organization, as depicted in Figure 1.1 (8). The conserved upstream reactions leading to backbone synthesis form the trunk, which supports many branches (and subbranches) representing increasingly diverse and species-specific downstream steps. However, many examples outlined in this chapter have shown that enzymes from one branch can often convert substrates from a different branch. Thus, in light of the ease with which it is now possible to combine carotenoid biosynthetic genes from diverse sources in recombinant organisms, pathway engineers might be better served by replacing the carotenoid “tree” with a more web-like model that emphasizes the interconnectivity of enzymes and metabolites and de-emphasizes the natural circumstances in which they are found. In addition, the tree model, with its conserved trunk and variable branches, implies that the 44 major mode of diversity generation is through the addition of new branches and subbranches. However, we now know that an important source of new carotenoid diversity is the generation of new trunks (new backbones), which can quickly be filled with many branches of their own by using enzymes taken from nature’s extant pathway branches and evolving them in their new pathway context. Future challenge: specific pathways To date, most laboratory-evolved and many engineered pathways accumulate novel carotenoids as components of a complex mixture. This may be fine and sufficient for the discovery of new compounds, but to be practically useful as a synthetic route to a specific compound, for example, the pathway must undergo further engineering to become more specific. Natural carotenoid pathways, which tend to produce only a small number of end products, probably followed a similar course of “pruning” many products down to a chosen few. As laboratory evolution experiments demonstrate, invention is an overnight event, but shaping newly discovered pathways into mature, specific ones can require much subsequent engineering effort. In the laboratory thus far, we have succeeded only in the first step, and real work remains. We list several possible approaches to converting a newborn, nonspecific pathway into one that makes a single novel metabolite. Evolving enzyme specificity. The most straightforward (but maybe the most labor-intensive) way to control pathway specificity is to engineer more specific biosynthetic enzymes. Most laboratory-evolved enzymes, however, show broadened rather than shifted specificity, and therefore the pathways containing them accumulate a combination of old and new products. In contrast, nature often does a perfect job, such 45 that two related enzymes (with a common ancestor but now sitting in different pathways) show no overlap in their substrate or product ranges. We think that pathways specific for newly discovered metabolites can be engineered, possibly after accumulating neutral mutations (in the context of the desired pathway) and certainly by directly screening for mutants that produce less of the old compounds while maintaining (or even improving) their ability to synthesize the new ones. The laboratory-discovered C35, C45, and C50 carotenoid pathways provide sophisticated experimental systems for testing this approach to dealing with what is a central, and challenging, problem in metabolic-pathway engineering. In addition, such experiments may contribute to our understanding of the early evolution of metabolism. The increasingly favored “patchwork” model of pathway evolution states that the specific metabolic pathways we observe today evolved from leaky assemblages of nonspecific enzymes (90, 171, 233) but provides no molecular explanation for how this happened. Experiments aimed at evolving pathway specificity in the laboratory would permit researchers to track the impact of each genetic change as the pathways acquire greater specificity, and they should therefore provide molecular insight into this poorly understood process. Designed channeling. Channeling of intermediates between successive enzymes in a pathway can eliminate undesirable fluxes and byproducts. As mentioned above, there is evidence supporting the existence of carotenoid biosynthetic enzyme complexes, although we do not know what role such complexes might play in pathways assembled in a recombinant organism. Designing enzyme complexes that can channel or shuttle intermediates from one enzyme or catalytic site to the next in a particular sequence may 46 find a use in directing the pathway toward efficient production of desired metabolites. Nature discovered this strategy for other metabolites, giving rise to the marvelous enzymatic assembly lines that synthesize polyketides and non-ribosomal peptides (reviewed in reference (169)). In an effort to engineer substrate channeling between successive enzymes in a biosynthetic pathway, Brodelius et al. fused a C15PP synthase with a sesquiterpene cyclase (34). The resultant fusion enzyme was more efficient at converting isopentenyl diphosphate into the cyclized C15 product than was the corresponding quantity of mixed unfused enzymes (34). Efforts in this direction might better regulate recombinant carotenoid pathways in E. coli, although significant structural information, which is currently unavailable for carotenoid enzymes, may be required. Specificity by flux balance. Even pathways harboring individually promiscuous enzymes can achieve reasonable specificity as a whole if all steps are properly balanced. If the activity or expression level of each enzyme is properly tuned, production of the desired product can be enhanced and the proportion of unwanted side products can be diminished. In addition to modifying the sequences of promoter or ribosomal binding sites, Smolke et al. have shown that the individual expression levels of multiple enzymes can be tuned to some degree by altering the transcriptional order of the genes in an operon and varying the stability of mRNA toward nuclease degradation by using engineered hairpin structures or RNase recognition sites (189). Although adjusting the expression levels of enzymes with broad substrate or product specificity is unlikely to eliminate undesired metabolites outright, it should permit some degree of modulation of the ratio of desired to undesired pathway products. 47 Specificity by diversion of unwanted intermediates. Balancing enzyme activities or expression levels cannot eliminate side products if an enzyme converts a single substrate into multiple products, only one of which is desired. If such enzymes cannot be engineered to narrow their product range, one strategy for achieving pathway specificity is to selectively divert unwanted intermediates away from downstream enzymes in the pathway. Instead, these intermediates could be catabolized or incorporated into products that are easily separated from the desired one(s) by introducing appropriately selective enzymes. In terms of the conversion yield of precursors into products, this approach is more wasteful than is engineering enzymes to be more specific. However, because product recovery costs can vastly exceed fermentation expenses in industrial processes, product purity can be more important than product titer (23). Thus, if a tradeoff is unavoidable, the better choice may be to accept lower product yield in favor of increased purity. Prospects and challenges for diversifying other pathways by laboratory evolution Although the best examples of diversifying metabolic pathways by directed evolution come from work on the carotenoids, this approach can be applied to other natural product pathways as well. There are very good indications that other pathways and biosynthetic enzymes will be as readily evolvable in the laboratory as the carotenoid pathways. Jones and Firn hypothesize that many natural product pathways are in fact already conducting their own combinatorial biosynthesis and high-throughput screening programs, at least on evolutionary timescales (62-64, 91). Because the probability that any particular small molecule will have potent biological activity is inherently low, Jones and Firn argue that organisms increase the odds of discovering new metabolites that 48 provide a selective advantage by exploring a large number of different structures. Thus, the argument continues, natural product pathways have evolved traits that maximize the production and retention of product diversity while minimizing the costs of synthesizing different metabolites, most of which are not beneficial to the producer. Among these traits are branched pathway structures, which enable the discovery of new metabolites as well as the retention of existing ones; matrix pathways or metabolic grids, where a small number of enzymes convert structurally similar precursors to a large number of products by multiple routes; and promiscuous enzymes, which can accept a variety of substrates and convert newly discovered metabolites into additional new products. As we have shown, carotenoid pathways possess these traits as well as others (e.g., individual enzymes are evolvable) that can be exploited for forward evolution. On the other hand, because carotenoids already fulfill important biological roles and no organism is known to synthesize a large number of different carotenoids, it is not apparent that nature is conducting massive searches for new and improved carotenoids. Other natural product pathways, however, do appear to be in “search” mode (for example, the bracken fern makes at least 27 different sesquiterpene indan-1-ones (91)), and these pathways may be even more evolvable than carotenoid pathways. Isoprenoid pathways are an obvious target for laboratory evolution. Many isoprenoid biosynthetic enzymes accept a variety of natural and unnatural substrates (139, 140, 147). (91). The gibberellins, a class of diterpenoid hormones with more than 120 known members, are synthesized by a metabolic grid composed of enzymes with broad substrate tolerance (59, 64). We have shown how the localized specificity of downstream carotenoid biosynthetic enzymes allowed pathway branches leading to whole sets of 49 novel compounds to be opened when the substrate or product preferences of key upstream enzymes were altered. In a similar example demonstrating the localized specificity of other isoprenoid biosynthetic enzymes, a mutated hydroxylase located early in the monoterpene pathway of spearmint resulted in a plant with a completely shifted monoterpene profile resembling that of peppermint (52). Other isoprenoid biosynthetic enzymes have very broad product specificity and synthesize multiple compounds (in one case, more than 50) from a single substrate (25, 47, 51, 60, 190, 229). Pathways harboring such enzymes are therefore highly branched and provide many possible avenues for further product diversification by directed evolution of downstream enzymes. Enzymes with broad specificity, a key feature of evolvable pathways, are found in the biosynthetic pathways of many other natural products, including alkaloids, polyketides, shikimate derivatives, nonribosomal peptides, and volatile esters (3, 26, 36, 169, 184, 188). It is likely that all these pathways will be readily diversified by laboratory evolution. Laboratory evolution will also be useful in constructing hybrid pathways for new natural products. Nature parsimoniously achieves great increases in small-molecule product diversity through the biosynthesis of hybrid natural products. Mycophenolic acid, tocotrienols and tocopherols (vitamin E), cannabinoids, isoprenoid quinones, furanocoumarins, furanoquinolines, alizarin anthraquinones, and certain flavonoids and alkaloids are examples of natural products formed by the fusion of products from two or more distinct biosynthetic pathways (36, 127). Chemical synthesis of unnatural hybrids of natural products has given rise to molecules with potent biological activity, many of which possess combined properties of their individual natural product constituents (reviewed in references (208) and (132)). The number of possible natural product hybrids 50 is astronomical, and, like nonhybrid natural products, most have yet to be made. Accordingly, altering the specificity of enzymes catalyzing the fusion reactions that lead to hybrid products in nature may be a promising way to explore natural product diversity. While laboratory evolution is likely in principle to be effective at exploring natural product diversity in a number of pathways, in practice, some experiments will be far easier than others. Thus, the above discussion is not complete without consideration of the technical issues involved in making and interrogating large libraries of mutant pathways. The first challenge is to create and express libraries of mutant enzymes in the context of a functional pathway. By virtue of their high transformation efficiency, fast growth, and the large number of available tools for genetic manipulation, E. coli cells are attractive for laboratory evolution experiments (and many other metabolic engineering experiments). Also, because E. coli does not synthesize carotenoids on its own, there is no background pool of carotenoids to contend with for laboratory evolution or combinatorial biosynthesis experiments with carotenoid biosynthetic pathways. E. coli, however, is not a universal protein expression machine, nor is it an ideal production host for all compounds. For example, it lacks the ability to glycosylate proteins. In addition, the precursors required for the biosynthesis of certain natural products, including many polyketides and isoprenoids, are present at low levels or not at all in E. coli. The use of engineered strains of E. coli with increased capacity for isoprenoid production (reviewed in reference (17)) and the ability to synthesize complex polyketides (reviewed in reference (161)) will overcome this limitation. Alternatively, libraries can be expressed and even constructed in other organisms such as Saccharomyces cerevisiae, for which a host of laboratory evolution tools exist (1, 2, 37, 38, 45, 46). Recently, an approach to the 51 laboratory evolution of polyketide biosynthesis was demonstrated in which E. coli was used as a host for generating a plasmid library by in vivo recombination. This library was subsequently transformed into a special strain of Streptomyces venezuelae for expression and screening (99). This approach combines the ease of genetic manipulation of E. coli with the ability of Streptomyces to generate bioactive glycosylated polyketides. Many directed enzyme evolution experiments have used an analogous approach in which the mutant library was generated in E. coli, but expressed in another, more suitable host such as Bacillus subtilis (44, 187, 240). This approach is then limited by the efficiency of transformation (often poor, especially for eukaryotic cells) and the ability to make cell lines that stably and reproducibly express the mutant sequences (and their pathway products). Once the library of mutant pathways is constructed and expressed, it must be screened to identify those that produce a new or desired metabolite(s). As is the case for directed protein evolution, this part of the experiment is usually the most challenging and labor-intensive. In the examples discussed in this chapter, it was relatively easy to monitor the characteristic pigmentation of carotenoids (e.g., using simple, color-based visual screening of bacterial colonies on plates). It is possible that color-based screens will similarly prove useful for evolving flavonoid (195) or porphyrin (114) biosynthetic pathways, since these products are also pigmented. Nonetheless, most natural products do not generate fluorescent or UV-visible spectra that are characteristic and distinguishable in the presence of cell debris, and other strategies must be employed for screening. Screening becomes much more challenging when there are no characteristic spectral changes that can be measured in situ, or when the desired products must be isolated and 52 analyzed before they can be identified. (Even among visibly colored families of compounds, new structures are not identifiable by colony color screening unless their pigmentation differs markedly from that of the products of the native pathway. Additionally, cell color reflects the total product mixture, and evolved pathways must therefore generate a significantly different product spectrum from the native pathway in order to be apparent in a simple color-based screen.) Thus, more general methods for rapidly screening microbial clones for the production of a wide range of natural products are desirable. Ideally, the screens would require minimal purification or work-up of cells or lysates, would be highly sensitive and reproducible, and would be amenable to automation. Mass spectrometry (MS) can be used when a target product has a different mass or fragmentation pattern from the product(s) of the wild-type enzyme(s). Using MS, it is possible to screen up to 10,000 samples per day (182), and MS screening has been used to for the directed evolution of enzymes with altered product profiles or enantioselectivity (166, 168). However, due to the large capital investment required (>$1 million), automated, high-throughput MS-based screening equipment is found primarily in well-funded industrial research laboratories. Screening by HPLC or thin-layer chromatography is also feasible but similarly requires sample pretreatment and is only high-throughput with parallel, automated instrumentation. Screening using nuclear magnetic resonance spectroscopy (NMR) has also been demonstrated (167). Up to 1400 samples per day could be analyzed by an NMR spectrometer equipped with a commercially available flow-through NMR probe head. Product concentrations, however, must be quite high for detection by NMR, and pretreatment is required. In some cases, pooling of samples increases the number of clones that can be screened, provided that 53 there is sufficient sensitivity to detect the novel compounds (which are often present at a lower concentration). Screens based on biological properties (e.g., antimicrobial activity or protein binding), widely used in drug discovery (24, 217, 221), could also be adapted to laboratory evolution studies. CONCLUSIONS In its short history, laboratory pathway evolution has produced more than 30 carotenoids that have never been seen in nature. With the ability to make new backbones in E. coli comes the potential to generate whole families of novel carotenoids through the action of wild-type or laboratory-evolved carotenoid-modifying enzymes on the new carbon scaffolds. Applied to other biosynthetic pathways, laboratory pathway evolution could allow researchers to access thousands of molecules that are difficult to produce in practical quantities by synthetic chemistry, are expensive to isolate from natural sources, or have not been found in nature. Seeing is believing. Evolving carotenoid biosynthetic pathways in the laboratory has allowed us to witness first-hand their remarkable evolutionary potential. In the process, we have learned that carotenoid enzymes can acquire new specificities that allow them to accept different substrates, function in a foreign pathway, make a different product from the same substrate, and even give rise to new pathways. Furthermore, all of these changes can be effected in just one round of evolution and are usually brought about by a single amino acid substitution. As evolution proceeds, we will gain further, detailed information on how pathways diverge and, we hope, some elementary understanding of how the stringent specificity of enzymes and pathways we see in nature 54 is achieved at the molecular level. We wonder how far laboratory pathway evolution can be taken. For example, starting with the genes that make up an arbitrary biosynthetic pathway in nature, can we evolve any chemically possible pathway made up of the same basic transformations? We have seen that the carotenoid synthase CrtM can rapidly acquire new specificities, lose much of its original function, and yet quickly recover its original function via different mutational routes. This is an encouraging lesson: evolving an enzyme with narrowed specificity does not “paint it into a corner,” evolutionarily speaking. It seems that one can abolish a particular specificity with ease but cannot abolish an enzyme’s inherent ability to evolve. Thus, the enzymes that exist in 2005 may be perfectly good starting points for creating widely diverse pathways. The dramatic functional changes we see in laboratory pathway evolution experiments remind us that natural product biosynthetic pathways are not merely a snapshot of history to be observed and documented. Rather, these pathways are continually changing entities whose evolutionary dynamics we are just beginning to probe. Laboratory evolution experiments with carotenoid pathways have given us an exciting glance at these dynamics. Future experiments promise both a greater understanding of how metabolic systems evolve and the discovery and optimization of biosynthetic routes to a host of molecules with diverse beneficial impacts on human health and well-being. 55 Figure 1.1 56 Figure 1.1. Natural carotenoid biosynthetic pathways can be organized in a tree-like hierarchy. The biosynthesis of all natural carotenoids begins with the enzymatic assembly of a C30 or C40 backbone. These backbones are desaturated, cyclized, oxidized, and otherwise modified by downstream enzymes in various species-specific combinations. Shown are several common types of enzymatic transformations that occur in natural carotenoid pathways. Common carotenoids formed early in a pathway, such as lycopene, are modified in different organisms depending on the enzymes present. The multiple enzymatic routes originating from intermediates common to many end products result in extensive pathway branching (and sub-branching). 57 Figure 1.2 58 Figure 1.2. Selected examples of gene assembly leading to novel carotenoids in E. coli. Combining enzymes from different source organisms can lead to rare or novel carotenoids. In some cases, such as with CrtC and CrtD (4, 5), new pathway branches can be uncovered by replacing an enzyme with its counterpart from a different organism (192). Carotenoids in boxes had not been previously identified in biological material, or chemically synthesized. Enzyme abbreviations: Al-1, phytoene desaturase from Neurospora crassa (five-step); CrtC, neurosporene 1,2-hydratase; CrtD, 1-OHneurosporene 3,4-desaturase; CrtIEu, phytoene desaturase from Erwinia uredovora (fourstep); CrtIRc, phytoene desaturase from Rhodobacter capsulatus (three-step); CrtW, β,βcarotene 4,(4')-ketolase; CrtX, zeaxanthin glycosylase; CrtY, lycopene β-cyclase; CrtZ, β,β-carotene 3,(3')-hydroxylase. Other enzyme subscripts: Aa, “Agrobacterium aurantiacum” (current designation, Paracoccus sp. strain MBIC1143); Eu, Erwinia uredovora (current approved name, Pantoea ananatis); Rg, Rubrivivax gelatinosus; Rs, Rhodobacter sphaeroides. Natural pathways leading to the synthesis of demethylspheroidene and β,β-carotene are shaded. The dotted arrow represents trace enzymatic conversion, and the crossed-out arrow denotes undetectable enzymatic conversion. References to original publications describing the biosynthesis of various compounds are given in brackets beside compound names. 59 Figure 1.3. “Matrix” pathway resulting from the coexpression of carotenoid biosynthetic enzymes with broad specificity. Coexpression in E. coli of CrtW [β,βcarotene 4,(4')-ketolase] and CrtZ [β,β-carotene 3,(3')-hydroxylase] from “Agrobacterium aurantiacum” (current designation, Paracoccus sp. strain MBIC1143) along with the genes for β,β-carotene synthesis from E. uredovora (current approved name, Pantoea ananatis) resulted in the biosynthesis of at least nine different β,β-carotene derivatives (135). This figure was made using data from reference (135). 60 Figure 1.4 61 Figure 1.4. Chain elongation reactions catalyzed by natural all-E IDSs. Each IDS adds a defined number of IPP molecules to an allylic diphosphate substrate before the final product is released. Wild-type IDSs have quite stringent product specificity; catalytic ranges of known all-E IDSs are shown with arrows on the right. Natural products derived from the various isoprenyl diphosphates are shown on the left. This figure was made using data from reference (225). 62 Figure 1.5 63 Figure 1.5. Product length determination by CrtM and mutants thereof. (a) Reaction mechanism of squalene synthase (left pathway) and CrtM (right pathway). Both enzymes catalyze the head-to-head condensation of two molecules of C15PP to yield linear C30 hydrocarbons. The enzymes employ similar mechanisms involving a common stable intermediate, presqualene diphosphate (PSPP). The mechanisms differ only in the final rearrangement step, which is followed in the case of squalene synthase by reduction of the central double bond. (b) Crystal structure of human squalene synthase (PDB ID: 1EZF). Green residues are involved in the first half-reaction (formation of PSPP), while blue residues form the pocket of the second half-reaction in which PSPP is rearranged. Red residues correspond by sequence alignment to F26 and W38 of CrtM, which were found to control the product size of that enzyme (213, 214). Shown in yellow are the residues that align with mutations in CrtM that improve both its C30 and C40 carotenoid synthase activities. (c) Mutation analysis of F26 and W38 of CrtM. Various site-directed variants of CrtM (indicated by their one-letter amino acid code) were constructed and tested for their synthase activity in both C30 and C40 carotenoid pathways. Variants are arranged from left to right in increasing order with respect to the van der Waals’ volume of the substituted amino acid. The C30 carotenoid synthase activity of each variant was estimated from the level of yellow pigmentation when coexpressed with CrtN. Similarly, the C40 carotenoid synthase function of each variant was evaluated in terms of the level of red pigmentation when coexpressed with CrtE and CrtI. Panels a and b were made using data from reference (212). 64 Figure 1.6 65 Figure 1.6. Extension of laboratory-evolved pathways to 3,4,3',4'- tetradehydrolycopene and torulene by coexpression of downstream carotenoid modifying enzymes (118). Boxed structures had not been previously identified in biological material. Native enzyme reactions are shown with black arrows. Gray arrows depict reactions not seen in natural organisms, and laboratory-evolved enzymes are written in gray lettering. Double arrows indicate enzymatic modification of both ends of a carotenoid substrate. Enzyme abbreviations: CrtA, spheroidene monooxygenase; CrtI, phytoene desaturase from E. uredovora (current approved name, Pantoea ananatis) (four-step), CrtI14, laboratory-evolved mutant of CrtI (four- to six-step) (180); CrtO, β,βcarotene 4,(4')-ketolase; CrtU, β,β-carotene desaturase; CrtX, zeaxanthin glycosylase; CrtY, lycopene β-cyclase; CrtY2, laboratory-evolved mutant of CrtY (180); CrtZ, β,βcarotene 3,(3')-hydroxylase. Biosynthesis of oxygenated derivatives of ζ-carotene and neurosporene was attributed to early termination by CrtA of the desaturation sequence of CrtI, which is normally a four-step desaturase (118). Although CrtA is primarily a ketolase, it is thought to catalyze the introduction of both hydroxy groups of phillipsiaxanthin (C. Schmidt-Dannert, personal communication). This figure was made using data from reference (118). 66 Figure 1.7 67 Figure 1.7. The step number of the C30 desaturase CrtN is readily modified by mutation. A library of mutant crtN alleles was coexpressed with the C30 carotenoid synthase crtM in E. coli. Wild-type CrtN is a three- to four-step desaturase when expressed in E. coli, causing colonies to appear orange (inset). Colonies harboring CrtN mutants with increased step number were deep orange and red (highlighted by arrows), reflecting the longer carotenoid chromophores formed by these mutant desaturases. Colonies harboring mutants with decreased step number appear yellow/lemon, while colonies with non-functional or single-step desaturases are pale since these products are colorless. Shown below are the possible C30 desaturation products and the desaturases that synthesize them. CrtN1-3 are discovered mutants of CrtN with altered desaturation step number. Each colored box depicts the approximate color of the carotenoid in white light. Molecules without colored boxes are colorless. Abbreviations: lacP, lac promoter; wt, wild-type. 68 Figure 1.8 69 Figure 1.8. Cyclization of carotenoids. (a) Mechanism of carotenoid cyclization. Lycopene with its two ψ-end groups is the preferred substrate for all known carotenoid cyclases. All cyclases produce the same carbocationic intermediate on protonation of C-2 of the substrate. Product ring type (β, ε, or γ) is determined by which proton (a, b, or c in the figure) is eliminated in the subsequent rearrangement step. This panel was made using data from reference (32). (b) Substrates accepted by lycopene cyclases. The shaded portion(s) of each structure is cyclized. The first three compounds, with their ψ-end groups, have long been known as natural substrates for lycopene cyclases. The remaining seven structures, including neurosporene with its 7,8-dihydro-ψ-end (left side of molecule) and ζ-carotene with two 7,8-dihydro-ψ-ends, have more recently been shown to be cyclized. 70 Figure 1.9. Alteration of product specificity of the β,β-carotene hydroxylase from Arabidopsis thaliana. The wild-type enzyme catalyzes two hydroxylation steps, converting β,β-carotene to zeaxanthin when expressed in either A. thaliana or E. coli. When the N-terminal 129 amino acids (aa) were removed, the truncated enzyme expressed in E. coli catalyzed only one hydroxylation step, leading primarily to synthesis of β-cryptoxanthin (197). 71 Figure 1.10 72 Figure 1.10. Several carotenoid cleavage enzymes display localized specificity. Gray arrowheads show bonds cleaved. (a) β,β-carotene-15,15'-monooxygenase (βCM) can cleave substrates with an unsubstituted β-end (123, 228). (b) Murine β,β-carotene-9',10'oxygenase (βCO9-10) can also cleave lycopene, leading to uncharacterized apolycopenals (98). (c) One carotenoid cleavage dioxygenase from A. thaliana (AtCCD1) cleaves at least six different carotenoid substrates, leading to a variety of products (185). The downward arrow from C14 dialdehyde indicates that this product was detected from all six substrates shown. 73 Figure 1.11. Generation of a C35 carotenoid pathway by gene assembly and directed enzyme evolution. (211) When supplied with C15PP and C20PP, the C30 carotenoid synthase CrtM produces the C35 carotenoid backbone, 4-apophytoene. By coexpressing C30 or C40 desaturases and mutants thereof (gray), different clones could be found that produce each possible acyclic C35 carotenoid as the main product. E. uredovora (P. ananatis) β-cyclase (CrtY) and L. sativa ε-cyclase (Dy4) were shown to cyclize two of the C35 substrates, leading to four different cyclic C35 carotenoids. All ten C35 carotenoids in this figure had never been previously reported. 74 Figure 1.12. Biosynthesis of C45 and C50 carotenoid backbones. (212) Expression of the Y81A variant of the C15PP synthase from B. stearothermophilus (BstFPSY81A) led to the production of C20PP and C25PP in E. coli. Additional coexpression of variants of the C30 carotenoid synthase CrtM mutated at F26 and/or W38 (CrtMmut) resulted in biosynthesis of the C45 carotenoid backbone 16-isopentenylphytoene (C20+C25) and the C50 backbone 16,16'-diisopentenylphytoene (C25+C25). Both of these larger carotenoid backbones had never been previously reported. These backbones can be further metabolized by the desaturase CrtI, leading to new families of unnatural carotenoid pigments (see Chapter 3). 75 REFERENCES 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. Abecassis, V., D. Pompon, and G. Truan. 2000. High efficiency family shuffling based on multi-step PCR and in vivo DNA recombination in yeast: statistical and functional analysis of a combinatorial library between human cytochrome P450 1A1 and 1A2. Nucleic Acids Res. 28:E88. Abecassis, V., D. Pompon, and G. Truan. 2003. Producing chimeric genes by CLERY: in vitro and in vivo recombination, p. 165-173. In F. H. Arnold and G. Georgiou (ed.), Methods Mol. Biol., vol. 231. Directed Evolution Library Creation Methods and Protocols. Humana Press, Totowa, N.J. Aharoni, A., L. C. Keizer, H. J. Bouwmeester, Z. Sun, M. Alvarez-Huerta, H. A. Verhoeven, J. Blaas, A. M. van Houwelingen, R. C. De Vos, H. van der Voet, R. C. Jansen, M. Guis, J. Mol, R. W. Davis, M. Schena, A. J. van Tunen, and A. P. O'Connell. 2000. Identification of the SAAT gene involved in strawberry flavor biogenesis by use of DNA microarrays. Plant Cell 12:647-62. Albrecht, M., S. Takaichi, N. Misawa, G. Schnurr, P. Böger, and G. Sandmann. 1997. Synthesis of atypical cyclic and acyclic hydroxy carotenoids in Escherichia coli transformants. J. Biotechnol. 58:177-185. Albrecht, M., S. Takaichi, S. Steiger, Z. Y. Wang, and G. Sandmann. 2000. Novel hydroxycarotenoids with improved antioxidative properties produced by gene combination in Escherichia coli. Nat. Biotechnol. 18:843-846. Aragón, C. M., F. J. Murillo, M. D. de la Guardia, and E. Cerdá-Olmedo. 1976. An enzyme complex for the dehydrogenation of phytoene in Phycomyces. Eur. J. Biochem. 63:71-5. Armstrong, G. A. 1999. Carotenoid genetics and biochemistry, p. 321-352. In D. E. Cane (ed.). Isoprenoids including carotenoids and steroids, vol. 2., Elsevier, Amsterdam. Armstrong, G. A., and J. E. Hearst. 1996. Carotenoids 2: Genetics and molecular biology of carotenoid pigment biosynthesis. Faseb J. 10:228-237. Arnold, F. H., and G. Georgiou (ed.). 2003. Methods Mol. Biol., vol. 231. Directed Evolution Library Creation Methods and Protocols. Humana Press, Totowa, N.J. Arnold, F. H., P. C. Wintrode, K. Miyazaki, and A. Gershenson. 2001. How enzymes adapt: Lessons from directed evolution. Trends Biochem. Sci. 26:100106. Arrach, N., R. Fernández-Martin, E. Cerdá-Olmedo, and J. Ávalos. 2001. A single gene for lycopene cyclase, phytoene synthase, and regulation of carotene biosynthesis in Phycomyces. Proc. Natl. Acad. Sci. U.S.A. 98:1687-1692. Arrach, N., T. J. Schmidhauser, and J. Ávalos. 2002. Mutants of the carotene cyclase domain of al-2 from Neurospora crassa. Mol. Genet. Genomics 266:91421. Ausich, R. L. 1994. Production of carotenoids by recombinant-DNA technology. Pure Appl. Chem. 66:1057-1062. Ávalos, J., J. Casadesús, and E. Cerdá-Olmedo. 1985. Gibberella fujikuroi mutants obtained with UV radiation and N-methyl-N'-nitro-N-nitrosoguanidine. Appl. Environ. Microbiol. 49:187-91. 76 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. Ávalos, J., and E. Cerdá-Olmedo. 1987. Carotenoid mutants of Gibberella fujikuroi. Curr. Genet. 11:505-511. Badenhop, F., S. Steiger, M. Sandmann, and G. Sandmann. 2003. Expression and biochemical characterization of the 1-HO-carotenoid methylase CrtF from Rhodobacter capsulatus. FEMS Microbiol. Lett. 222:237-42. Barkovich, R., and J. C. Liao. 2001. Metabolic engineering of isoprenoids. Metab. Eng. 3:27-39. Bejarano, E. R., N. S. Govind, and E. Cerdá-Olmedo. 1987. Zeta-carotene and other carotenes in a Phycomyces mutant. Phytochemistry 26:2251-2254. Bendich, A. 1994. Recent advances in clinical research involving carotenoids. Pure Appl. Chem. 66:1017-1024. Bergquist, P. L., M. D. Gibbs, D. D. Morris, V. S. Te'o, D. J. Saul, and H. W. Moran. 1999. Molecular diversity of thermophilic cellulolytic and hemicellulolytic bacteria. FEMS Microbiol. Ecol. 28:99-110. Bertram, J. S. 1999. Carotenoids and gene regulation. Nutr. Rev. 57:182-191. Blagg, B. S. J., M. B. Jarstfer, D. H. Rogers, and C. D. Poulter. 2002. Recombinant squalene synthase. A mechanism for the rearrangement of presqualene diphosphate to squalene. J. Am. Chem. Soc. 124:8846-8853. Blanch, H. W., and D. S. Clark. 1997. Product Recovery, p. 453-577. Biochemical Engineering. Marcel Dekker, Inc., New York. Bleicher, K. H., H. J. Bohm, K. Muller, and A. I. Alanine. 2003. Hit and lead generation: beyond high-throughput screening. Nat. Rev. Drug Discov. 2:369-78. Bohlmann, J., M. Phillips, V. Ramachandiran, S. Katoh, and R. Croteau. 1999. cDNA cloning, characterization, and functional expression of four new monoterpene synthase members of the Tpsd gene family from grand fir (Abies grandis). Arch. Biochem. Biophys. 368:232-43. Boswell, H. D., B. Drager, W. R. McLauchlan, A. Portsteffen, D. J. Robins, R. J. Robins, and N. J. Walton. 1999. Specificities of the enzymes of Nalkyltropane biosynthesis in Brugmansia and Datura. Phytochemistry 52:871-8. Boucher, Y., and W. F. Doolittle. 2000. The role of lateral gene transfer in the evolution of isoprenoid biosynthesis pathways. Mol. Microbiol. 37:703-716. Bouvier, F., O. Dogbo, and B. Camara. 2003. Biosynthesis of the food and cosmetic plant pigment bixin (annatto). Science 300:2089-2091. Bramley, P. M. 1985. The in vitro biosynthesis of carotenoids. Adv. Lipid Res. 21:243-279. Breinbauer, R., I. R. Vetter, and H. Waldmann. 2002. From protein domains to drug candidates—natural products as guiding principles in the design and synthesis of compound libraries. Angew. Chem. Int. Ed. Engl. 41:2879-90. Breitenbach, J., and G. Sandmann. 2005. Zeta-carotene cis isomers as products and substrates in the plant poly-cis carotenoid biosynthetic pathway to lycopene. Planta 220:785-793. Britton, G. 1998. Overview of carotenoid biosynthesis, p. 13-147. In G. Britton, S. Liaaen-Jensen, and H. Pfander (ed.). Carotenoids, vol. 3: Biosynthesis and Metabolism. Birkhäuser Verlag, Basel. Britton, G. 1995. UV/Visible Spectroscopy, p. 13-62. In G. Britton, S. LiaaenJensen, and H. Pfander (ed.). Carotenoids, vol. 1B: Spectroscopy. Birkhäuser 77 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. Verlag, Basel. Brodelius, M., A. Lundgren, P. Mercke, and P. E. Brodelius. 2002. Fusion of farnesyldiphosphate synthase and epi-aristolochene synthase, a sesquiterpene cyclase involved in capsidiol biosynthesis in Nicotiana tabacum. Eur. J. Biochem. 269:3570-3577. Buckingham, J. 2004. Dictionary of Natural Products. Chapman & Hall/CRC Press. http://www.chemnetbase.com/scripts/dnpweb.exe. Bu'Lock, J. D. 1965. The Biosynthesis of Natural Products. McGraw Hill, London. Bulter, T., and M. Alcalde. 2003. Preparing libraries in Saccharomyces cerevisiae, p. 17-22. In F. H. Arnold and G. Georgiou (ed.), Methods Mol. Biol., vol. 231. Directed Evolution Library Creation Methods and Protocols. Humana Press, Totowa, N.J. Bulter, T., M. Alcalde, V. Sieber, P. Meinhold, C. Schlachtbauer, and F. H. Arnold. 2003. Functional expression of a fungal laccase in Saccharomyces cerevisiae by directed evolution. Appl. Environ. Microbiol. 69:987-95. Cadwell, R. C., and G. F. Joyce. 1994. Mutagenic PCR. PCR Methods Appl. 3:S136-S140. Candau, R., E. R. Bejarano, and E. Cerdá-Olmedo. 1991. In vivo channeling of substrates in an enzyme aggregate for beta-carotene biosynthesis. Proc. Natl. Acad. Sci. U.S.A. 88:4936-40. Cerdá-Olmedo, E. 1985. Carotene mutants of Phycomyces. Methods Enzymol. 110:220-243. Chappell, J. 1995. Biochemistry and molecular biology of the isoprenoid biosynthetic pathway in plants. Annu. Rev. Plant Physiol. Plant Molec. Biol. 46:521-547. Chasan-Taber, L., W. C. Willett, J. M. Seddon, M. J. Stampfer, B. Rosner, G. A. Colditz, F. E. Speizer, and S. E. Hankinson. 1999. A prospective study of carotenoid and vitamin A intakes and risk of cataract extraction in US women. Am. J. Clin. Nutr. 70:509-516. Chen, K., and F. H. Arnold. 1993. Tuning the activity of an enzyme for unusual environments: sequential random mutagenesis of subtilisin E for catalysis in dimethylformamide. Proc. Natl. Acad. Sci. U.S.A. 90:5618-22. Chen, Z., B. S. Katzenellenbogen, J. A. Katzenellenbogen, and H. Zhao. 2004. Directed evolution of human estrogen receptor variants with significantly enhanced androgen specificity and affinity. J. Biol. Chem. (advance electronic publication). Cherry, J. R., M. H. Lamsa, P. Schneider, J. Vind, A. Svendsen, A. Jones, and A. H. Pedersen. 1999. Directed evolution of a fungal peroxidase. Nat. Biotechnol. 17:379-84. Colby, S. M., J. Crock, B. Dowdle-Rizzo, P. G. Lemaux, and R. Croteau. 1998. Germacrene C synthase from Lycopersicon esculentum cv. VFNT cherry tomato: cDNA isolation, characterization, and bacterial expression of the multiple product sesquiterpene cyclase. Proc. Natl. Acad. Sci. U.S.A. 95:2216-21. Collins, A. R. 2001. Carotenoids and genomic stability. Mutat. Res.-Fundam. Mol. Mech. Mutagen. 475:21-28. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63. 64. 65. 78 Cornish, K., and D. J. Siler. 1996. Alternative natural rubber. Chemtech 26:3844. Crameri, A., G. Dawes, E. Rodriguez, Jr., S. Silver, and W. P. Stemmer. 1997. Molecular evolution of an arsenate detoxification pathway by DNA shuffling. Nat. Biotechnol. 15:436-8. Crock, J., M. Wildung, and R. Croteau. 1997. Isolation and bacterial expression of a sesquiterpene synthase cDNA clone from peppermint (Mentha x piperita, L.) that produces the aphid alarm pheromone (E)-beta-farnesene. Proc. Natl. Acad. Sci. U.S.A. 94:12833-12838. Croteau, R., F. Karp, K. C. Wagschal, D. M. Satterwhite, D. C. Hyatt, and C. B. Skotland. 1991. Biochemical characterization of a spearmint mutant that resembles peppermint in monoterpene content. Plant Physiol. 96:744-752. Cunningham, F. X., and E. Gantt. 2001. One ring or two? Determination of ring number in carotenoids by lycopene epsilon-cyclases. Proc. Natl. Acad. Sci. U.S.A. 98:2905-2910. Cunningham, F. X., G. C. T. Jiang, and E. Gantt. 1997. Analysis of structure and function of carotenoid cyclase enzymes. Plant Physiol. 114:926-926. Cunningham, F. X., B. Pogson, Z. R. Sun, K. A. McDonald, D. DellaPenna, and E. Gantt. 1996. Functional analysis of the beta and epsilon lycopene cyclase enzymes of Arabidopsis reveals a mechanism for control of cyclic carotenoid formation. Plant Cell 8:1613-1626. Davies, B. H. 1977. C30 Carotenoids, p. 51-100. In T. W. Goodwin (ed.), vol. 14. Biochemistry of Lipids II. University Park Press, Baltimore. Davisson, V. J., and C. D. Poulter. 1993. Farnesyl-diphosphate synthase— Interplay between substrate topology, stereochemistry, and regiochemistry in electrophilic alkylations. J. Am. Chem. Soc. 115:1245-1260. De la Guardia, M. D., C. M. Aragón, F. J. Murillo, and E. Cerdá-Olmedo. 1971. A carotenogenic enzyme aggregate in Phycomyces: evidence from quantitive complementation. Proc. Natl. Acad. Sci. U.S.A. 68:2012-5. Dewick, P. M. 2002. The biosynthesis of C5-C25 terpenoid compounds. Nat. Prod. Rep. 19:181-222. Facchini, P. J., and J. Chappell. 1992. Gene family for an elicitor-induced sesquiterpene cyclase in tobacco. Proc. Natl. Acad. Sci. U.S.A. 89:11088-92. Fernandez, S. M. S., B. A. Kellogg, and C. D. Poulter. 2000. Farnesyl diphosphate synthase. Altering the catalytic site to select for geranyl diphosphate activity. Biochemistry 39:15316-15321. Firn, R. D., and C. G. Jones. 2000. The evolution of secondary metabolism—a unifying model. Mol. Microbiol. 37:989-994. Firn, R. D., and C. G. Jones. 1996. An explanation of secondary product "redundancy," p. 295-312. In J. T. Romeo, J. A. Saunders, and P. Barbosa (ed.), Recent Advances in Phytochemistry, vol. 30. Phytochemical Diversity and Redundancy in Ecological Interactions. Plenum Press, New York. Firn, R. D., and C. G. Jones. 2003. Natural products—a simple model to explain chemical diversity. Nat. Prod. Rep. 20:382-391. Fraser, P. D., N. Misawa, H. Linden, S. Yamano, K. Kobayashi, and G. Sandmann. 1992. Expression in Escherichia coli, purification, and reactivation 79 66. 67. 68. 69. 70. 71. 72. 73. 74. 75. 76. 77. 78. 79. of the recombinant Erwinia uredovora phytoene desaturase. J. Biol. Chem. 267:19891-19895. Fraser, P. D., M. J. Ruiz-Hidalgo, M. A. Lopez-Matas, M. I. Alvarez, A. P. Eslava, and P. M. Bramley. 1996. Carotenoid biosynthesis in wild type and mutant strains of Mucor circinelloides. Biochim. Biophys. Acta 1289:203-8. Fujisaki, S., H. Hara, Y. Nishimura, K. Horiuchi, and T. Nishino. 1990. Cloning and nucleotide-sequence of the ispA gene responsible for farnesyl diphosphate synthase activity in Escherichia coli. J. Biochem. (Tokyo) 108:9951000. Fujisaki, S., T. Nishino, H. Katsuki, H. Hara, Y. Nishimura, and Y. Hirota. 1989. Isolation and characterization of an Escherichia coli mutant having temperature-sensitive farnesyl diphosphate synthase. J. Bacteriol. 171:5654-5658. Garcia-Asua, G., R. J. Cogdell, and C. N. Hunter. 2002. Functional assembly of the foreign carotenoid lycopene into the photosynthetic apparatus of Rhodobacter sphaeroides, achieved by replacement of the native 3-step phytoene desaturase with its 4-step counterpart from Erwinia herbicola. Mol. Microbiol. 44:233-244. Garcia-Asua, G., H. P. Lang, R. J. Cogdell, and C. N. Hunter. 1998. Carotenoid diversity: a modular role for the phytoene desaturase step. Trends Plant Sci. 3:445-449. Giuliano, G., S. Al-Babili, and J. von Lintig. 2003. Carotenoid oxygenases: cleave it or leave it. Trends Plant Sci. 8:145-9. Giuliano, G., L. Giliberto, and C. Rosati. 2002. Carotenoid isomerase: a tale of light and isomers. Trends Plant Sci. 7:427-9. Goodwin, T. W., and L. A. Griffiths. 1952. Studies in carotenogenesis. V. Carotene production by various mutants of Phycomyces blakesleeanus and by Phycomyces nitens. Biochem. J. 52:499-501. Goto, S., K. Kogure, K. Abe, Y. Kimata, K. Kitahama, E. Yamashita, and H. Terada. 2001. Efficient radical trapping at the surface and inside the phospholipid membrane is responsible for highly potent antiperoxidative activity of the carotenoid astaxanthin. Biochim. Biophys. Acta-Biomembr. 1512:251-258. Guo, R. T., C. J. Kuo, C. C. Chou, T. P. Ko, H. L. Shr, P. H. Liang, and A. H. Wang. 2004. Crystal structure of octaprenyl pyrophosphate synthase from hyperthermophilic Thermotoga maritima and mechanism of product chain length determination. J. Biol. Chem. 279:4903-12. Harker, M., and J. Hirschberg. 1997. Biosynthesis of ketocarotenoids in transgenic cyanobacteria expressing the algal gene for beta-C-4-oxygenase, crtO. FEBS Lett. 404:129-134. Hemmi, H., M. Noike, T. Nakayama, and T. Nishino. 2003. An alternative mechanism of product chain-length determination in type III geranylgeranyl diphosphate synthase. Eur. J. Biochem. 270:2186-94. Hemmi, H., M. Noike, T. Nakayama, and T. Nishino. 2002. Change of product specificity of hexaprenyl diphosphate synthase from Sulfolobus solfataricus by introducing mimetic mutations. Biochem. Biophys. Res. Commun. 297:1096-101. Hirayama, O., K. Nakamura, S. Hamada, and Y. Kobayasi. 1994. Singlet oxygen quenching ability of naturally-occurring carotenoids. Lipids 29:149-150. 80. 81. 82. 83. 84. 85. 86. 87. 88. 89. 90. 91. 92. 93. 94. 80 Hirooka, K., T. Kato, J. Matsu-ura, H. Hemmi, and T. Nishino. 2000. The role of histidine-114 of Sulfolobus acidocaldarius geranylgeranyl diphosphate synthase in chain-length determination. FEBS Lett. 481:68-72. Hirooka, K., S. Ohnuma, A. Koike-Takeshita, T. Koyama, and T. Nishino. 2000. Mechanism of product chain length determination for heptaprenyl diphosphate synthase from Bacillus stearothermophilus. Eur. J. Biochem. 267:4520-4528. Hornero-Méndez, D., and G. Britton. 2002. Involvement of NADPH in the cyclization reaction of carotenoid biosynthesis. FEBS Lett. 515:133-136. Hughes, D. A. 1999. Effects of carotenoids on human immune function. Proc. Nutr. Soc. 58:713-718. Hugueney, P., A. Badillo, H. C. Chen, A. Klein, J. Hirschberg, B. Camara, and M. Kuntz. 1995. Metabolism of cyclic carotenoids—a model for the alteration of this biosynthetic pathway in Capsicum annuum chromoplasts. Plant J. 8:417-424. Hunter, C. N., B. S. Hundle, J. E. Hearst, H. P. Lang, A. T. Gardiner, S. Takaichi, and R. J. Cogdell. 1994. Introduction of new carotenoids into the bacterial photosynthetic apparatus by combining the carotenoid biosynthetic pathways of Erwinia herbicola and Rhodobacter sphaeroides. J. Bacteriol. 176:3692-3697. Isaacson, T., I. Ohad, P. Beyer, and J. Hirschberg. 2004. Analysis in vitro of the enzyme CRTISO establishes a poly-cis-carotenoid biosynthesis pathway in plants. Plant Physiol. 136:4246-4255. Iwata-Reuyl, D., S. K. Math, S. B. Desai, and C. D. Poulter. 2003. Bacterial phytoene synthase: molecular cloning, expression, and characterization of Erwinia herbicola phytoene synthase. Biochemistry 42:3359-65. Jarstfer, M. B., B. S. J. Blagg, D. H. Rogers, and C. D. Poulter. 1996. Biosynthesis of squalene. Evidence for a tertiary cyclopropylcarbinyl cationic intermediate in the rearrangement of presqualene diphosphate to squalene. J. Am. Chem. Soc. 118:13089-13090. Jarstfer, M. B., D. L. Zhang, and C. D. Poulter. 2002. Recombinant squalene synthase. Synthesis of non-head-to-tail isoprenoids in the absence of NADPH. J. Am. Chem. Soc. 124:8834-8845. Jensen, R. A. 1976. Enzyme recruitment in evolution of new function. Annu. Rev. Microbiol. 30:409-25. Jones, C. G., and R. D. Firn. 1991. On the evolution of plant secondary chemical diversity. Philos. Trans. R. Soc. Lond. Ser. B-Biol. Sci. 333:273-280. Kainou, T., K. Okada, K. Suzuki, T. Nakagawa, H. Matsuda, and M. Kawamukai. 2001. Dimer formation of octaprenyl-diphosphate synthase (IspB) is essential for chain length determination of ubiquinone. J. Biol. Chem. 276:7876-83. Karrer, P., and C. H. Eugster. 1951. Carotinoidsynthesen 8. Synthese des dodecapreno-beta-carotins. Helv. Chim. Acta 34:1805-1814. Kato, J. I., S. Fujisaki, K. I. Nakajima, Y. Nishimura, M. Sato, and A. Nakano. 1999. The Escherichia coli homologue of yeast Rer2, a key enzyme of dolichol synthesis, is essential for carrier lipid formation in bacterial cell wall 81 95. 96. 97. 98. 99. 100. 101. 102. 103. 104. 105. 106. 107. 108. 109. synthesis. J. Bacteriol. 181:2733-2738. Kaur, C., and H. C. Kapoor. 2001. Antioxidants in fruits and vegetables—the millennium's health. Int. J. Food Sci. Technol. 36:703-725. Kawasaki, T., Y. Hamano, T. Kuzuyama, N. Itoh, H. Seto, and T. Dairi. 2003. Interconversion of the product specificity of type I eubacterial farnesyl diphosphate synthase and geranylgeranyl diphosphate synthase through one amino acid substitution. J. Biochem. (Tokyo) 133:83-91. Kellogg, B. A., and C. D. Poulter. 1997. Chain elongation in the isoprenoid biosynthetic pathway. Curr. Opin. Chem. Biol. 1:570-578. Kiefer, C., S. Hessel, J. M. Lampert, K. Vogt, M. O. Lederer, D. E. Breithaupt, and J. von Lintig. 2001. Identification and characterization of a mammalian enzyme catalyzing the asymmetric oxidative cleavage of provitamin A. J. Biol. Chem. 276:14110-14116. Kim, B. S., D. H. Sherman, and K. A. Reynolds. 2004. An efficient method for creation and functional analysis of libraries of hybrid type I polyketide synthases. Prot. Eng. Des. Sel. 17:277-284. Kleinig, H., and R. Schmitt. 1982. On the biosynthesis of C30 carotenoic acid glucosyl esters in Pseudomonas rhodos—Analysis of car-mutants. Z. Naturforsch. (C) 37:758-760. Kleinig, H., R. Schmitt, W. Meister, G. Englert, and H. Thommen. 1979. New C30 Carotenoic Acid Glucosyl Esters from Pseudomonas rhodos. Z. Naturforsch. (C) 34:181-185. Kobayashi, M., T. Koyama, K. Ogura, S. Seto, F. J. Ritter, and I. E. M. Bruggemannrotgans. 1980. Bioorganic synthesis and absolute-configuration of faranal. J. Am. Chem. Soc. 102:6602-6604. Kobayashi, M., and Y. Sakamoto. 1999. Singlet oxygen quenching ability of astaxanthin esters from the green alga Haematococcus pluvialis. Biotechnol. Lett. 21:265-269. Kojima, N., W. Sitthithaworn, E. Viroonchatapan, D. Y. Suh, N. Iwanami, T. Hayashi, and U. Sankaw. 2000. Geranylgeranyl diphosphate synthases from Scoparia dulcis and Croton sublyratus. cDNA cloning, functional expression, and conversion to a farnesyl diphosphate synthase. Chem. Pharm. Bull. (Tokyo). 48:1101-3. Komori, M., R. Ghosh, S. Takaichi, Y. Hu, T. Mizoguchi, Y. Koyama, and M. Kuki. 1998. A null lesion in the rhodopin 3,4-desaturase of Rhodospirillum rubrum unmasks a cryptic branch of the carotenoid biosynthetic pathway. Biochemistry 37:8987-8994. Koyama, T., K. Ogura, and S. Seto. 1977. Construction of a chiral center by use of stereospecificity of prenyltransferase. J. Am. Chem. Soc. 99:1999-2000. Koyama, T., A. Saito, K. Ogura, and S. Seto. 1980. Substrate-specificity of farnesylpyrophosphate synthetase. Application to asymmetric synthesis. J. Am. Chem. Soc. 102:3614-3618. Krinsky, N. I. 1994. The Biological properties of carotenoids. Pure Appl. Chem. 66:1003-1010. Krubasik, P., M. Kobayashi, and G. Sandmann. 2001. Expression and functional analysis of a gene cluster involved in the synthesis of decaprenoxanthin 110. 111. 112. 113. 114. 115. 116. 117. 118. 119. 120. 121. 122. 123. 124. 125. 82 reveals the mechanisms for C50 carotenoid formation. Eur. J. Biochem. 268:37023708. Krubasik, P., and G. Sandmann. 2000. A carotenogenic gene cluster from Brevibacterium linens with novel lycopene cyclase genes involved in the synthesis of aromatic carotenoids. Mol. Gen. Genet. 263:423-432. Krubasik, P., and G. Sandmann. 2000. Molecular evolution of lycopene cyclases involved in the formation of carotenoids with ionone end groups. Biochem. Soc. Trans. 28:806-810. Krubasik, P., S. Takaichi, T. Maoka, M. Kobayashi, K. Masamoto, and G. Sandmann. 2001. Detailed biosynthetic pathway to decaprenoxanthin diglucoside in Corynebacterium glutamicum and identification of novel intermediates. Arch. Microbiol. 176:217-23. Kushwaha, S. C., M. Kates, and H. J. Weber. 1980. Exclusive formation of alltrans-phytoene by a colorless mutant of Halobacterium halobium. Can. J. Microbiol. 26:1011-4. Kwon, S. J., A. L. de Boer, R. Petri, and C. Schmidt-Dannert. 2003. Highlevel production of porphyrins in metabolically engineered Escherichia coli: Systematic extension of a pathway assembled from overexpressed genes involved in heme biosynthesis. Appl. Environ. Microbiol. 69:4875-83. Lakshman, M. R. 2004. Alpha and omega of carotenoid cleavage. J. Nutr. 134:241S-245S. Lange, B. M., T. Rujan, W. Martin, and R. Croteau. 2000. Isoprenoid biosynthesis: The evolution of two ancient and distinct pathways across genomes. Proc. Natl. Acad. Sci. U.S.A. 97:13172-13177. Lauro, G. J. 1991. A primer on natural colors. Cereal Foods World 36:949-953. Lee, P. C., A. Z. R. Momen, B. N. Mijts, and C. Schmidt-Dannert. 2003. Biosynthesis of structurally novel carotenoids in Escherichia coli. Chem. Biol. 10:453-462. Lee, P. C., and C. Schmidt-Dannert. 2002. Metabolic engineering towards biotechnological production of carotenoids in microorganisms. Appl. Microbiol. Biotechnol. 60:1-11. Lee, T. C., D. B. Rodriguez, I. Karasawa, T. H. Lee, K. L. Simpson, and C. O. Chichester. 1975. Chemical alteration of carotene biosynthesis in Phycomyces blakesleeanus and mutants. Appl. Microbiol. 30:988-93. Leuenberger, M. G., C. Engeloch-Jarret, and W. D. Woggon. 2001. The reaction mechanism of the enzyme-catalyzed central cleavage of beta-carotene to retinal. Angew. Chem. Int. Ed. Engl. 40:2613-2617. Liang, P. H., T. P. Ko, and A. H. J. Wang. 2002. Structure, mechanism and function of prenyltransferases. Eur. J. Biochem. 269:3339-3354. Lindqvist, A., and S. Andersson. 2002. Biochemical properties of purified recombinant human beta-carotene 15,15'-monooxygenase. J. Biol. Chem. 277:23942-23948. LinGoerke, J. L., D. J. Robbins, and J. D. Burczak. 1997. PCR-based random mutagenesis using manganese and reduced dNTP concentration. Biotechniques 23:409-&. Maki, Y., M. Komabayashi, Y. Gotoh, N. Ohya, H. Hemmi, K. Hirooka, T. 126. 127. 128. 129. 130. 131. 132. 133. 134. 135. 136. 137. 138. 139. 83 Nishino, and T. Koyama. 2002. Dramatic changes in the substrate specificities of prenyltransferase by a single amino acid substitution. J. Mol. Catal. B-Enzym. 19:431-436. Maki, Y., A. Masukawa, H. Ono, T. Endo, T. Koyama, and K. Ogura. 1995. Substrate-specificity of farnesyl diphosphate synthase from Bacillus stearothermophilus. Bioorg. Med. Chem. Lett. 5:1605-1608. Mann, J. 1987. Secondary Metabolism. Clarendon Press, Oxford. Mann, V., M. Harker, I. Pecker, and J. Hirschberg. 2000. Metabolic engineering of astaxanthin production in tobacco flowers. Nat. Biotechnol. 18:888-892. Marshall, J. H., and G. J. Wilmoth. 1981. Pigments of Staphylococcus aureus, a series of triterpenoid carotenoids. J. Bacteriol. 147:900-13. Marshall, J. H., and G. J. Wilmoth. 1981. Proposed pathway of triterpenoid carotenoid biosynthesis in Staphylococcus aureus: evidence from a study of mutants. J. Bacteriol. 147:914-9. Masamoto, K., H. Wada, T. Kaneko, and S. Takaichi. 2001. Identification of a gene required for cis-to-trans carotene isomerization in carotenogenesis of the cyanobacterium Synechocystis sp. PCC 6803. Plant Cell Physiol. 42:1398-402. Mehta, G., and V. Singh. 2002. Hybrid systems through natural product leads: an approach towards new molecular entities. Chem. Soc. Rev. 31:324-334. Misawa, N., S. Kajiwara, K. Kondo, A. Yokoyama, Y. Satomi, T. Saito, W. Miki, and T. Ohtani. 1995. Canthaxanthin biosynthesis by the conversion of methylene to keto groups in a hydrocarbon beta-carotene by a single gene. Biochem. Biophys. Res. Commun. 209:867-876. Misawa, N., M. Nakagawa, K. Kobayashi, S. Yamano, Y. Izawa, K. Nakamura, and K. Harashima. 1990. Elucidation of the Erwinia uredovora carotenoid biosynthetic pathway by functional analysis of gene products expressed in Escherichia coli. J. Bacteriol. 172:6704-6712. Misawa, N., Y. Satomi, K. Kondo, A. Yokoyama, S. Kajiwara, T. Saito, T. Ohtani, and W. Miki. 1995. Structure and functional analysis of a marine bacterial carotenoid biosynthesis gene cluster and astaxanthin biosynthetic pathway proposed at the gene level. J. Bacteriol. 177:6575-6584. Misawa, N., S. Yamano, H. Linden, M. R. Defelipe, M. Lucas, H. Ikenaga, and G. Sandmann. 1993. Functional expression of the Erwinia uredovora carotenoid biosynthesis gene crtl in transgenic plants showing an increase of betacarotene biosynthesis activity and resistance to the bleaching herbicide norflurazon. Plant J. 4:833-840. Montenegro, M. A., M. A. Nazareno, E. N. Durantini, and C. D. Borsarelli. 2002. Singlet molecular oxygen quenching ability of carotenoids in a reversemicelle membrane mimetic system. Photochem. Photobiol. 75:353-361. Murillo, F. J., S. Torres-Martinez, C. M. Aragón, and E. Cerdá-Olmedo. 1981. Substrate transfer in carotene biosynthesis in Phycomyces. Eur. J. Biochem. 119:511-6. Nagaki, M., S. Sato, Y. Maki, T. Nishino, and T. Koyama. 2000. Artificial substrates for undecaprenyl diphosphate synthase from Micrococcus luteus B-P 26. J. Mol. Catal. B-Enzym. 9:33-38. 84 140. Nagaki, M., A. Takaya, Y. Maki, J. Ishibashi, Y. Kato, T. Nishino, and T. Koyama. 2000. One-pot syntheses of the sex pheromone homologs of a codling moth, Laspeyresia promonella L. J. Mol. Catal. B-Enzym. 10:517-522. 141. Narita, K., S. Ohnuma, and T. Nishino. 1999. Protein design of geranyl diphosphate synthase. Structural features that define the product specificities of prenyltransferases. J. Biochem. (Tokyo) 126:566-571. 142. Newman, D. J., G. M. Cragg, and K. M. Snader. 2003. Natural products as sources of new drugs over the period 1981-2002. J. Nat. Prod. 66:1022-1037. 143. Nishino, H. 1997. Cancer prevention by natural carotenoids. J. Cell. Biochem.:86-91. 144. Nishino, H., H. Tokuda, Y. Satomi, M. Masuda, P. Bu, M. Onozuka, S. Yamaguchi, Y. Okuda, J. Takayasu, J. Tsuruta, M. Okuda, E. Ichiishi, M. Murakoshi, T. Kato, N. Misawa, T. Narisawa, N. Takasuka, and M. Yano. 1999. Cancer prevention by carotenoids. Pure Appl. Chem. 71:2273-2278. 145. Ogura, K., and T. Koyama. 1998. Enzymatic aspects of isoprenoid chain elongation. Chem. Rev. 98:1263-1276. 146. Ogura, K., T. Koyama, and H. Sagami. 1997. Polyprenyl diphosphate synthases, p. 57-87. In R. Bittman (ed.). Subcellular Biochemistry 28: Cholesterol: Its function and metabolism in biology and medicine., Plenum Press, New York. 147. Ohnuma, S., H. Hemmi, T. Koyama, K. Ogura, and T. Nishino. 1998. Recognition of allylic substrates in Sulfolobus acidocaldarius geranylgeranyl diphosphate synthase: Analysis using mutated enzymes and artificial allylic substrates. J. Biochem. (Tokyo) 123:1036-1040. 148. Ohnuma, S., K. Hirooka, H. Hemmi, C. Ishida, C. Ohto, and T. Nishino. 1996. Conversion of product specificity of archaebacterial geranylgeranyl-diphosphate synthase—Identification of essential amino acid residues for chain length determination of prenyltransferase reaction. J. Biol. Chem. 271:18831-18837. 149. Ohnuma, S., K. Hirooka, C. Ohto, and T. Nishino. 1997. Conversion from archaeal geranylgeranyl diphosphate synthase to farnesyl diphosphate synthase— Two amino acids before the first aspartate-rich motif solely determine eukaryotic farnesyl diphosphate synthase activity. J. Biol. Chem. 272:5192-5198. 150. Ohnuma, S., K. Hirooka, N. Tsuruoka, M. Yano, C. Ohto, H. Nakane, and T. Nishino. 1998. A pathway where polyprenyl diphosphate elongates in prenyltransferase—Insight into a common mechanism of chain length determination of prenyltransferases. J. Biol. Chem. 273:26705-26713. 151. Ohnuma, S., K. Narita, T. Nakazawa, C. Ishida, Y. Takeuchi, C. Ohto, and T. Nishino. 1996. A role of the amino acid residue located on the fifth position before the first aspartate-rich motif of farnesyl diphosphate synthase on determination of the final product. J. Biol. Chem. 271:30748-30754. 152. Ohnuma, S. I., T. Nakazawa, H. Hemmi, A. M. Hallberg, T. Koyama, K. Ogura, and T. Nishino. 1996. Conversion from farnesyl diphosphate synthase to geranylgeranyl diphosphate synthase by random chemical mutagenesis. J. Biol. Chem. 271:10087-10095. 153. Okada, K., T. Kainou, K. Tanaka, T. Nakagawa, H. Matsuda, and M. Kawamukai. 1998. Molecular cloning and mutational analysis of the ddsA gene encoding decaprenyl diphosphate synthase from Gluconobacter suboxydans. Eur. 85 154. 155. 156. 157. 158. 159. 160. 161. 162. 163. 164. 165. 166. 167. 168. J. Biochem. 255:52-9. Okada, K., M. Minehira, X. F. Zhu, K. Suzuki, T. Nakagawa, H. Matsuda, and M. Kawamukai. 1997. The ispB gene encoding octaprenyl diphosphate synthase is essential for growth of Escherichia coli. J. Bacteriol. 179:3058-3060. Ootaki, T., A. C. Lighty, M. Delbrück, and W. J. Hsu. 1973. Complementation between mutants of Phycomyces deficient with respect to carotenogenesis. Mol. Gen. Genet. 121:57-70. Ortiz de Montellano, P. R., J. S. Wei, W. A. Vinson, R. Castillo, and A. S. Boparai. 1977. Substrate selectivity of squalene synthetase. Biochemistry 16:2680-2685. Ouchane, S., M. Picaud, C. Vernotte, F. ReissHusson, and C. Astier. 1997. Pleiotropic effects of puf interposon mutagenesis on carotenoid biosynthesis in Rubrivivax gelatinosus—A new gene organization in purple bacteria. J. Biol. Chem. 272:1670-1676. Paik, J., A. During, E. H. Harrison, C. L. Mendelsohn, K. Lai, and W. S. Blaner. 2001. Expression and characterization of a murine enzyme able to cleave beta-carotene—The formation of retinoids. J. Biol. Chem. 276:32160-32168. Pandit, J., D. E. Danley, G. K. Schulte, S. Mazzalupo, T. A. Pauly, C. M. Hayward, E. S. Hamanaka, J. F. Thompson, and H. J. Harwood. 2000. Crystal structure of human squalene synthase—A key enzyme in cholesterol biosynthesis. J. Biol. Chem. 275:30610-30617. Perry, K. L., T. A. Simonitch, K. J. Harrisonlavoie, and S. T. Liu. 1986. Cloning and regulation of Erwinia herbicola pigment genes. J. Bacteriol. 168:607-612. Pfeifer, B. A., and C. Khosla. 2001. Biosynthesis of polyketides in heterologous hosts. Microbiol. Mol. Biol. Rev. 65:106-18. Powls, R., and G. Britton. 1977. A series of mutant strains of Scenedesmus obliquus with abnormal carotenoid compositions. Arch. Microbiol. 113:275-80. Raisig, A., and G. Sandmann. 2001. Functional properties of diapophytoene and related desaturases of C30 and C40 carotenoid biosynthetic pathways. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 1533:164-170. Rau, W., and U. Mitzka-Schnabel. 1985. Carotenoid synthesis in Neurospora crassa. Methods Enzymol. 110:253-67. Redmond, T. M., S. Gentleman, T. Duncan, S. Yu, B. Wiggert, E. Gantt, and F. X. Cunningham. 2001. Identification, expression, and substrate specificity of a mammalian beta-carotene 15,15'-dioxygenase. J. Biol. Chem. 276:6560-6565. Reetz, M. T., M. H. Becker, H.-W. Klein, and D. Stöckigt. 1999. A method for high-throughput screening of enantioselective catalysts. Angew. Chem. Int. Ed. Engl. 38:1758-1761. Reetz, M. T., A. Eipper, P. Tielmann, and R. Mynott. 2002. A practical NMRbased high-throughput assay for screening enantioselective catalysts and biocatalysts. Adv. Synth. Catal. 344:1008-1016. Reetz, M. T., C. Torre, A. Eipper, R. Lohmer, M. Hermes, B. Brunner, A. Maichele, M. Bocola, M. Arand, A. Cronin, Y. Genzel, A. Archelas, and R. Furstoss. 2004. Enhancing the enantioselectivity of an epoxide hydrolase by directed evolution. Org. Lett. 6:177-80. 86 169. 170. 171. 172. 173. 174. 175. 176. 177. 178. 179. 180. 181. 182. 183. 184. 185. 186. Reeves, C. D. 2003. The enzymology of combinatorial biosynthesis. Crit. Rev. Biotechnol. 23:95-147. Rice-Evans, C. A., J. Sampson, P. M. Bramley, and D. E. Holloway. 1997. Why do we expect carotenoids to be antioxidants in vivo? Free Radic. Res. 26:381-398. Rison, S. C., and J. M. Thornton. 2002. Pathway evolution, structurally speaking. Curr. Opin. Struct. Biol. 12:374-82. Rouhi, A. M. 2003. Rediscovering Natural Products. Chem. Eng. News 81(41):77-91. Sager, R., and M. Zalokar. 1958. Pigments and photosynthesis in a carotenoiddeficient mutant of Chlamydomonas. Nature 182:98-100. Sandmann, G. 1994. Carotenoid biosynthesis in microorganisms and plants. Eur. J. Biochem. 223:7-24. Sandmann, G. 2002. Combinatorial biosynthesis of carotenoids in a heterologous host: A powerful approach for the biosynthesis of novel structures. ChemBioChem 3:629-635. Sandmann, G. 2002. Molecular evolution of carotenoid biosynthesis from bacteria to plants. Physiol. Plantarum 116:431-440. Sandmann, G., M. Albrecht, G. Schnurr, O. Knorzer, and P. Boger. 1999. The biotechnological potential and design of novel carotenoids by gene combination in Escherichia coli. Trends Biotechnol. 17:233-237. Saperstein, S., and M. P. Starr. 1954. The ketonic carotenoid canthaxanthin isolated from a colour mutant of Corynebacterium michiganense. Biochem. J. 57:273-5. Satomi, Y., T. Yoshida, K. Aoki, N. Misawa, M. Masuda, M. Murakoshi, N. Takasuka, T. Sugimura, and H. Nishino. 1995. Production of phytoene, an oxidative stress protective carotenoid, in mammalian cells by introduction of phytoene synthase gene crtB isolated from a bacterium Erwinia uredovora. Proc. Jpn. Acad. Ser. B-Phys. Biol. Sci. 71:236-240. Schmidt-Dannert, C. 2000. Engineering novel carotenoids in microorganisms. Curr. Opin. Biotechnol. 11:255-261. Schmidt-Dannert, C., D. Umeno, and F. H. Arnold. 2000. Molecular breeding of carotenoid biosynthetic pathways. Nat. Biotechnol. 18:750-753. Schrader, W., A. Eipper, D. J. Pugh, and M. T. Reetz. 2002. Second-generation MS-based high-throughput screening system for enantioselective catalysts and biocatalysts. Can. J. Chem. 80:626-632. Schroeder, W. A., and E. A. Johnson. 1995. Carotenoids protect Phaffia rhodozyma against singlet oxygen damage. J. Ind. Microbiol. 14:502-507. Schwab, W. 2003. Metabolome diversity: too few genes, too many metabolites? Phytochemistry 62:837-49. Schwartz, S. H., X. Qin, and J. A. Zeevaart. 2001. Characterization of a novel carotenoid cleavage dioxygenase from plants. Journal of Biological Chemisry 276:25208-11. Schwartz, S. H., B. C. Tan, D. A. Gage, J. A. D. Zeevaart, and D. R. McCarty. 1997. Specific oxidative cleavage of carotenoids by VP14 of maize. Science 276:1872-1874. 87 187. 188. 189. 190. 191. 192. 193. 194. 195. 196. 197. 198. 199. 200. Shafikhani, S., R. A. Siegel, E. Ferrari, and V. Schellenberger. 1997. Generation of large libraries of random mutants in Bacillus subtilis by PCR-based plasmid multimerization. Biotechniques 23:304-10. Shalit, M., I. Guterman, H. Volpin, E. Bar, T. Tamari, N. Menda, Z. Adam, D. Zamir, A. Vainstein, D. Weiss, E. Pichersky, and E. Lewinsohn. 2003. Volatile ester formation in roses. Identification of an acetyl-coenzyme A. Geraniol/Citronellol acetyltransferase in developing rose petals. Plant Physiol. 131:1868-76. Smolke, C. D., V. J. J. Martin, and J. D. Keasling. 2001. Controlling the metabolic flux through the carotenoid pathway using directed mRNA processing and stabilization. Metab. Eng. 3:313-321. Steele, C. L., J. Crock, J. Bohlmann, and R. Croteau. 1998. Sesquiterpene synthases from grand fir (Abies grandis)—Comparison of constitutive and wound-induced activities, and cDNA isolation, characterization and bacterial expression of delta-selinene synthase and gamma-humulene synthase. J. Biol. Chem. 273:2078-2089. Steiger, S., A. Mazet, and G. Sandmann. 2003. Heterologous expression, purification, and enzymatic characterization of the acyclic carotenoid 1,2hydratase from Rubrivivax gelatinosus. Arch. Biochem. Biophys. 414:51-8. Steiger, S., S. Takaichi, and G. Sandmann. 2002. Heterologous production of two unusual acyclic carotenoids, 1,1'-dihydroxy-3,4-didehydrolycopene and 1hydroxy-3,4,3',4'-tetradehydrolycopene by combination of the crtC and crtD genes from Rhodobacter and Rubrivivax. J. Biotechnol. 97:51-8. Stemmer, W. P. 1994. Rapid evolution of a protein in-vitro by DNA shuffling. Nature 370:389-391. Stickforth, P., S. Steiger, W. R. Hess, and G. Sandmann. 2003. A novel type of lycopene epsilon-cyclase in the marine cyanobacterium Prochlorococcus marinus MED4. Arch. Microbiol. 179:409-415. Su, V., and B. D. Hsu. 2003. Cloning and expression of a putative cytochrome P450 gene that influences the colour of Phalaenopsis flowers. Biotechnol. Lett. 25:1933-9. Subden, R. E., and S. F. Threlkeld. 1968. Genetic and complementation studies of a new carotenoid mutant of Neurospora crassa. Can. J. Genet. Cytol. 10:351-6. Sun, Z. R., E. Gantt, and F. X. Cunningham. 1996. Cloning and functional analysis of the beta-carotene hydroxylase of Arabidopsis thaliana. J. Biol. Chem. 271:24349-24352. Takaichi, S., K. Inoue, M. Akaike, M. Kobayashi, H. Ohoka, and M. T. Madigan. 1997. The major carotenoid in all known species of heliobacteria is the C30 carotenoid 4,4'-diaponeurosporene, not neurosporene. Arch. Microbiol. 168:277-281. Takaichi, S., G. Sandmann, G. Schnurr, Y. Satomi, A. Suzuki, and N. Misawa. 1996. The carotenoid 7,8-dihydro-psi end group can be cyclized by the lycopene cyclases from the bacterium Erwinia uredovora and the higher plant Capsicum annuum. Eur. J. Biochem. 241:291-296. Takaichi, S., and K. Shimada. 1999. Pigment composition of two pigmentprotein complexes derived from anaerobically and semi-aerobically grown 88 201. 202. 203. 204. 205. 206. 207. 208. 209. 210. 211. 212. 213. 214. 215. 216. 217. Rubrivivax gelatinosus, and identification of a new keto-carotenoid, 2ketospirilloxanthin. Plant Cell Physiol. 40:613-617. Takaichi, S., Y. Tamura, T. Miyamoto, K. Azegami, Y. Yamamoto, and J. Ishidsu. 1999. Carotenogenesis pathway of novel carotenoid glucoside mycolic acid esters in Rhodococcus rhodochrous using carotenogenesis mutants and inhibitors. Biosci. Biotechnol. Biochem. 63:2014-2016. Takatsuji, H., T. Nishino, K. Izui, and H. Katsuki. 1982. Formation of dehydrosqualene catalyzed by squalene synthetase in Saccharomyces cerevisiae. J. Biochem. (Tokyo) 91:911-921. Tarshis, L. C., P. J. Proteau, B. A. Kellogg, J. C. Sacchettini, and C. D. Poulter. 1996. Regulation of product chain length by isoprenyl diphosphate synthases. Proc. Natl. Acad. Sci. U.S.A. 93:15018-15023. Tarshis, L. C., M. J. Yan, C. D. Poulter, and J. C. Sacchettini. 1994. Crystal structure of recombinant farnesyl diphosphate synthase at 2.6-angstrom resolution. Biochemistry 33:10871-10877. Taylor, R. F. 1984. Bacterial triterpenoids. Microbiol. Rev. 48:181-198. Taylor, R. F., and B. H. Davies. 1976. Triterpenoid carotenoids and related lipids—Triterpenoid carotenoid aldehydes from Streptococcus faecium Unh 564p. Biochem. J. 153:233-239. Teramoto, M., S. Takaichi, Y. Inomata, H. Ikenaga, and N. Misawa. 2003. Structural and functional analysis of a lycopene beta-monocyclase gene isolated from a unique marine bacterium that produces myxol. FEBS Lett. 545:120-126. Tietze, L. F., H. P. Bell, and S. Chandrasekhar. 2003. Natural product hybrids as new leads for drug discovery. Angew. Chem. Int. Ed. Engl. 42:3996-4028. Timberlake, C. F., and B. S. Henry. 1986. Plant pigments as natural food colors. Endeavour 10:31-36. Tuveson, R. W., R. A. Larson, and J. Kagan. 1988. Role of cloned carotenoid genes expressed in Escherichia coli in protecting against inactivation by near-UV light and specific phototoxic molecules. J. Bacteriol. 170:4675-4680. Umeno, D., and F. H. Arnold. 2003. A C35 carotenoid biosynthetic pathway. Appl. Environ. Microbiol. 69:3573-3579. Umeno, D., and F. H. Arnold. 2004. Evolution of a pathway to novel long-chain carotenoids. J. Bacteriol. 186:1531-1536. Umeno, D., K. Hiraga, and F. H. Arnold. 2003. Method to protect a targeted amino acid residue during random mutagenesis. Nucleic Acids Res. 31:e91. Umeno, D., A. V. Tobias, and F. H. Arnold. 2002. Evolution of the C30 carotenoid synthase CrtM for function in a C40 pathway. J. Bacteriol. 184:66906699. Valadon, L. R. G., and R. S. Mummery. 1977. Natural beta-apo-4'-carotenoic acid methyl ester in the fungus Verticillium agaricinum. Phytochemistry 16:613614. Van Dien, S. J., C. J. Marx, B. N. O'Brien, and M. E. Lidstrom. 2003. Genetic characterization of the carotenoid biosynthetic pathway in Methylobacterium extorquens AM1 and isolation of a colorless mutant. Appl. Environ. Microbiol. 69:7563-6. Vesterlund, S., J. Paltta, A. Laukova, M. Karp, and A. C. Ouwehand. 2004. 89 218. 219. 220. 221. 222. 223. 224. 225. 226. 227. 228. 229. 230. 231. 232. Rapid screening method for the detection of antimicrobial substances. J. Microbiol. Methods 57:23-31. Viljanen, K., S. Sundberg, T. Ohshima, and M. Heinonen. 2002. Carotenoids as antioxidants to prevent photooxidation. Eur. J. Lipid Sci. Technol. 104:353-359. von Lintig, J., and K. Vogt. 2000. Filling the gap in vitamin A research— Molecular identification of an enzyme cleaving beta-carotene to retinal. J. Biol. Chem. 275:11915-11920. von Lintig, J., and A. Wyss. 2001. Molecular analysis of vitamin a formation: Cloning and characterization of beta-carotene 15,15'-dioxygenases. Arch. Biochem. Biophys. 385:47-52. Walters, W. P., and M. Namchuk. 2003. Designing screens: how to make your hits a hit. Nat. Rev. Drug Discov. 2:259-266. Wang, C. W., and J. C. Liao. 2001. Alteration of product specificity of Rhodobacter sphaeroides phytoene desaturase by directed evolution. J. Biol. Chem. 276:41161-41164. Wang, C. W., M. K. Oh, and J. C. Liao. 2000. Directed evolution of metabolically engineered Escherichia coli for carotenoid production. Biotechnol. Prog. 16:922-926. Wang, C. W., M. K. Oh, and J. C. Liao. 1999. Engineered isoprenoid pathway enhances astaxanthin production in Escherichia coli. Biotechnol. Bioeng. 62:235241. Wang, K., and S. Ohnuma. 1999. Chain-length determination mechanism of isoprenyl diphosphate synthases and implications for molecular evolution. Trends Biochem. Sci. 24:445-451. Wieland, B., C. Feil, E. Gloriamaercker, G. Thumm, M. Lechner, J. M. Bravo, K. Poralla, and F. Gotz. 1994. Genetic and biochemical analyses of the biosynthesis of the yellow carotenoid 4,4'-diaponeurosporene of Staphylococcus aureus. J. Bacteriol. 176:7719-7726. Windhovel, U., B. Geiges, G. Sandmann, and P. Boger. 1994. Expression of Erwinia uredovora phytoene desaturase in Synechococcus Pcc7942 leading to resistance against a bleaching herbicide. Plant Physiol. 104:119-125. Wirtz, G. M., C. Bornemann, A. Giger, R. K. Muller, H. Schneider, G. Schlotterbeck, G. Schiefer, and W. D. Woggon. 2001. The substrate specificity of beta,beta-carotene 15,15'-monooxygenase. Helv. Chim. Acta 84:2301-2315. Wise, M. L., T. J. Savage, E. Katahira, and R. Croteau. 1998. Monoterpene synthases from common sage (Salvia officinalis). cDNA isolation, characterization, and functional expression of (+)-sabinene synthase, 1,8-cineole synthase, and (+)-bornyl diphosphate synthase. J. Biol. Chem. 273:14891-9. Woodall, A. A., S. W. M. Lee, R. J. Weesie, M. J. Jackson, and G. Britton. 1997. Oxidation of carotenoids by free radicals: relationship between structure and reactivity. Biochim. Biophys. Acta-Gen. Subj. 1336:33-42. Wyss, A., G. Wirtz, W. D. Woggon, R. Brugger, M. Wyss, A. Friedlein, H. Bachmann, and W. Hunziker. 2000. Cloning and expression of beta,betacarotene 15,15'-dioxygenase. Biochem. Biophys. Res. Commun. 271:334-336. Yan, W. M., G. F. Jang, F. Haeseleer, N. Esumi, J. H. Chang, M. Kerrigan, M. Campochiaro, P. Campochiaro, K. Palczewski, and D. J. Zack. 2001. Cloning 90 233. 234. 235. 236. 237. 238. 239. 240. and characterization of a human beta,beta-carotene-15,15'-dioxygenase that is highly expressed in the retinal pigment epithelium. Genomics 72:193-202. Ycas, M. 1974. On earlier states of the biochemical system. J. Theor. Biol. 44:145-60. Ye, X. D., S. Al-Babili, A. Kloti, J. Zhang, P. Lucca, P. Beyer, and I. Potrykus. 2000. Engineering the provitamin A (beta-carotene) biosynthetic pathway into (carotenoid-free) rice endosperm. Science 287:303-305. Yokoyama, A., Y. Shizuri, and N. Misawa. 1998. Production of new carotenoids, astaxanthin glucosides, by Escherichia coli transformants carrying carotenoid biosynthetic genes. Tetrahedron Lett. 39:3709-3712. Zeevaart, J. A. D., and R. A. Creelman. 1988. Metabolism and physiology of abscisic acid. Annu. Rev. Plant Physiol. Plant Molec. Biol. 39:439-473. Zhang, D. L., and C. D. Poulter. 1995. Biosynthesis of non-head-to-tail isoprenoids—Synthesis of 1'-1-structures and 1'-3-structures by recombinant yeast squalene synthase. J. Am. Chem. Soc. 117:1641-1642. Zhang, Y. W., X. Y. Li, and T. Koyama. 2000. Chain length determination of prenyltransferases: Both heteromeric subunits of medium-chain (E)-prenyl diphosphate synthase are involved in the product chain length determination. Biochemistry 39:12717-12722. Zhang, Y. W., X. Y. Li, H. Sugawara, and T. Koyama. 1999. Site-directed mutagenesis of the conserved residues in component I of Bacillus subtilis heptaprenyl diphosphate synthase. Biochemistry 38:14638-14643. Zhao, H., and F. H. Arnold. 1999. Directed evolution converts subtilisin E into a functional equivalent of thermitase. Protein Eng. 12:47-53. 91 CHAPTER 2 Evolution of the C30 Carotenoid Synthase CrtM for Function in a C40 Pathway Material from this chapter appears in Evolution of the C30 Carotenoid Synthase CrtM for Function in a C40 Pathway, Daisuke Umeno, Alexander V. Tobias, and Frances H. Arnold, Journal of Bacteriology 184(23): 6690-6699 (2002) and is reprinted with permission from the American Society for Microbiology. 92 SUMMARY The C30 carotene synthase CrtM from Staphylococcus aureus and the C40 carotene synthase CrtB from Erwinia uredovora were swapped into their respective foreign C40 and C30 biosynthetic pathways (heterologously expressed in Escherichia coli) and evaluated for function. Each displayed negligible ability to synthesize the natural carotenoid product of the other. After one round of mutagenesis and screening, we isolated 116 variants of CrtM able to synthesize C40 carotenoids. In contrast, we failed to find a single variant of CrtB with detectable C30 activity. Subsequent analysis revealed that the best CrtM mutants performed comparably to CrtB in an in vivo C40 pathway and that Phe 26 of CrtM is a key specificity-determining residue. The CrtM mutants showed significant variation in performance in their original C30 pathway, indicating the emergence of enzymes with broadened substrate specificity as well as those with shifted specificity. We also report for the first time the isolation of carotenoid pigments based on a C35 carbon backbone formed by condensation of farnesyl diphosphate (FPP) and geranylgeranyl dipohosphate (GGPP) by wild-type and variants of CrtM. The expanded substrate and product range of the CrtM mutants reported herein highlights the potential for creating further new carotenoid backbone structures. 93 INTRODUCTION A common feature of small molecule natural product biosynthetic pathways is the extensive use of enzymes with broad substrate and product specificities. Many isoprenoid biosynthetic enzymes, for example, accept a variety of both natural and unnatural substrates (27, 28, 31). Some have been shown to synthesize an impressively large number of compounds (sometimes >50) from a single substrate (9, 12, 45). Natural product biosynthetic pathways also use enzymes with remarkably stringent specificity. Such enzymes are frequently seen in key determinant positions, usually in the very early steps of a pathway, while promiscuous enzymes tend to be located further downstream. Thus, many natural product pathways have a “reverse tree” topology (3, 42) where the backbone structures of metabolites are dictated by a small number of stringent, upstream enzymes. When the substrate or product preferences of these key upstream enzymes are altered, pathway branches leading to sets of novel compounds may be opened (10). Our interest is to achieve the same by applying methods of directed enzyme evolution to recombinant pathways in Escherichia coli (43, 50). Among the most widespread of all small molecule natural products, carotenoids are natural pigments that play important biological roles. Some are accessory lightharvesting components of photosynthetic systems, while others are photo-protecting antioxidants or regulators of membrane fluidity. Recent studies advocate their effectiveness in preventing cancer and heart disease (26) as well as their potential hormonal activity (4, 18). Such diverse molecular functions justify exploring rare or novel carotenoid structures. At present, ~700 carotenoids from the naturally occurring C30 and C40 carotenoid biosynthetic pathways have been characterized (17). Most natural 94 carotenoid diversity arises from differences in types and levels of desaturation and other modifications of the C40 backbone. C40 carotenoids are also much more widespread in nature than their C30 counterparts. The former are synthesized by thousands of plant and microbial species, whereas the latter are known only in a select few bacteria (46, 48). Homocarotenoids (carotenoids with >40 carbon atoms) and apocarotenoids (carotenoids with <40 carbon atoms), which result from the action of downstream enzymes on a C40 substrate, are also known. Although these structures do not have 40 carbon atoms, they are nonetheless derived from C40 carotenoid precursors (5). The first committed step in carotenoid biosynthesis is the head-to-head condensation of two prenyl diphosphates catalyzed by a synthase enzyme (Figure 2.1). The C40 carotenoid phytoene is synthesized by the condensation of two molecules of geranylgeranyl diphosphate (GGPP, C20PP) catalyzed by the synthase CrtB. (Most phytoene synthases produce the 15Z isomer of phytoene (5)). C30 carotenoids are synthesized via an independent route whereby two molecules of farnesyl diphosphate (FPP, C15PP) are condensed to (15Z)-4,4'-diapophytoene by CrtM (48). The various downstream modification enzymes possess broad substrate specificity and therefore represent potential targets for generating biosynthetic routes to novel carotenoids. For example, when the three-step phytoene desaturase CrtI from Rhodobacter sphaeroides was replaced with a four-step enzyme from Erwinia herbicola, the cells accumulated a series of carotenoids produced neither by Erwinia nor Rhodobacter (16). Carotene desaturases (39), carotene cyclases (44), and β,β-carotene cleavage enzyme (40) have also been shown to accept a broad range of substrates. Combinatorial expression of such enzymes can create unusual and sometimes previously unidentified carotenoids (1, 2, 21). 95 Nevertheless, the greatest potential to further extend carotenoid biosynthetic diversity lies in creating whole new backbone structures, and therefore with engineering the carotene synthases. The C30 and C40 pathways are very similar except in the sizes of their precursor molecules and their distributions in nature, and it is clear that they diverged from a common ancestral pathway. We would like to determine the minimal genetic change required in key carotenoid biosynthetic enzymes to create such new pathway branches. Can the enzymes that synthesize one carotenoid be modified in a laboratory evolution experiment to synthesize others? How much of carotenoid diversity can be accessed in this way? And, can novel pathways to different, even unnatural structures (e.g., C35, C45, C50, or larger carotenoids) be accessed by using C30 or C40 enzymes as a starting point? To begin to answer these questions, we studied the performance of the C30 carotene synthase CrtM from Staphylococcus aureus in a C40 pathway and the C40 carotene synthase CrtB from Erwinia uredovora in a C30 pathway. We then examined the ability of these enzymes to adapt to their respective “foreign” pathways in order to assess the ease and uncover the mechanisms by which this might be accomplished. RESULTS AND DISCUSSION Constructing pathways for C30 and C40 carotenoids To establish a recombinant C40 pathway in E. coli, we subcloned crtE encoding GGPP (C20PP) synthase, crtB encoding phytoene synthase, and crtI encoding phytoene desaturase, all from E. uredovora, into a vector derived from pUC18, resulting in plasmid pUC-crtE-crtB-crtI (Figure 2.2a). For C30 carotenoid production, plasmid pUC-fps-crtM- 96 crtN was constructed by integrating the E. coli farnesyl diphosphate (C15PP) synthase (FPS) gene, fps, with crtM (4,4'-diapophytoene synthase gene) and crtN (4,4'diapophytoene desaturase gene) from S. aureus into the same vector. Plasmid pUC-crtMcrtN was constructed in an identical fashion, but it lacks fps. Each plasmid shares the cloning sites for the corresponding enzyme genes: EcoRI and XbaI sites flank isoprenyl diphosphate synthase (IDS) genes (crtE and fps), XbaI and XhoI sites flank carotene synthase genes (crtB and crtM), and XhoI and ApaI sites flank carotene desaturase genes (crtI and crtN) (Figure 2.2a). With this arrangement, corresponding genes could be easily swapped in order to evaluate their function in the other pathway. E. coli cells harboring pUC-crtE-crtB-crtI plasmids (C40 pathway) developed a characteristic red-pink color, whereas cells possessing pUC-fps-crtM-crtN and pUCcrtM-crtN plasmids (C30 pathway) were yellow (Figure 2.2b). HPLC analysis of extracted pigments showed that XL1-Blue(pUC-crtE-crtB-crtI) cells produce mostly lycopene (four-step desaturation) along with a small amount (5 to 10% of total pigment) of 3,4,3',4'-tetradehydrolycopene (six-step desaturation) under the conditions described. Although CrtI is classified as a four-step desaturase, production of 3,4- didehydrolycopene (five-step desaturation) by CrtI both in vivo and in vitro has been reported (15, 23). Several groups have expressed CrtM and CrtN from S. aureus in E. coli and observed almost exclusive production of 4,4'-diaponeurosporene (39, 51). However, in our XL1-Blue(pUC-crtM-crtN) expression system, the cells accumulated a significant amount of 4,4'-diapolycopene (~30% of total carotenoids). When a constitutive lac promoter (lacking the operator) was used for operon expression, the amount of 4,4'- 97 diapolycopene increased further and reached 50% of carotenoids produced (D. Umeno, unpublished data). This phenomenon was observed in all E. coli strains we tested, BL21, BL21(DE3), JM109, JM101, DH5α, HB101, SCS110, and XL10-Gold, and was insensitive to growth temperature and plasmid copy number. Thus, it is clear that the apparent desaturation step number of CrtN depends on its expression level and the effective concentration of substrates. In E. coli, FPP (C15PP) is a precursor to a variety of important housekeeping molecules such as respiratory quinones, prenylated tRNA, and dolichol. Concerned about retarding or preventing the growth of our recombinant C30 cultures due to depletion of FPP, we first expressed the fps gene along with crtM and crtN. However, we observed no difference in growth rate, pigmentation level, or carotenoid composition between XL1Blue cells harboring the pUC-crtM-crtN plasmid and those harboring the pUC-fps-crtMcrtN plasmid. This demonstrates that endogenous FPP levels in E. coli suffice to support both growth and synthesis of C30 carotenoids. Functional analysis of CrtM and CrtB swapped into their respective foreign pathways To assess the function of wild-type CrtM in a C40 pathway, pUC-crtE-crtM-crtI was constructed and transformed into E. coli XL1-Blue. Under these circumstances, CrtM is supplied with GGPP (C20PP) produced by CrtE. If CrtM were able to synthesize the C40 carotenoid phytoene from GGPP, subsequent desaturation by CrtI to lycopene would cause the cells to develop a red-pink color. However, while cells expressing the crtE-crtB-crtI operon exhibited the characteristic red-pink of lycopene (Figure 2.2b) and synthesized this carotenoid in liquid culture (Figure 2.4), cells expressing the crtE-crtM- 98 crtI operon had only very subtle pink-orange color on agar plates and synthesized much less lycopene in liquid culture (Figure 2.4). As did Raisig and Sandmann (39), we thus conclude that CrtM fails to complement CrtB in a C40 pathway and has very poor ability compared to CrtB to synthesize the C40 carotenoid backbone. This observation cannot be explained by simple competition between FPP and GGPP for access to CrtM (coupled with poor ability of CrtI to desaturate the C30 product) because XL1-Blue cells expressing the crtE-crtM-crtN operon showed only very minor yellow color development. This indicates that the availability of FPP for carotenoid biosynthesis is significantly reduced upon expression of CrtE. The function of CrtB in a C30 pathway was examined by analyzing the pigmentation of XL1-Blue cells transformed with pUC-crtB-crtN. In this case, endogenous FPP is the only available prenyl diphosphate substrate for CrtB, since the level of GGPP is very low in E. coli compared with that of FPP. If CrtB could synthesize C30 carotenoids from FPP, the 4,4'-diapophytoene produced would be desaturated by CrtN and the cells would develop a yellow color. In contrast to the intense yellow of XL1-Blue transformed with pUC-crtM-crtN, XL1-Blue(pUC-crtB-crtN) showed no color development (Figure 2.2b). When expressed alone or with CrtN, CrtB synthesized C30 carotenoids very poorly in liquid culture (see Figures 2.5 and 2.6). We thus conclude that CrtB fails to complement CrtM in a C30 pathway. We also analyzed the pigment produced by XL1-Blue carrying pUC-fps-crtBcrtN. In this case, the cells displayed a yellow color similar to that of XL1-Blue transformed with pUC-fps-crtM-crtN (Figure 2.2b). HPLC analysis of carotenoid extracts from XL1-Blue(pUC-fps-crtB-crtN) revealed the C40 carotenoid neurosporene, 99 with trace amounts of the C30 carotenoids 4,4'-diapolycopene and 4,4'-diaponeurosporene. Thus, CrtB seems to have at least some C30 activity in the presence of high levels of FPP. Production of the C40 carotenoid neurosporene as the major pigment is explained by the promiscuous nature of both FPS and CrtN. This was verified by our observation that cells expressing an fps-crtB-crtI operon had a weak pink hue and accumulated lycopene and 3,4,3',4'-tetradehydrolycopene. Thus, FPS can produce significant amounts of GGPP in E. coli when overexpressed. It is known that avian FPS also possesses weak ability to synthesize GGPP (41). Indeed, other studies have shown a varied product distribution and strong dependence on conditions for FPS enzymes (25, 34). Additionally, CrtN can accept phytoene as a substrate and introduce two or three double bonds (39). When we transformed XL1-Blue with pUC-crtE-crtB-crtN, the resulting cells exhibited significant yellow color (Figure 2.2b) and accumulated neurosporene, thus demonstrating the promiscuity of CrtN. Screening for synthase function in a foreign pathway In the previous section, we confirmed that the carotene synthases CrtB and CrtM show negligible activity in their respective foreign pathways. We next proceeded to evolve the two enzymes, with the goal of improving the function of each in the other's native pathway. To uncover CrtB variants with significant CrtM-like ability to synthesize C30 carotenoids, we constructed pUC-[crtB]-crtN libraries and transformed them into XL1-Blue cells. Here GGPP is not available, so cells with the wild-type crtB-crtN operon fail to develop color. Any variants of CrtB able to convert FPP (C15PP) into 4,4'diapophytoene would produce yellow colonies. Similarly, we searched for CrtM mutants with improved C40 activity by transforming four pUC-crtE-[crtM]-crtI libraries into XL1- 100 Blue. As described in the previous section, the amount of FPP available for carotenoid biosynthesis becomes significantly depleted when CrtE is overexpressed, resulting in negligible production of C30 carotenoids, even by native C30 enzymes. Cells expressing wild-type CrtM from the crtE-crtM-crtI operon showed a weak pink-orange color due to trace production of lycopene as well as C30 and C35 carotenoids, but CrtM mutants able to complement CrtB via acquisition of enhanced C40 activity would be expected to yield intensely red-pink colonies and thus be distinguishable on the plates. Evolution of 4,4'-diapophytoene synthase (CrtM) for function in a C40 pathway Four different mutagenic libraries of crtM corresponding to four different mutation rates were generated by performing error-prone PCR (54) on the entire 843nucleotide crtM gene. PCR products from each reaction were ligated into the XbaI-XhoI site of pUC-crtE-crtM-crtI (Figure 2.2a), resulting in pUC-crtE-[crtM]-crtI libraries. Figure 2.3 shows a typical agar plate covered with a nitrocellulose membrane upon which lie colonies of E. coli XL1-Blue expressing a crtE-[crtM]-crtI library. In each library, colonies with pale orange, pale yellow, or virtually no color dominated the population. The pale orange colonies express variants of CrtM with phenotypes similar to that of the wild-type enzyme in this context, while the pale and colorless colonies express severely or completely inactivated synthase mutants. More rare were colonies that developed an intense red-pink color, indicating significant production of C40 carotenoids and hence improved CrtB-like activity of CrtM. On average, about 0.5% of the colonies screened showed intense red-pink color. The highest frequency of positives was obtained from the library prepared by PCR with the lowest MnCl2 concentration (0.02 mM). In this library, approximately 1 out of every 120 colonies was red-pink (0.8%). We screened 101 over 23,000 CrtM mutants from the four libraries and picked 116 positive clones. These clones were re-screened by stamping them onto an agar plate covered with a white nitrocellulose membrane. All 116 stamped clones exhibited red-pink coloration. We sequenced the 10 most intensely red stamped clones, as determined by visual assessment. Mutations found in these variants (Table 2.1) were heavily biased toward transitions: 36 versus only 3 transversions. Additionally, 87% of the base substitutions found by sequencing were A/T→G/C. This is a typical observation for PCR mutagenesis with MnCl2 (7, 24). Out of 39 total nucleotide substitutions, 24 resulted in amino acid substitutions. Most notably, 9 of the 10 sequenced CrtM mutants had a mutation at phenylalanine 26. Carotenoid production of evolved CrtM variants We analyzed in detail the in vivo carotenoid production of variant M8, which has the F26L mutation only; variant M9, which has the F26S mutation; and variant M10, which has no mutation at F26. To confirm the newly acquired CrtB-like function of these three sequenced variants of CrtM, XL1-Blue cultures carrying each of the three plasmids pUC-crtE-M8-crtI, pUC-crtE-M9-crtI, and pUC-crtE-M10-crtI (collectively referred to as pUC-crtE-M8-10-crtI) were cultivated in TB medium. Extracted pigments were analyzed by HPLC with a photodiode array detector (Figure 2.4). These analyses revealed that all three clones produced the C40 carotenoids lycopene (peak 5) and 3,4,3',4'tetradehydrolycopene (peak 4) as major products, whereas cells harboring the parent pUC-crtE-crtM-crtI plasmid produced mainly C30 and trace amounts of C40 and C35 carotenoids. Two carotenoids with C35 backbone structures were detected in extracts from cells harboring pUC-crtE-crtM-crtI and pUC-crtE-M8-10-crtI. Elution profiles, UV-visible 102 spectra, and mass spectra confirm that one of the structures is the fully conjugated C35 carotenoid 4-apo-3',4'-didehydrolycopene. We also detected C35 carotenoids with 11 conjugated double bonds. Because C35 carotenoids are asymmetric, there are two possible C35 structures that possess 11 conjugated double bonds: 4-apolycopene and 4-apo-3',4'didehydro-7,8-dihydrolycopene. At present, we have not determined whether the cells synthesize one (and if so, which one) or both of these C35 carotenoids. Direct product distribution of CrtM variants in the presence of GGPP (C20PP) To directly evaluate the product specificities of the three CrtM mutants, we constructed pUC-crtE-M8-10 plasmids and transformed the plasmids into XL1-Blue cells. Here the CrtM variants are supplied with GGPP, but the carotenoid products cannot be desaturated. Because all three possible products in this scenario, 4,4'-diapophytoene (C30), 4-apophytoene (C35), and phytoene (C40), have an identical chromophore structure consisting of three conjugated double bonds, the molecular extinction coefficients for all three can be assumed to be equivalent, irrespective of the total number of carbon atoms in the carotenoid molecule (49). Thus, the product distribution of the CrtM variants can be discerned from the HPLC chromatogram peak heights (at 286 nm) for each product. As can be seen in Figure 2.5, cultures expressing CrtB along with CrtE produced approximately 230 nmol of phytoene/g of dry cell mass but did not detectably synthesize C30 or C35 carotenoids. CrtE-CrtM cultures produced about 20 to 35 nmol of each of the C30, C35, and C40 carotenoids/g. In stark contrast, CrtE-M8 and CrtE-M9 cultures, which express synthases mutated at F26, generated over 300 nmol of phytoene/g. These cultures also produced 40 to 75% more C35 carotenoids but 70 to 90% fewer C30 carotenoids than CrtE-CrtM cultures. Cultures expressing M10, which has no mutation at F26, along with 103 CrtE synthesized roughly 100 nmol of phytoene/g as well as about 20 and 14 nmol of C35 and C30 carotenoids/g, respectively. Comparison of the C40 and C30 performance of CrtM variants To compare the acquired CrtB-like C40 function of the CrtM mutants with their CrtM-like ability to synthesize C30 carotenoids, the three mutants were placed back into the original C30 pathway, resulting in pUC-M8-10-crtN plasmids. Pigmentation analysis of cells carrying these as well as pUC-crtE-M8-10-crtI plasmids (Figure 2.6) revealed that the CrtM variants retained C30 activity, although the C30 pathway performance of cells expressing these mutants varied. Acetone extracts of cultures expressing variant M8, which has the F26L mutation alone, along with CrtE and CrtI (CrtE-M8-CrtI cultures) had more than threefold-higher C40 carotenoid absorbance (475 nm) than extracts of CrtECrtM-CrtI cultures. However, the C30 carotenoid absorbance (470 nm) of extracts of cultures expressing variant M8 and CrtN was only about 40% that of CrtM-CrtN cultures. Cultures expressing variant M9, which has the F26S mutation, along with CrtE and CrtI also yielded extracts with over three times the C40 signal of CrtE-CrtM-CrtI culture extracts. Yet the C30 signal of M9-CrtN culture extracts was only about 10% that of CrtMCrtN culture extracts. Cultures expressing mutant M10, which has no mutation at F26, along with CrtE and CrtI generated extracts with approximately 70% higher C40 absorbance than extracts of CrtE-CrtM-CrtI cultures. Interestingly, cultures expressing M10 and CrtN showed no reduction in C30 pathway performance compared to CrtM-CrtN cultures. M10 was the only one of the 10 sequenced variants that gave this result (data not shown). 104 Analysis of mutations The most significant and only recurring mutations found in the 10 sequenced CrtM variants were those at F26. In seven variants, phenylalanine is replaced by leucine, while two have serine at this position. The F26L substitution alone is sufficient for acquisition of C40 activity by CrtM (M8; Table 2.1). Thus, we conclude that mutation at residue 26 of CrtM directly alters the enzyme's specificity. Changing enzyme expression level or stability would not lead to increased C40 performance and decreased C30 performance of cultures expressing CrtM variants compared to those expressing wildtype CrtM (Figure 2.6). Variant M10 possesses no mutation at amino acid position 26. Thus, it is apparent that mutation at this residue is not the only means by which CrtM can acquire CrtB-like activity. Of all 10 sequenced variants, M10 is the only one with no substitution for phenylalanine at position 26 and is also the only one whose cultures did not have decreased C30 pathway performance compared to CrtM cultures. Structural considerations: mapping mutations onto human squalene synthase Most structurally characterized isoprenoid biosynthetic enzymes, including FPS, squalene synthase (SqS), and terpene cyclases, have the same “isoprenoid synthase fold,” consisting predominantly of α-helices (22). In addition, secondary structure prediction (11) and sequence alignment (8) of CrtM and CrtB with their related enzymes also suggest that the enzymes have a common fold. Given this, and the lack of a crystal structure for a carotenoid synthase, we mapped the amino acid substitutions in our CrtM variants onto the crystal structure of human SqS (37). SqSs catalyze the first committed step in cholesterol biosynthesis. As with carotene synthases, this is the head-to-head condensation of two identical prenyl 105 diphosphates (FPP for SqS). The condensation reaction catalyzed by SqS proceeds in two distinct steps (38). The first half-reaction generates the stable intermediate presqualene diphosphate, which forms upon abstraction of a diphosphate group from a prenyl donor, followed by 1-1' condensation of the donor and acceptor molecules. In the second halfreaction, the intermediate undergoes a complex rearrangement followed by a second removal of diphosphate and a final carbocation-quenching process (Figure 2.7). SqSs catalyze the additional reduction of the central double bond of 4,4'-diapophytoene (also called dehydrosqualene) by NADPH to form squalene, a reaction not performed by carotene synthases. Because the SqS and carotene synthase enzymes share clusters of conserved amino acids and catalyze essentially identical reactions, it is probable that they also have the same reaction mechanism. Indeed, when NADPH is in short supply, SqS produces 4,4'-diapophytoene, the natural product of CrtM (19, 52). Sequence alignment of CrtM with related enzymes implies that F26 in CrtM corresponds to I58 in human SqS, which is located in helix B and points into the pocket that accommodates the second half-reaction. This residue is located four amino acids downstream of a flexible “flap” region in SqS that is believed to form a “lid” that shields intermediates in the reaction pocket from water (37). The amino acids constituting the flap are almost completely conserved among all known head-to-head isoprenoid synthase enzymes that catalyze 1-1' condensation. It is noteworthy that a single mutation at F26 of CrtM is sufficient to permit this enzyme to synthesize C40 carotenoids. Because this position is thought to lie in the site of the second half-reaction (rearrangement and quenching of a cyclopropylcarbinyl intermediate) (37), and because wild-type CrtM produces trace amounts of phytoene 106 (indicating that initially accepting two molecules of GGPP is not impossible), it is likely that wild-type CrtM is able to perform the first half-reaction of phytoene synthesis (condensation of two molecules of GGPP to form a presqualene diphosphate-like structure). We hypothesize that the F26 residue prevents the second half-reaction from going to completion by acting as a steric or electrostatic inhibitor of intermediate rearrangement. When this bulky phenylalanine residue is replaced with a smaller or more flexible amino acid such as serine or leucine, the second half-reaction is permitted to proceed and phytoene is produced. Similar results for a variety of short-chain isoprenyl diphosphate synthases (IDSs) have been reported. In this class of enzymes, the size of the fifth amino acid upstream of the first aspartate-rich motif determines product length (29, 32, 33, 35, 36). Based on a very strong correlation between average product length and surface area of amino acids in this position (36), as well as the available crystal structure for avian FPS (47), it was hypothesized that this residue forms a steric barrier or wall that controls the size of the products (30). This model has been successfully applied to a variety of other enzymes in this family, including medium-chain IDSs (53). It is unknown why so many IDSs differing so greatly in sequence share a single key residue that determines product specificity. Evolution of phytoene synthase (CrtB) in a C30 pathway We constructed mutant libraries of crtB to search for variants with C30 activity. Four mutagenic PCR libraries differing in MnCl2 concentration were ligated into the XbaI-XhoI site of pUC-crtB-crtN, resulting in four pUC-[crtB]-crtN plasmid libraries. Upon transformation into XL1-Blue, pUC-crtB-crtN, containing wild-type crtB, gave no 107 discernible pigmentation, while the pUC-crtM-crtN cells produced had intense yellow pigmentation. Among the ~43,000 colonies expressing pUC-[crtB]-crtN variants screened, not a single one showed distinguishable yellow (or other) pigmentation. Thus, we found no CrtB mutants with improved C30 activity. We also constructed five additional pUC-[crtB]-crtN libraries by using the Genemorph PCR mutagenesis kit (Stratagene), which enables the construction of randomly mutagenized gene libraries with a mutational spectrum different from that of those generated by mutagenic PCR with MnCl2 (7). We screened an additional ~10,000 variants, but again found no variants of CrtB able to synthesize C30 carotenoids at appreciable levels. An explanation for the relative difficulty in acquiring C30 function for CrtB may be that accepting a smaller-than-natural substrate is a more difficult task for this type of enzyme than accepting a larger-than-natural substrate. However, an evolutionary explanation may also be in order. The contexts in which the two enzymes evolved differ markedly. FPP is a precursor for many life-supporting compounds and is present in all organisms. Thus, C40 enzymes such as CrtB have evolved in the presence of FPP throughout their history. It is not unreasonable to infer that CrtB has evolved under a nontrivial selection pressure to minimize consumption of FPP, for accepting FPP as a substrate and bypassing GGPP could be detrimental to the host organism's fitness. In stark contrast, C30 synthases have evolved in an environment essentially devoid of GGPP. Consequently, no pressure to reject this substrate has been placed on these enzymes. 108 CONCLUSIONS We have demonstrated for the first time that the specificity of a carotenoid synthase is easily and profoundly altered by directed evolution. In our experiments, the carotene synthases CrtM and CrtB failed to complement one another in their respective foreign pathways. However, upon random mutagenesis of crtM followed by C40-specific color complementation screening, we isolated 116 mutants of the enzyme (~0.5% of the total screened) with significant C40 activity. The in vivo C40 pathway performance of the best CrtM variants is comparable to that of CrtB, the native C40 synthase. That CrtM, a key biosynthetic enzyme that determines the size of the carotenoids in the downstream pathway, is capable of synthesizing C35 carotenoid backbones and is one amino acid substitution from becoming a C40 phytoene synthase is a finding of evolutionary and technological significance. Firn and Jones have suggested that natural product biosynthetic pathways have evolved traits that enhance their ability to generate and retain chemical diversity in order to maximize their likelihood of discovering new biologically active molecules (13, 14, 20). The two major traits that Firn and Jones have identified in these pathways are the use of enzymes with broad substrate or product specificity and a high degree of pathway branching or bifurcation. Our work has revealed a special type of combinatorial pathway branching that exploits the precursor-fusion chemistry of carotenoid synthases. The native reaction catalyzed by CrtM is the condensation of two molecules of FPP to form a C30 carotenoid backbone. Here we have shown that wild-type CrtM also possesses the ability to condense one molecule of FPP with one molecule of GGPP to form a C35 carotenoid backbone. However, the enzyme is very poor at condensing two molecules of 109 GGPP to form the C40 carotenoid backbone, phytoene. By broadening the specificity of CrtM through point mutagenesis, we have created variants that can also synthesize C40 carotenoids. That these mutants can synthesize two non-native products as a result of the addition of only one new precursor (GGPP) to their substrate repertoires is a consequence of both their broadened specificity as well as the nature of the coupling reaction catalyzed by carotenoid synthases. If a (mutant) carotenoid synthase does not discriminate between n different prenyl diphosphate substrates, it will synthesize n(n+1)/2 different carotenoid backbones by virtue of the combinatorics of substrate coupling. Therefore, carotenoid synthases, by virtue of their special chemistry, can act as key “diversity-multiplying” enzymes in carotenoid biosynthetic pathways if suitable mutants able to accept nonnative precursors can be found. In the following chapter, we describe the continuation of our efforts to further expand carotenoid biosynthesis by creating additional backbones that can serve as new branch points for carotenoid pathway diversification. MATERIALS AND METHODS Materials Erwinia uredovora (current approved name: Pantoea ananatis) C40 carotenoid pathway genes crtE encoding GGPP (C20PP) synthase, crtB encoding phytoene synthase, and crtI encoding phytoene desaturase were obtained by genomic PCR as previously described (43). The Escherichia coli farnesyl diphosphate (FPP, C15PP) synthase gene fps was cloned from E. coli strain JM109. The C30 pathway genes crtM (4,4'-diapophytoene synthase) and crtN (4,4'-diapophytoene desaturase) were cloned by PCR from Staphylococcus aureus genomic DNA (ATCC no. 35556D). We used E. coli XL1-Blue 110 supercompetent cells (Stratagene, La Jolla, CA) for cloning, screening, and carotenoid biosynthesis. AmpliTaq polymerase (Perkin-Elmer, Boston, MA) was employed for mutagenic PCR, while Vent polymerase (New England Biolabs, Beverly, MA) was used for cloning PCR. All chemicals and reagents used were of the highest available grade. Plasmid construction Plasmid maps and sequences can be found in Appendix A. Plasmid pUC18m was constructed by removing the entire lacZ fragment and multi-cloning site from pUC18 and inserting the multi-restriction CTCGAG-GGGCCC-GGCGCC-3' site sequence 5'-CATATG-GAATTC-TCTAGA- (NdeI-EcoRI-XbaI-XhoI-ApaI-EheI). Each open reading frame following a Shine-Dalgarno ribosomal binding sequence (boldface) and a spacer (AGGAGGATTACAAA) was cloned into pUC18m (see Appendix A) to form artificial operons for acyclic C40 carotenoids (pUC-crtE-crtB-crtI) or acyclic C30 carotenoids (pUC-fps-crtM-crtN or pUC-crtM-crtN) (the genes in plasmids and operons are always listed in transcriptional order). To facilitate exchange between the two pathways, corresponding genes were flanked by the same restriction sites: isoprenyl diphosphate synthase genes (fps and crtE) were flanked by EcoRI and XbaI sites, carotene synthase genes (crtM and crtB) were flanked by XbaI and XhoI sites, and carotene desaturase genes (crtN and crtI) were flanked by XhoI and ApaI sites (Figure 2.2a). Error-prone PCR mutagenesis and screening A pair of primers (5'-GCTGCCGTCAGTTAATCTAGAAGGAGG-3') and (5'AGACGAATTGCCAGTGCCAGGCCACCG-3') flanking crtM were designed to amplify the 0.85-kb gene by PCR under mutagenic conditions: 5 U AmpliTaq (100 µl 111 total volume); 20 ng of template DNA (entire plasmid); 50 pmol of each primer; 0.2 mM dATP; 1.0 mM (each) dTTP, dGTP, and dCTP; and 5.5 mM MgCl2. Four different mutagenic libraries were made by using four different MnCl2 concentrations: 0.2, 0.1, 0.05, and 0.02 mM. The temperature cycling scheme was 95 °C for 4 min followed by 30 cycles of 95 °C for 30 s, 40 °C for 45 s, and 72 °C for 2 min and by a final stage of 72 °C for 10 min. PCR yields for the 0.85-kb amplified fragment were 5 µg, corresponding to an amplification factor of ~1,000 or ~10 effective cycles. The PCR product from each library was purified with a Zymoclean gel purification kit (Zymo Research, Orange, CA), followed by digestion with XhoI and XbaI and DpnI treatment to digest the template. The PCR products were ligated into the carotene synthase gene site of vector pUC-crtE-crtMcrtI, resulting in pUC-crtE-[crtM]-crtI libraries (square brackets indicate the randomly mutagenized gene). PCR mutagenesis of crtB on plasmid pUC-crtB-crtN was performed with primers 5'-CTTTACACTTTATGCTTCCGG-3' and 5'-TCCTGTGACACCTG CACCAATTACTGC-3' under the same conditions used for mutagenesis of crtM. The PCR products were purified, digested, and ligated as described above into the carotene synthase gene site of pUC-crtB-crtN, resulting in four pUC-[crtB]-crtN libraries. The ligation mixtures were transformed into E. coli XL1-Blue supercompetent cells. Colonies were grown on Luria-Bertani (LB) plates containing carbenicillin (50 mg/l) as a selective marker at 37 °C for 12 h. Colonies were lifted onto white nitrocellulose membranes (Pall, Port Washington, NY), transferred onto LB+carbenicillin plates, and visually screened for color variants after an additional 12 to 24 h at room temperature. Selected colonies were picked and cultured overnight in 96-well plates, each well containing 0.5 ml of liquid LB medium supplemented with carbenicillin (50 mg/l). 112 Pigment analysis Among the strains we tested as expression hosts, XL1-Blue showed the best results in terms of stability and intensity of the color developed by colonies on agar plates. Although all of the genes assembled in each plasmid are grouped under a single lac operator/promoter, our expression system showed no response in terms of pigmentation levels to different IPTG (isopropyl-β-D-thiogalactopyranoside) concentrations. Thus, leaky transcription from the lac promoter was sufficient for carotenoid production in E. coli. Based on this observation, all experiments described in this report were performed without IPTG induction. To measure the relative amounts of carotenoids synthesized (see Figure 2.6), single colonies were inoculated into 3-ml precultures (LB medium containing 50 mg/l of carbenicillin) and shaken at 250 rpm and 37 °C overnight. Twenty microliters of each preculture were inoculated into 3 ml of Terrific broth (TB) medium (also containing 50 mg/l of carbenicillin) and shaken for 24 (C30 carotenoid cultures) or 30 h (C40 carotenoid cultures) at 250 rpm and 30 °C. The optical density at 600 nm (OD600) of each culture was measured immediately before harvesting. Then, 2 ml of each TB culture was centrifuged, the liquid was decanted, and the resulting cell pellet was extracted with 1 ml of acetone. The absorbance spectrum of each extract was measured with a SpectraMax Plus 384 microplate spectrophotometer (Molecular Devices, Sunnyvale, CA). Pigmentation levels in the culture extracts were determined from the height of absorption maxima (λmax): 470 nm for C30 carotenoids and 475 nm for C40 carotenoids. For accurate determination of the carotenoids produced by the cultures, 500 µl of LB preculture was inoculated into 50 ml of TB+carbenicillin (50 mg/l) and shaken in a 113 250-ml tissue culture flask (Becton Dickinson-Falcon, Bedford, MA) at 170 rpm and 30 °C for 24 to 30 h. Cultures expressing only CrtE plus a carotenoid synthase (CrtB, CrtM, or a mutant CrtM) were cultivated in 50 ml of TB+carbenicillin (50 mg/l) for 40 h at 160 rpm and 28 °C in 250-ml tissue culture flasks. The OD600 of each culture was measured immediately before harvesting, and the dry cell mass was determined from this measurement by using a calibration curve generated for similar cultures. After centrifugation, the cell pellets were extracted with 10 ml of an acetone-methanol mixture (2:1 [vol/vol]). Pigments were concentrated, and the solvent was replaced with 20 ml of hexane. Then, an equal volume of aqueous NaCl (100 g/l) was added, and the mixture was shaken vigorously to remove oily lipids. The upper phase containing the carotenoids was dewatered with anhydrous MgSO4 and concentrated in a rotary evaporator. The final volume of extract from each 50-ml culture was 1 ml. A 30- to 50-µl aliquot of extract was passed through a Spherisorb ODS2 column (4.6 × 250 mm, 5-µm particle size; Waters, Milford, MA) and eluted with an acetonitrile-isopropanol mixture (93:7 or 80:20 [vol/vol]) at a flow rate of 1 ml/min using an Alliance high-pressure liquid chromatography (HPLC) system (Waters) equipped with a photodiode array detector. Mass spectra were obtained with a series 1100 HPLC-mass spectrometer (HewlettPackard/Agilent, Palo Alto, CA) coupled with an atmospheric pressure chemical ionization interface. The molar quantities of the carotenoid backbones shown in Figure 2.5 were determined by comparing their HPLC chromatogram peak heights (at 286 nm) to a calibration curve generated using known amounts of a β,β-carotene standard (Sigma), and then multiplying by εβ,β-carotene (450 nm)/εphytoene (286 nm). The values of the molar 114 extinction coefficients (ε) used in the calculation were 138,900 and 49,800, respectively (6). The molar quantities of carotenoids were then normalized to the dry cell mass of each culture. 115 Table 2.1. Mutations found in sequenced CrtM variants Mutant designation Nonsynonymous mutations (amino acid change) Synonymous mutations M1 T76C (F26L) A364T (T122S) A561G M2 A58G (K20E) T77C (F26S) A471T M3 T76C (F26L) G127A (V43M) A408G M4 T76C(F26L) A446G (E149G) T150C G489A A726G M5 T76C (F26L) T800C (F267S) M6 A35G (H12R) T76C (F26L) A80G (D27G) A290G (K97R) A620G (H207R) A688G M7 T76C (F26L) A186G A447G M8 T78A (F26L) A345G M9 T77C (F26S) T119C (I40T) T135C T141C M10 A10G (M4V) A35G (H12R) T176C (F59S) A242G (Q81R) A539G (E180G) A39G 116 Figure 2.1 117 Figure 2.1. Natural carotenoid biosynthetic pathways. Carotenoid pathways are branches of the general isoprenoid pathway. In nature, two distinctive routes to carotenoid structures are known. C40 pathways, which start from the head-to-head condensation of two molecules of GGPP (C20PP), are found in a variety of plant and microbial species. C30 pathways, which begin with the condensation of two molecules of FPP (C15PP), have been identified only in a small number of bacterial species. Shown are the 15Z isomers of 4,4'-diapophytoene and phytoene, which are produced by CrtM and CrtB, respectively. Bacterial desaturases CrtN and CrtI catalyze Z-E isomerization of the central double bond in addition to desaturation of their carotenoid backbone substrates (15). The enzyme FPS is an FPP synthase; CrtE is a bacterial GGPP synthase; CrtM and CrtB are bacterial carotenoid synthases. DMAPP, dimethylallyl diphosphate; IPP, isopentenyl diphosphate. 118 Figure 2.2 119 Figure 2.2. C30 and C40 production systems used in this work. (a) Plasmids used in this work. Under the control of the lac promoter and operator of a pUC18-derived plasmid, carotene synthase genes (crtB and crtM) were cloned into an XbaI-XhoI site, along with the isoprenyl diphosphate synthase genes (crtE and fps; EcoRI-XbaI site) and the carotene desaturase genes (crtN and crtI; XhoI-ApaI site). Listed on the right are the approximate mole percentages (as a fraction of total carotenoids) of the main carotenoids produced by E. coli XL1-Blue cells transformed with each plasmid. Only major species consisting of at least 10% of total carotenoids are shown. ND, none detected. (b) Cell pellets of XL1-Blue harboring various carotenogenic plasmids. 120 Figure 2.3 121 Figure 2.3. Typical plate with E. coli XL1-Blue colonies expressing a mutagenic library of CrtM together with CrtI and CrtE. XL1-Blue cells were transformed with pUC-crtE-[crtM]-crtI (E[M]I), where [crtM] represents a mutagenic library of crtM. Among a majority of pale colonies can be seen deep red-pink colonies (arrows) expressing CrtM variants that have acquired C40 pathway functionality. EMI and EBI, XL1-Blue cells respectively. transformed with pUC-crtE-crtM-crtI and pUC-crtE-crtB-crtI, 122 Figure 2.4 123 Figure 2.4. HPLC-photodiode array analysis of carotenoid extracts of E. coli transformants carrying plasmids pUC-crtE-crtB-crtI, pUC-crtE-crtM-crtI, and pUCcrtE-M8-10-crtI. The following carotenoids were identified: peak 1, 4,4'-diapolycopene (λmax [nm]: 501, 470, 444, M+ at m/z = 400.4); peak 2, 4-apo-3',4'-didehydrolycopene (λmax [nm]: 527, 490, 465, M+ at m/z = 466.4); peak 3, 4-apolycopene or 4-apo-3',4'didehydro-7,8-dihydrolycopene (λmax [nm]: 500, 470, 441, M+ at m/z = 468.4); peak 4, 3,4,3',4'-tetradehydrolycopene (λmax [nm]: 540, 510, 480, M+ at m/z = 532.4); peak 5, lycopene (λmax [nm]: 502, 470, 445, M+ at m/z = 536.5). Double peaks indicate different geometrical isomers of the same compound. Insets, recorded absorption spectra of individual HPLC peaks. 124 Figure 2.5. Direct product distribution of CrtM and its mutants in the presence of CrtE (GGPP supply). Carotenoid extracts of XL1-Blue cells carrying plasmids pUCcrtE-crtB, pUC-crtE-crtM, and pUC-crtE-M8-10 were analyzed by HPLC with a photodiode array detector. Peaks for 4,4'-diapophytoene (C30), 4-apophytoene (C35), and phytoene (C40) were monitored at 286 nm. Molar quantities of the various carotenoids were determined as described in Materials and Methods. Bar heights are normalized to dry cell mass, each represents the average of three independent cultures; error bars, standard deviations. ND, not detected. 125 Figure 2.6. Pigmentation produced by CrtM variants in C40 and C30 pathways. XL1Blue cells were transformed with either pUC-crtE-M8-10-crtI (C40 pathway) or pUC-M8-10-crtN (C30 pathway) and cultured in a test tube (3 ml of TB) as described in Materials and Methods. Pigmentation levels in the culture extracts were determined from the absorption peak height of λmax (470 nm for C30 carotenoids, 475 nm for C40 carotenoids) of each sample. Bar heights are normalized to OD600 and represent the averages of at least three replicates; error bars, standard deviations. 126 Figure 2.7. Reaction schemes for SqS and CrtM. PSPP, presqualene diphosphate. 127 REFERENCES 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. Albrecht, M., S. Takaichi, N. Misawa, G. Schnurr, P. Boger, and G. Sandmann. 1997. Synthesis of atypical cyclic and acyclic hydroxy carotenoids in Escherichia coli transformants. J. Biotechnol. 58:177-185. Albrecht, M., S. Takaichi, S. Steiger, Z. Y. Wang, and G. Sandmann. 2000. Novel hydroxycarotenoids with improved antioxidative properties produced by gene combination in Escherichia coli. Nat. Biotechnol. 18:843-846. Armstrong, G. A., and J. E. Hearst. 1996. Carotenoids 2: Genetics and molecular biology of carotenoid pigment biosynthesis. Faseb J 10:228-37. Ben-Dor, A., A. Nahum, M. Danilenko, Y. Giat, W. Stahl, H. D. Martin, T. Emmerich, N. Noy, J. Levy, and Y. Sharoni. 2001. Effects of acyclo-retinoic acid and lycopene on activation of the retinoic acid receptor and proliferation of mammary cancer cells. Arch. Biochem. Biophys. 391:295-302. Britton, G. 1998. Overview of carotenoid biosynthesis, p. 13-140. In G. Britton, S. Liaaen-Jensen, and H. Pfander (ed.). Carotenoids vol. 3: Biosynthesis and Metabolism. Birkhäuser Verlag, Basel. Britton, G. 1995. UV/Visible Spectroscopy, p. 13-62. In G. Britton, S. LiaaenJensen, and H. Pfander (ed.). Carotenoids, vol. 1B: Spectroscopy. Birkhäuser Verlag, Basel. Cline, J., and H. Hogrefeo. 1999. Randomize gene sequences with new PCR mutagenesis kit. Stratagies 13:157-162. Corpet, F. 1988. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res. 16:10881-90. Crock, J., M. Wildung, and R. Croteau. 1997. Isolation and bacterial expression of a sesquiterpene synthase cDNA clone from peppermint (Mentha x piperita, L.) that produces the aphid alarm pheromone (E)-beta-farnesene. Proc. Natl. Acad. Sci. USA 94:12833-12838. Croteau, R., F. Karp, K. C. Wagschal, D. M. Satterwhite, D. C. Hyatt, and C. B. Skotland. 1991. Biochemical characterization of a spearmint mutant that resembles peppermint in monoterpene content. Plant Physiol. 96:744-752. Cuff, J. A., M. E. Clamp, A. S. Siddiqui, M. Finlay, and G. J. Barton. 1998. JPred: a consensus secondary structure prediction server. Bioinformatics 14:892-3. Facchini, P. J., and J. Chappell. 1992. Gene family for an elicitor-induced sesquiterpene cyclase in tobacco. Proc. Natl. Acad. Sci. USA 89:11088-11092. Firn, R. D., and C. G. Jones. 2000. The evolution of secondary metabolism—a unifying model. Mol. Microbiol. 37:989-994. Firn, R. D., and C. G. Jones. 2003. Natural products—a simple model to explain chemical diversity. Nat. Prod. Rep. 20:382-391. Fraser, P. D., N. Misawa, H. Linden, S. Yamano, K. Kobayashi, and G. Sandmann. 1992. Expression in Escherichia coli, purification, and reactivation of the recombinant Erwinia uredovora phytoene desaturase. J. Biol. Chem. 267:19891-19895. Garcia-Asua, G., H. P. Lang, C. N. Hunter, and R. J. Cogdell. 1998. Carotenoid diversity: a modular role for the phytoene desaturase step. Trends Plant Sci. 3:445-449. 128 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. Hornero-Méndez, D., and G. Britton. 2002. Involvement of NADPH in the cyclization reaction of carotenoid biosynthesis. FEBS Lett. 515:133-136. Ishimi, Y., M. Ohmura, X. X. Wang, M. Yamaguchi, and S. Ikegami. 1999. Inhibition by carotenoids and retinoic acid of osteoclast-like cell formation induced by bone-resorbing agents in vitro. J. Clin. Biochem. Nutr. 27:113-122. Jarstfer, M. B., B. S. J. Blagg, D. H. Rogers, and C. D. Poulter. 1996. Biosynthesis of squalene. Evidence for a tertiary cyclopropylcarbinyl cationic intermediate in the rearrangement of presqualene diphosphate to squalene. J. Am. Chem. Soc. 118:13089-13090. Jones, C. G., and R. D. Firn. 1991. On the evolution of plant secondary chemical diversity. Philos. Trans. R. Soc. Lond. Ser. B-Biol. Sci. 333:273-280. Komori, M., R. Ghosh, S. Takaichi, Y. Hu, T. Mizoguchi, Y. Koyama, and M. Kuki. 1998. A null lesion in the rhodopin 3,4-desaturase of Rhodospirillum rubrum unmasks a cryptic branch of the carotenoid biosynthetic pathway. Biochemistry 37:8987-8994. Lesburg, C. A., J. M. Caruthers, C. M. Paschall, and D. W. Christianson. 1998. Managing and manipulating carbocations in biology: terpenoid cyclase structure and mechanism. Curr. Opin. Struct. Biol. 8:695-703. Linden, H., N. Misawa, D. Chamovitz, I. Pecker, J. Hirschberg, and G. Sandmann. 1991. Functional complementation in Escherichia coli of different phytoene desaturase genes and analysis of accumulated carotenes. Z. Naturforsch. (C) 46:1045-1051. LinGoerke, J. L., D. J. Robbins, and J. D. Burczak. 1997. PCR-based random mutagenesis using manganese and reduced dNTP concentration. Biotechniques 23:409-412. Matsuoka, S., H. Sagami, A. Kurisaki, and K. Ogura 1991. Variable product specificity of microsomal dehydrodolichyl diphosphate synthase from rat liver. J. Biol. Chem. 266:3464-3468. Mayne, S. T. 1996. Beta-carotene, carotenoids, and disease prevention in humans. Faseb J. 10:690-701. Nagaki, M., S. Sato, Y. Maki, T. Nishino, and T. Koyama. 2000. Artificial substrates for undecaprenyl diphosphate synthase from Micrococcus luteus B-P 26. J. Mol. Catal. B-Enzym. 9:33-38. Nagaki, M., A. Takaya, Y. Maki, J. Ishibashi, Y. Kato, T. Nishino, and T. Koyama. 2000. One-pot syntheses of the sex pheromone homologs of a codling moth, Laspeyresia promonella L. J. Mol. Catal. B-Enzym. 10:517-522. Narita, K., S. Ohnuma, and T. Nishino. 1999. Protein design of geranyl diphosphate synthase. Structural features that define the product specificities of prenyltransferases. J Biochem (Tokyo) 126:566-71. Ogura, K., and T. Koyama. 1998. Enzymatic aspects of isoprenoid chain elongation. Chem. Rev. 98:1263-1276. Ohnuma, S., H. Hemmi, T. Koyama, K. Ogura, and T. Nishino. 1998. Recognition of allylic substrates in Sulfolobus acidocaldarius geranylgeranyl diphosphate synthase: Analysis using mutated enzymes and artificial allylic substrates. J. Biochem. (Tokyo) 123:1036-1040. 129 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. Ohnuma, S., K. Hirooka, H. Hemmi, C. Ishida, C. Ohto, and T. Nishino. 1996. Conversion of product specificity of archaebacterial geranylgeranyl-diphosphate synthase—identification of essential amino acid residues for chain length determination of prenyltransferase reaction. J. Biol. Chem. 271:18831-18837. Ohnuma, S., K. Hirooka, C. Ohto, and T. Nishino. 1997. Conversion from archaeal geranylgeranyl diphosphate synthase to farnesyl diphosphate synthase— Two amino acids before the first aspartate-rich motif solely determine eukaryotic farnesyl diphosphate synthase activity. J. Biol. Chem. 272:5192-5198. Ohnuma, S., T. Koyama, and K. Ogura 1993. Alternation of the product specificities of prenyltransferases by metal ions. Biochem. Biophys. Res. Commun. 192:407-412. Ohnuma, S., T. Nakazawa, H. Hemmi, A. M. Hallberg, T. Koyama, K. Ogura, and T. Nishino. 1996. Conversion from farnesyl diphosphate synthase to geranylgeranyl diphosphate synthase by random chemical mutagenesis. J. Biol. Chem. 271:10087-10095. Ohnuma, S., K. Narita, T. Nakazawa, C. Ishida, Y. Takeuchi, C. Ohto, and T. Nishino. 1996. A role of the amino acid residue located on the fifth position before the first aspartate-rich motif of farnesyl diphosphate synthase on determination of the final product. J. Biol. Chem. 271:30748-30754. Pandit, J., D. E. Danley, G. K. Schulte, S. Mazzalupo, T. A. Pauly, C. M. Hayward, E. S. Hamanaka, J. F. Thompson, and H. J. Harwood. 2000. Crystal structure of human squalene synthase—A key enzyme in cholesterol biosynthesis. J. Biol. Chem. 275:30610-30617. Poulter, C. D., T. L. Capson, M. D. Thompson, and R. S. Bard. 1989. Squalene synthetase—inhibition by ammonium analogs of carbocationic intermediates in the conversion of presqualene diphosphate to squalene. J. Am. Chem. Soc. 111:3734-3739. Raisig, A., and G. Sandmann. 2001. Functional properties of diapophytoene and related desaturases of C30 and C40 carotenoid biosynthetic pathways. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 1533:164-170. Redmond, T. M., S. Gentleman, T. Duncan, S. Yu, B. Wiggert, E. Gantt, and F. X. Cunningham. 2001. Identification, expression, and substrate specificity of a mammalian beta-carotene 15,15'-dioxygenase. J. Biol. Chem. 276:6560-6565. Reed, B. C., and H. C. Rilling. 1976. Substrate binding of avian liver prenyltransferase. Biochemistry 15:3739-45. Sacchettini, J. C., and C. D. Poulter. 1997. Creating isoprenoid diversity. Science 277:1788-1789. Schmidt-Dannert, C., D. Umeno, and F. H. Arnold. 2000. Molecular breeding of carotenoid biosynthetic pathways. Nat Biotechnol 18:750-3. Schnurr, G., N. Misawa, and G. Sandmann. 1996. Expression, purification and properties of lycopene cyclase from Erwinia uredovora. Biochem. J. 315:869-74. Steele, C. L., J. Crock, J. Bohlmann, and R. Croteau. 1998. Sesquiterpene synthases from grand fir (Abies grandis)—comparison of constitutive and woundinduced activities, and cDNA isolation, characterization and bacterial expression of delta-selinene synthase and gamma-humulene synthase. J. Biol. Chem. 273:2078-2089. 130 46. 47. 48. 49. 50. 51. 52. 53. 54. Takaichi, S., K. Inoue, M. Akaike, M. Kobayashi, H. Ohoka, and M. T. Madigan. 1997. The major carotenoid in all known species of heliobacteria is the C30 carotenoid 4,4'-diaponeurosporene, not neurosporene. Arch. Microbiol. 168:277-281. Tarshis, L. C., M. J. Yan, C. D. Poulter, and J. C. Sacchettini. 1994. Crystal structure of recombinant farnesyl diphosphate synthase at 2.6-angstrom resolution. Biochemistry 33:10871-10877. Taylor, R. F. 1984. Bacterial triterpenoids. Microbiol. Rev. 48:181-198. Taylor, R. F., and B. H. Davies. 1974. Triterpenoid carotenoids of Streptococcus faecium UNH 564P. Biochem. J. 139:751-760. Wang, C. W., and J. C. Liao. 2001. Alteration of product specificity of Rhodobacter sphaeroides phytoene desaturase by directed evolution. J. Biol. Chem. 276:41161-41164. Wieland, B., C. Feil, E. Gloriamaercker, G. Thumm, M. Lechner, J. M. Bravo, K. Poralla, and F. Gotz. 1994. Genetic and biochemical analyses of the biosynthesis of the yellow carotenoid 4,4'-diaponeurosporene of Staphylococcus aureus. J. Bacteriol. 176:7719-7726. Zhang, D. L., and C. D. Poulter. 1995. Biosynthesis of non-head-to-tail isoprenoids—Synthesis of 1'-1-structures and 1'-3-structures by recombinant yeast squalene synthase. J. Am. Chem. Soc. 117:1641-1642. Zhang, Y. W., X. Y. Li, and T. Koyama. 2000. Chain length determination of prenyltransferases: both heteromeric subunits of medium-chain (E)-prenyl diphosphate synthase are involved in the product chain length determination. Biochemistry 39:12717-12722. Zhao, H., J. C. Moore, A. Volkov, and F. H. Arnold. 1999. Methods for optimizing industrial enzymes by directed evolution, p. 597-604. In A. L. Demain and J. E. Davies (ed.). Methods of Industrial Microbiology and Biotechnology. 2nd ed, ASM Press, Washington DC. 131 CHAPTER 3 Taking Natural Products to New Lengths: Biosynthesis of Novel Carotenoid Families Based on Unnatural Carbon Scaffolds 132 SUMMARY In an extension of previous work in which biosynthetic routes to novel C45 and C50 carotenoid backbones were established in recombinant E. coli, we demonstrate the capacity of the C40 carotenoid desaturase CrtI from Erwinia uredovora to accept and desaturate these unnatural substrates. Desaturation step number in the C45 and C50 pathways was not very specific, resulting in the production of at least 10 more C45 and C50 carotenoids. These compounds have never before been identified in nature or chemically synthesized. We also present evidence of the biosynthesis of a novel asymmetric C40 backbone formed by condensation of farnesyl diphosphate (C15PP) with farnesylgeranyl diphosphate (C25PP), and the subsequent desaturation of this backbone by CrtI in an unusual manner. Under some conditions, we found that C40, C45, and C50 carotenoid backbones synthesized in E. coli were oxidized by unknown chemical or enzymatic means, giving monohydroxylated backbone derivatives. Some of these hydroxylated species served as substrates for CrtI in vitro, leading to the production of still more novel carotenoids. The ability to supply CrtI with unnaturally large substrates in vivo has allowed us to show that this enzyme regulates its desaturation step number by sensing the end groups of its substrate, unlike certain fungal carotenoid desaturases whose step number is apparently determined by their particular multimeric state. Analysis of the different molecular mechanisms by which chemical diversity is generated and then propagated through our nascent pathways provides insight into how this occurs in nature and the selective pressures that have shaped the evolution of natural product biosynthetic enzymes and pathways. 133 INTRODUCTION Nature’s wealth of small molecules has proven extremely useful to humankind as a source of medicines, fragrances, pigments, toxins, and other functional compounds. Many of these natural products have captivated scientists for decades with their highly complex structures and the elaborate biosynthetic routes by which they are generated. As products of evolution, the ~170,000 natural products characterized thus far (10) are a collective demonstration of the power of this simple algorithm to generate immense chemical diversity. Inspired by the importance of natural products to health, culture, chemistry, and biology, we have been conducting our own evolution experiments with natural product biosynthetic pathways in the laboratory. By mimicking and accelerating some of the very same processes that drive natural evolution—mutation, gene transfer, and selection—we and others have shown that it is possible to evolve carotenoid biosynthetic pathways, a model system of choice, in new, unnatural directions in standard laboratory bacteria (3, 4, 31, 35, 42, 43, 45, 46, 48, 53, 54, 56). (See Chapter 1 for a detailed description of how biosynthetic pathways can be evolved in the laboratory.) Carotenoids are ancient natural pigments that play vital roles in key biological processes such as photosynthesis, quenching of free radicals, and vision (57). The ~700 carotenoids identified in nature branch from only two major pathways. Over 95% of natural carotenoids are biosynthesized from the symmetric C40 backbone phytoene, which is formed by condensation of two molecules of geranylgeranyl diphosphate (GGPP, C20PP) (Figure 3.1). The C40 pathway, in addition to being the most diverse carotenoid pathway, is also the most widespread in nature, appearing in thousands of species of 134 bacteria, archaea, algae, fungi, and plants. A separate C30 pathway that begins with the fusion of two molecules of farnesyl diphosphate (FPP, C15PP) (Figure 3.1) accounts for the remainder of natural carotenoid diversity. C30 carotenoids are known in only a small group of bacteria such as Staphylococcus, Streptococcus, Methylobacterium, and Heliobacterium species (52). (See Chapter 1 for a more thorough description of the key enzymatic steps in carotenoid biosynthesis.) Previously, our group reported the expansion of carotenoid biosynthesis with the generation of a novel C35 carotenoid pathway in recombinant E. coli (53, 56). This unusual pathway, which begins with the heterocondensation of C15PP and C20PP to form an unnatural, asymmetric C35 carotenoid backbone, was further diversified by coexpression of downstream carotenoid desaturases and cyclases, some of which were evolved in our laboratory for a particular function in the new pathway (see Chapter 1). This work led to the biosynthesis of at least ten new carotenoids never before identified in nature or chemically synthesized (53). Our laboratory also reported the biosynthesis of novel C45 and C50 carotenoid backbones in recombinant E. coli expressing the Y81A mutant of the farnesyl diphosphate (C15PP) synthase from Bacillus stearothermophilus, BstFPSY81A (37), and the F26A+W38A double mutant of the C30 carotenoid synthase CrtM from Staphylococcus aureus, CrtMF26A,W38A (54). The first enzyme, BstFPSY81A, synthesizes a mixture of C15PP, C20PP, and the very rare (see Discussion) farnesylgeranyl diphosphate (FGPP, C25PP). The next enzyme, CrtMF26A,W38A, has an expanded substrate and product range compared to wild-type CrtM, which can only synthesize C30 and C35 carotenoid backbones (53, 56). When BstFPSY81A and CrtMF26A,W38A were coexpressed in E. coli, a 135 mixture of C35, C40, C45, and C50 carotenoid backbones was produced (Figure 3.1, ref. (54)). The above work did not investigate whether these unnaturally large C45 and C50 carotenoid backbones could be metabolized by carotenoid desaturases, leading to the introduction of an extended conjugated system (chromophore) and the resulting emergence of pigmentation in the C45 and C50 pathways. In addition, the lack of an asymmetric C40 carotenoid backbone detected in extracts of E. coli cultures coexpressing BstFPSY81A and CrtMF26A,W38A warranted further examination. From homo- or heterocondensation of the three precursors C15PP, C20PP, and C25PP, six different carotenoid backbones are theoretically possible: C30, C35, symmetric C40 (phytoene, C20+C20), asymmetric C40 (C15+C25), C45, and C50 (see Figure 3.1). However, only one population of C40 backbones was isolated, and it was assumed to be all phytoene (54). Since C15PP, C20PP, and C25PP are all present in the cells, as indicated by the biosynthesis of C35, C45, and C50 carotenoid backbones (CrtMF26A,W38A has lost most of its C30 synthesis capability (54)), it was unclear if asymmetric C40 backbones were not discovered because they were not synthesized or because they could not be separated and distinguished from phytoene. In this work, we demonstrate the remarkable substrate promiscuity of the carotenoid desaturase CrtI from Erwinia uredovora by showing that it can desaturate C45 and C50 backbones, leading to an array of pigmented C45 and C50 carotenoids. We reveal that the production of specific desaturation products and the absence of others provides insight into the mechanism by which CrtI regulates its desaturation step number. We also present evidence that the asymmetric C40 carotenoid backbone is indeed synthesized by E. 136 coli expressing BstFPSY81A and variants of CrtM, and that this unnatural backbone is processed by CrtI in an unusual manner. Finally, we show that large carotenoid backbones are further diversified in an unexpected manner by in vivo hydroxylation under certain conditions, and that some of these hydroxylated backbones can serve as alternative substrates for CrtI. In addition to the potential technological uses of the new carotenoids we report herein, the biosynthetic routes by which they are synthesized provide a convenient laboratory model to study emergent metabolic pathways in nature. We show how analysis of the modes by which chemical diversity is propagated in the new carotenoid pathways can enhance our understanding of the mechanisms used by evolution to continually discover new small molecules. RESULTS CrtI desaturates unnatural C45, C50, and asymmetric C40 carotenoid backbones, resulting in the biosynthesis of numerous novel carotenoids E. coli XL1-Blue cells coexpressing BstFPSY81A, a CrtM variant (either the F26L single mutant CrtMF26L or the F26A+W38A double mutant CrtMF26A,W38A), and wild-type CrtI from E. uredovora synthesize at least ten novel desaturated carotenoids with C45 or C50 backbones. Structures 3, 4, 5, 6, 10, 11a, 11b, 12a, 12b/c, and 13, reported here for the first time, were identified by their high-performance liquid chromatography (HPLC) retention times, UV-visible spectra, and mass spectra (Table 3.1; Figures 3.2, 3.3, and 3.6). We also isolated an unusual 2-step desaturated C40 carotenoid that is likely based on 137 an asymmetric C40 backbone (structure 1, see below). Table 3.2 lists trivial and IUPACIUB semi-systematic names for the structures depicted in Figures 3.2-3.4. E. coli cultures harboring the plasmid pUCmodII-crtMF26L-crtI-bstFPSY81A, pUCmodII-crtMF26A,W38A-crtI-bstFPSY81A, or the plasmids pUC18m-bstFPSY81A and pACcrtMF26A,W38A-crtI together synthesized mixtures of all of these novel desaturated carotenoids in different proportions and titers, depending on the expression plasmid(s). With all of these expression systems, we observed almost 100% conversion of the C45 carotenoid backbone 16-isopentenylphytoene to desaturated C45 carotenoids, while only about 25% of the C50 backbone 16,16'-diisopentenylphytoene was converted to desaturated products (Table 3.1). Whereas E. uredovora CrtI primarily catalyzes four desaturation steps on phytoene (24, 33, 56), acts predominantly as a 4-step desaturase in a C30 pathway (56), and performs 4-5 desaturation steps on C35 carotenoids (53), the step number of CrtI is less well defined on C45 and C50 substrates. In the C45 pathway, 2-, 3-, 5-, and 6-step products were isolated from E. coli cultures harboring the plasmids listed above; in the same cultures, 2-, 3-, 4-, and 6-step C50 products were found. In both pathways, there was no clear majority product (Table 3.1). We refer to this imprecise desaturase behavior as “stuttering.” Figures 3.2 and 3.3 depict the desaturation isomers of these C45 and C50 products whose biosynthesis is supported by the HPLC and MS data (see below). In general, the UV-visible absorption spectra of the desaturated C45 and C50 carotenoids are hypsochromically shifted compared to those of C40 carotenoids with the same number of conjugated double bonds (Figure 3.6: 3 and 10 vs. ζ-carotene, 4 and 11a vs. neurosporene, 12a vs. lycopene; see Figure 2.1 for C40 structures). The spectra shown 138 in Figure 3.6 are the most bathochromic of those measured before and after iodinecatalyzed photoisomerization, and most of these spectra exhibit cis-peaks (9) that are less or only slightly more intense than the corresponding C40 standard (e.g., 11a vs. neurosporene, 10 vs. ζ-carotene). We therefore hypothesize that the hypsochromic shifts in the spectra of 3, 4, 10, 11a, and 12a are not caused by a high proportion of Z- (cis) isomers, but rather by unfavorable interactions between these highly non-polar carotenoids and the much more polar, mostly-acetonitrile solvent. Of special interest are C50 carotenoids 11b and 12b/c. Compared with 11a, the former has a spectrum that is hypsochromically shifted by 11 nm at the wavelength of maximum absorption, λmax (Figure 3.6), elutes slightly earlier in reverse-phase HPLC, is only one-tenth as abundant, and has an identical molecular ion at m/z = 674.2 (Table 3.1). We believe that these properties are best explained by an unusual desaturation pattern in 11b in which all three desaturation steps are on one side of the molecule (Figure 3.3) (we denote this as “3+0” desaturation). We are not aware of other carotenoids with a 3+0 desaturation pattern whose spectra we can compare with that of 11b. However, 7,8,11,12tetrahydrolycopene, an isomer of ζ-carotene with a 2+0 desaturation pattern instead of the 1+1 pattern of ζ-carotene (see Figure 3.4), has an absorption spectrum that is hypsochromically shifted by ~5 nm compared with that of ζ-carotene (9, 14, 15, 51). Product 12b/c has a spectrum that is hypsochromically shifted by 4 nm at λmax compared with that for 12a (Figure 3.6), and it elutes slightly before 12a in HPLC (Table 3.1). This species is only slightly less abundant than 12a and has the same molecular ion at m/z = 672.3 (Table 3.1). These properties suggest that 12b/c is a 4-step desaturated C50 carotenoid with a 3+1 desaturation pattern (12b in Figure 3.3). However, we cannot rule 139 out the possibility that 12b/c has a 4+0 desaturation pattern (12c) or is a mixture of 12b and 12c, which is why we have designated its spectrum in Figure 3.6 as “12b/c.” Carotenoid 5 has the mass of a 5-step desaturated C45 carotenoid, and its absorption spectrum corresponds closely with that of 3,4-didehydrolycopene, which has a 3+2 desaturation pattern (9, 25). There are two possible C45 carotenoids with this desaturation pattern (Figure 3.2), and we could not distinguish by HPLC and MS analysis whether carotenoid 5 has specific structure 5a or 5b, or represents a mixture of the two. Similarly, it is not possible to confirm whether carotenoid 4 has precise structure 4a or 4b without synthetic standards or the use of advanced nuclear magnetic resonance techniques requiring up to tens of milligrams of sample (18, 32). Spectra 6 and 13 are similar to the spectrum of 3,4,3',4'-tetradehydrolycopene with 6 desaturation steps in a 3+3 pattern (9). Spectrum 6 is slightly hypsochromically shifted compared to spectrum 13; this effect is likely due to a significant proportion of Zisomers in our sample of carotenoid 6, evidenced by the greater relative absorbance of its cis peaks at 396 and 415 nm. Having no reason to believe that either 6 or 13 has an unusual desaturation pattern, we have depicted these structures in Figures 3.2 and 3.3, respectively, with symmetrical 3+3 desaturation. Notably absent in all the extracts we analyzed of cultures expressing BstFPSY81A, CrtMF26L or CrtMF26A,W38A, and CrtI were 4-step desaturated C45 and 5-step desaturated C50 carotenoids. We believe these observations, which may initially seem merely curious, can help to clarify the means by which this desaturase regulates its step number (see Discussion). 140 Carotenoid 1 was initially surprising to find in the above extracts. This molecule and ζ-carotene have the same molecular ion at m/z = 540.2 (Table 3.1), but compared with ζ-carotene, carotenoid 1 has a slightly longer HPLC retention time (~19 vs. ~18 min) and a UV-visible spectrum that is hypsochromically shifted by 5 nm at λmax (Figure 3.6). Because both molecules are C40 carotenoids with equal masses and virtually identical polarities, this wavelength shift cannot be due to a change in solvent–analyte interaction. Rather, we believe the shift is due to a 2+0 desaturation pattern, and that carotenoid 1 is based on an asymmetric C40 (C15+C25) backbone as shown in Figure 3.4 (see Discussion). E. coli expressing only BstFPSY81A and a variant of CrtM accumulate hydroxylated carotenoid backbones When E. coli XL1-Blue cells were transformed with the desaturase-free plasmids pUCmodII-crtMF26L-bstFPSY81A or pUCmodII-crtMF26A,W38A-bstFPSY81A and grown in liquid culture, they accumulated novel monohydroxylated C45 and C50 carotenoid backbones 7 and 14 as well as monohydroxylated C40 backbones, which may be novel depending on the location of the OH-group and whether the C40 backbone is symmetric or asymmetric (Figures 3.5, 3.7 and 3.8). The biosynthesis of these hydroxylated carotenoids was confirmed by MS and chemical derivatization (Figure 3.9), and their proportions relative to each other and the unmodified backbones were quite reproducible (Figure 3.8). On the other hand, similar XL1-Blue cultures harboring the plasmids pUC18m-bstFPSY81A and pAC-crtMF26A,W38A did not produce hydroxylated backbones. Some possible reasons for this disparity are presented in the Discussion. 141 Although we could not identify the specific locations of the hydroxy groups by HPLC and MS analysis, we can exclude several possible regioisomers. The in vitro acetylation reactions with acetic anhydride described in Materials and Methods were positive for all the hydroxylated C40, C45, and C50 backbones, with conversions above 90% in all cases. This indicates that the hydroxy groups are primary or secondary (19). Also, the propensity of the hydroxylated and acetylated carotenoids to lose water or acetate, respectively, in atmospheric pressure chemical ionization mass spectrometry (APCI-MS) (Figure 3.9) is evidence that the substituents are located in an allylic position (2). Finally, that some of these hydroxylated backbones are desaturated by CrtI in vitro (see below) suggests the OH group is located far from the center of the molecule. A hydroxy group located close to the center of a carotenoid backbone, which is where desaturases initiate their catalytic action, might interfere with the ability of a desaturase to process such a substrate. Only one C40 backbone fraction was seen in HPLC; likewise, hydroxylated C40 backbones eluted as a single peak (Figure 3.7). Attempts to further separate these fractions using a linear gradient of acetonitrile:isopropanol (98:2 to 93:7 over 30 min.) also failed. However, because of the strong evidence that carotenoid 1 is based on the asymmetric C40 carotenoid backbone 16-isopentenyl-4'-apophytoene, we nevertheless believe that the C40 backbone fraction is a mixture of phytoene and 16-isopentenyl-4'apophytoene, and that the C40-OH fraction may also be a mixture of hydroxylated versions of these backbones. Indeed, the subtle structural differences between symmetric and asymmetric backbones of the same length should have minimal effects on 142 chromatographic retention. Therefore, co-elution under our separation conditions would not be unexpected. Cultures of E. coli strain HB101 carrying either plasmid pUCmodII-crtMF26LbstFPSY81A or pUCmodII-crtMF26A,W38A-bstFPSY81A also synthesized hydroxylated C40, C45, and C50 carotenoids, but in different relative proportions compared with the XL1-Blue cultures (data not shown). Surprisingly, significant proportions of acetylated C40 and C45 carotenoid backbones (~10 and ~19 mol% of total carotenoids, respectively) were detected in cultures of HB101(pUC18m-bstFPSY81A + pAC-crtMF26A,W38A) in addition to smaller amounts of hydroxylated C40 and C45 carotenoid backbones (~2 and ~4 mol%, respectively). The in vivo-acetylated carotenoids behaved identically in HPLC and APCIMS to their counterparts produced by in vitro derivatization of hydroxylated carotenoids with acetic anhydride. These acetylated backbones are probably formed by the reaction of hydroxylated carotenoids with acetyl-CoA, a process that is somehow promoted in HB101 cells carrying these plasmids. In vitro desaturation experiments with CrtI In an effort to learn more about the substrate specificity of E. uredovora CrtI and to potentially access new desaturated carotenoids, we carried out in vitro desaturation reactions in which an invariant amount of E. coli lysate containing CrtI was incubated with an individual carotenoid backbone (see Materials and Methods). These experiments, in which substrates dissolved in a small amount of acetone were added to cell lysate, yielded markedly different results compared with carotenoid desaturation in living cells, where carotenoid backbones already present in intact cell membranes are converted by membrane-bound desaturases. E. uredovora CrtI converts all the available phytoene to 143 lycopene (and even tetradehydrolycopene) in vivo, leaving no intermediates (33, 56). In vitro, on the other hand, the enzyme converted an average of 19% of the phytoene to a mixture of mainly lycopene and intermediate products (Table 3.3). A similarly reduced in vitro efficiency on both native and non-native substrates was also seen for purified CrtI from Rhodobacter capsulatus and CrtN from S. aureus (39, 40), and appears to be a general feature of in vitro compared with in vivo carotenoid desaturation. This reduced efficiency is probably a consequence of suboptimal reaction conditions and substrate delivery in vitro. In vivo, carotenoids are sequestered together with desaturases in cell membranes, increasing the effective concentration of both enzyme and substrate. In vitro, proper association of carotenoid backbones and desaturases may be hampered. Additionally, inactivated desaturases are replenished with newly synthesized copies in vivo but not in vitro. Of the intermediates detected and quantified by HPLC, 1-step phytofluene and 2step ζ-carotene were each present at approximately twice the level of 3-step neurosporene (Table 3.3, structures of these carotenoids are shown in Figure 3.4). This result qualitatively agrees with that of Fraser et al., who detected phytofluene and ζcarotene but not neurosporene in the product mixture when they supplied purified E. uredovora CrtI with phytoene in vitro (24). If we take the in vitro conversion statistics as a measure of the degree of compatibility between a substrate and CrtI, then comparing the fractional conversion of other backbones to the benchmark of ~19% conversion of phytoene can allow us to assess the substrate range of the enzyme, at least with respect to this relevant parameter. In this context, the C30 diapophytoene is a much less favored substrate for CrtI, while the 144 C45 backbone ranks between phytoene and diapophytoene in acceptability (Table 3.3). The C50 backbone diisopentenylphytoene was not converted at all in vitro, reaffirming our in vivo results showing that a substantial proportion of this backbone synthesized in E. coli cells remained unmetabolized by CrtI. These results also further highlight the reduced efficiency that carotenoid desaturases display in vitro. In addition to its much lower conversion in vitro (~5% vs. ~100% in vivo), the C45 backbone also underwent fewer desaturation steps in vitro, with the terminal in vitro product being the 2-step carotenoid 3. The predominant C45 desaturation product in vitro was the 1-step carotenoid 2, which was not detected at all in vivo. Therefore, the reduced step number displayed by CrtI in vitro on the C45 backbone allowed access to a novel carotenoid that did not accumulate in cultured cells. CrtI also desaturated hydroxylated C40 and C45 backbones, resulting in the production of (at least) two more new carotenoids, 8 and 9. (The desaturated monohydroxy C40 carotenoids OH-phytofluene, OH-ζ-carotene, OH-neurosporene, and OH-lycopene (see Figure 3.5) may also be novel, depending on the location of the hydroxy group.) Although the fungal carotenoid desaturase Al-1 from Neurospora crassa was reported to desaturate 1-OH-neurosporene and 1-OH-lycopene (25) and the 3-step desaturase from R. capsulatus was shown to efficiently accept 1,2-epoxyphytoene as a substrate (39), this is to our knowledge the first report of the desaturation of oxygenated carotenoids by a bacterial desaturase. Because the precise position of the hydroxy group in the C45-OH substrate 7 is unknown, we do not know the exact structures of products 8 and 9. Accordingly, we have represented these carotenoids only by name in Figure 3.5. Interestingly, the average fractional conversion of the hydroxylated C45 backbone was 145 almost three times that of the unmodified C45 backbone, implying that the hydroxy group promotes desaturation in vitro. We are uncertain of the reason for this, but hypothesize that the increased polarity brought about by hydroxylation may enhance the ability of the substrate to be solubilized and therefore mix with the enzyme in the reaction medium. The hydroxy group on the C50-OH substrate 14, however, did not appear to assist desaturation by CrtI in vitro. Neither it nor its unmodified counterpart was desaturated in these experiments. As with the C45 backbone, the C45-OH backbone 7 was desaturated two steps in vitro, with a greater proportion of 2-step products accumulating in the latter reactions. The hydroxy group clearly does not interfere with the desaturation sequence of CrtI, at least up to the first two steps. We interpret this as evidence that the OH group is located distal to the center of the molecule. Hydroxylated C40 carotenoid backbones were also converted at a relatively high level (Table 3.3). It is not certain whether this substrate pool was a mixture of hydroxylated phytoene and hydroxylated 16-isopentenyl-4'-apophytoene, and if so, the proportion of each. However, judging by the relatively similar percentages of 1- to 4-step products in the phytoene and C40-OH desaturation experiments, we surmise that most of the C40-OH pool was hydroxylated phytoene. Therefore, we did not depict any hydroxylated asymmetric C40 pathway products in Figure 3.5. We are not sure of the reason(s) for the increased proportion of 3-step products in the reactions with C40-OH backbones compared to phytoene. This may be somehow due to the hydroxy group on the substrate, but many other explanations are plausible. HPLC analysis of the 2-step desaturation products from the C40-OH reactions did not yield convincing evidence of a hydroxylated derivative of carotenoid 1. This can be taken as additional evidence that 146 hydroxylated phytoene dominated the C40-OH backbone population. As with the C45-OH backbone, the hydroxy group on the C40-OH substrate does not inhibit the desaturation sequence of CrtI, as evidenced by the high proportion of 4-step desaturation products. We believe this result points to a terminal or near-terminal position of the OH group in the hydroxylated C40 backbones. Carotenoid biosynthesis in cultures expressing the C25PP synthase from Aeropyrum pernix In an attempt to increase the proportion of C50 carotenoids synthesized by our recombinant E. coli, we substituted BstFPSY81A with the C25PP synthase from the thermophilic archaeon Aeropyrum pernix, ApFGS. Farnesylgeranyl diphosphate (FGPP, C25PP) is a very rare molecule in nature, and apFGS is the only natural C25PP synthase gene sequenced to date (50). We cloned apFGS from A. pernix genomic DNA and coexpressed it with crtMF26A,W38A on one plasmid as well as on separate plasmids. ApFGS turned out to be disappointing as a C25PP synthase and mainly behaved as a C20PP synthase in our cells, as shown in Figure 3.10. When CrtMF26A,W38A is expressed alone in E. coli XL1-Blue(pUC18m-crtMF26A,W38A), only C30 and C35 carotenoids are synthesized (Figure 3.10, first data set). Expression of wild-type CrtM alone in E. coli results in almost exclusive production of C30 diapophytoene (54), but CrtMF26A,W38A is a much poorer C30 synthase and apparently a very effective scavenger of C20PP. Therefore, even though the endogenous level of C20PP is very low in E. coli and cannot support C40 phytoene synthesis by the native C40 synthase CrtB (see Chapter 2) or by CrtMF26A,W38A (Figure 3.10, first data set), the latter enzyme condenses abundant C15PP with much less abundant C20PP to such an extent that C30 backbones outnumber C35 backbones by only a 147 factor of 2 in XL1-Blue(pUC18m-crtMF26A,W38A). When ApFGS was coexpressed with CrtMF26A,W38A together on plasmid pUC18m-apFGS-crtMF26A,W38A, approximately equal proportions of C35 and C40 carotenoid backbones were synthesized (Figure 3.10, second data set). This indicates that ApFGS primarily synthesizes C20PP and also that a substantial amount of C15PP remains available for carotenoid biosynthesis in XL1Blue(pUC18m-apFGS-crtMF26A,W38A) cells. When the same two genes were expressed on separate plasmids, XL1-Blue cultures harboring pUC18m-apFGS and pAC-crtMF26A,W38A synthesized the C40 backbone phytoene almost exclusively, with traces of C45 and C50 backbones also being detected (Figure 3.10, fourth data set). This difference is most likely due to the differential copy number of the two plasmids. Being on a high-copy pUC-based plasmid, apFGS should be more highly expressed than crtMF26A,W38A, which is on a medium-copy pAC-based plasmid (both genes are under the control of identical lac promoter and operator sequences). The higher relative ApFGS level should therefore allow this enzyme to more completely consume the available C15PP before it can be incorporated into carotenoids by CrtMF26A,W38A. However, even when given this opportunity, ApFGS still releases primarily C20PP and only small amounts of C25PP. ApFGS was shown to prefer C20PP as a substrate for synthesizing C25PP (50). Therefore, to see if increasing the supply of C20PP in the cells would result in a higher proportion of C45 or C50 carotenoids, we co-transformed XL1-Blue cells with pUC18mapFGS-crtMF26A,W38A and pAC-crtE containing the C20PP synthase gene from E. uredovora. This resulted in a ~3-fold increase in total carotenoids, and some C45 backbones were detected, but phytoene represented the vast majority of the carotenoid 148 backbone pool in these cells (Figure 3.10, third data set). Evidently, ApFGS could not effectively compete with CrtMF26A,W38A for the additional C20PP supplied by CrtE. A. pernix is a thermophilic organism, and ApFGS probably has an optimum temperature much higher than that at which E. coli cultures can be grown. However, cultivating ApFGS-expressing cultures at 37 °C instead of the usual 28 °C at which we grow our carotenogenic E. coli cultures did not increase the proportion of C45 or C50 carotenoids (data not shown). When CrtMF26A,W38A was coexpressed with ApFGS at 37 °C, almost no carotenoid backbones were synthesized. This may be due to compromised stability of this CrtM double mutant. The distribution of carotenoids synthesized by cells expressing BstFPSY81A is strongly influenced by Idi overexpression and physiological state It is known that the biosynthesis of isoprenoids in E. coli is limited by the supply of the C5PP “starter unit” dimethylallyl diphosphate (DMAPP, structure shown in Figure 1.4), and that overexpression of isopentenyl diphosphate isomerase (Idi) can increase carotenoid titers by approximately an order of magnitude (59). In an effort to increase our carotenoid titers, we transformed XL1-Blue cells with plasmids pUC18m-bstFPSY81A-idi (containing the idi gene from E. coli) and pAC-crtMF26A,W38A. After culturing these cells in TB medium, we found that Idi overexpression resulted in a ~10-fold increase in the quantity of carotenoids synthesized by the cells, but also dramatically shifted the distribution of carotenoid backbones toward production of phytoene (cf. first and second data sets in Figure 3.11). This result is likely due to alteration of the relative levels of isoprenyl diphosphate precursors of different lengths brought about by Idi overexpression (see Discussion). 149 In the course of our experiments involving coexpression of bstFPSY81A, crtMF26L or crtMF26A,W38A, and crtI, we noticed that colonies expressing these genes from one or two plasmids reproducibly displayed a dramatically deeper red color than cell pellets from liquid cultures harboring the same plasmid(s). To investigate this further, we collected a sufficient quantity of the colonies (~0.5 g wet cells) to permit carotenoid extraction and HPLC analysis, and compared the carotenoid content of the colonies with that of the cell pellets. We discovered that the colonies primarily synthesized C40 carotenoids and barely made any C45 and C50 products, while the liquid cultures inoculated by the very same colonies made substantial amounts of the larger carotenoids. This effect was also observed with no desaturase present (cf. first and third data sets in Figure 3.11) and occurred whether colonies were grown on LB- or TB-agar plates. Therefore, the dissimilar carotenoid distributions do not result from “defective” colonies, but rather, from differences in the physiology of E. coli colonies and liquid cultures. The strikingly similar shift toward an increased proportion of C40 carotenoids at the expense of larger products caused by Idi overexpression and by cell growth in colonies is examined in more detail in the Discussion. Attempted creation of a C60 carotenoid biosynthetic pathway To ascertain whether our best C50 carotenoid-producing CrtM variants or the C40 synthase CrtB could also synthesize C60 carotenoid backbones, we coexpressed the hexaprenyl diphosphate (C30PP) synthase HexPS from Micrococcus luteus (47) with CrtMF26L, CrtMF26A,W38A, or CrtB on plasmids pUC18m-hexPS-crtMF26L, pUC18mhexPS-crtMF26A,W38A, and pUC18m-hexPS-crtB, respectively. However, we did not detect any carotenoids at all in cultures of XL1-Blue transformed with these plasmids. This 150 result indicates that HexPS is an active enzyme that consumes C15PP, since expression of crtMF26A,W38A alone on a pUC18m-based plasmid yields C30 and C35 carotenoids (Figure 3.10), and also that these synthases cannot synthesize C60 carotenoids. Additional evidence also demonstrates that HexPS efficiently consumes C15PP and specifically synthesizes C30PP. XL1-Blue colonies harboring pUC18m-crtM-crtN are bright yellow due to the synthesis of large amounts of desaturated C30 carotenoids (Figure 3.12a, panel 1). However, colonies transformed with pUC18m-hexPS-crtM-crtN are colorless, indicating considerable consumption of C15PP by HexPS (Figure 3.12a, panel 2). Coexpression of the C40 carotenoid genes CrtB and CrtI further demonstrates that HexPS does not release C20PP. Whereas colonies harboring pUC18m-crtE-crtB-crtI are red-pink due to production of desaturated C40 carotenoids beginning with the synthesis of C20PP by CrtE (Figure 3.12a, panel 3), colonies transformed with plasmid pUC18m-hexPScrtB-crtI are colorless because hexPS does not supply CrtB with C20PP (Figure 3.12a, panel 4). Finally, in vitro experiments performed by Adam Hartwick show that when supplied with C15PP and isopentenyl diphosphate (IPP, structures shown in Figures 3.13.5), CrtE synthesizes the expected C20PP product (Figure 3.12b, lane 1), BstFPSY81A synthesizes the expected C25PP product (Figure 3.12b, lane 2), and HexPS specifically synthesizes an even larger product (Figure 3.12b, lane 3). Similar experiments performed by Shimizu et al. confirmed with authentic standards that M. luteus HexPS indeed synthesizes primarily C30PP from C15PP and IPP (47). No known carotenoid synthase, including our CrtM mutants, can convert C30PP to a C60 carotenoid backbone. It may be possible to evolve one of these mutants or another carotenoid synthase in the laboratory for C60 carotenoid synthesis. However, our results 151 showing poor conversion of the C50 backbone to desaturated carotenoids by CrtI (Tables 3.1 and 3.3) and no conversion by the C30 desaturase CrtN (data not shown) indicate that, should a biosynthetic route to C60 backbones be established, desaturation of this substrate would be even less efficient by these enzymes. Therefore, no simple colorimetric assay exists for the screening of synthase variants in a directed evolution experiment aimed at evolving a C60 carotenoid synthase. DISCUSSION Determination of desaturation step number by Erwinia CrtI Elegant genetic complementation experiments with heterokaryons of the fungus Phycomyces blakesleeanus have provided convincing evidence for the existence of multienzyme complexes that function as assembly lines for carotenoid biosynthesis in that organism (5, 12, 16, 36). In these complexes, carotenoid substrates undergo stepwise chemical transformations as they are processed by one enzyme and then passed on to the next one in the complex, hence the analogy to an industrial assembly line. Therefore, phytoene undergoes four desaturation steps in Phycomyces because four desaturase subunits are present in that organism’s carotenoid biosynthetic enzyme complexes (5). Carotenogenic enzyme complexes are believed to be widespread in other organisms as well, although there are many uncertainties regarding the factors that determine the extent of carotenoid desaturation (7). Our results on the in vivo desaturation of the C45 backbone isopentenylphytoene by E. uredovora CrtI provide evidence against the idea that the number of subunits in a complex determines the desaturation step number. As mentioned, E. uredovora CrtI is 152 primarily a 4-step desaturase in the symmetric C40 pathway, converting phytoene to lycopene as the majority product (24, 33, 56). If the primary determinant of this 4-step product specificity were the association of CrtI subunits as tetramers, we should also expect primarily 4-step products with other carotenoid backbones as well, assuming these substrates are accepted and processed by the complex. However, not only is this not the case in the C45 pathway, but 4-step C45 products do not accumulate at all, even though 5and 6-step C45 carotenoids are detected (Table 3.1, Figure 3.2). Therefore, 4-step C45 carotenoids are “skipped over” by CrtI in vivo, indicating a preference for synthesizing the higher step-number C45 products 5 (5 steps, majority product) and 6 (6 steps, secondmost abundant). We believe this observation is related to two others. First, in the C50 pathway, we observed no accumulation of 5-step products in vivo (Table 3.1, Figure 3.3), even though 6-step C50 products were formed. Second, in vitro desaturation experiments with E. uredovora CrtI on phytoene have shown that the 3-step neurosporene is the least abundant intermediate, accumulating at low levels (Table 3.3) or not at all (24). (In vivo, the enzyme leaves behind no intermediates and even catalyzes six desaturation steps on phytoene (33, 56).) These seemingly disparate phenomena are all connected by a common trait shared by neurosporene and the likeliest possible 4-step C45 and 5-step C50 products: all have one ψ-end and one dihydro-ψ-end. This structural feature (see Figure 1.8) shared by all three disfavored products implies that E. uredovora CrtI has a strong propensity to avoid terminating its desaturation sequence at products with this combination of ends, regardless of the size of the carotenoid backbone substrate or the number of steps 153 required. Therefore, CrtI appears to regulate desaturation step number by sensing its substrate’s end groups, with particular preference for carotenoids with one ψ- and one dihydro-ψ-end, which are desaturated with high efficiency. The enzyme may accomplish this by having a higher affinity for substrates with these ends, but other strategies are possible. Whatever the specific mechanism, our results on C45 and C50 backbones clarify that the step number of this enzyme is significantly influenced by the size and end groups of its substrate. Thus, nature has apparently solved the problem of regulating carotenoid desaturation step number in at least two very different ways, as demonstrated by the distinct biochemical strategies employed by the phytoene desaturases of E. uredovora and P. blakesleeanus. These results also shed light on the functional plasticity displayed by bacterial carotenoid desaturases in directed evolution experiments aimed at altering desaturation step number (Chapter 1, refs. (46, 53, 58)). If a change in desaturation step number required a change in multimeric state, then converting a 4-step desaturase into a 6-step enzyme would require conversion of a tetrameric enzyme into a hexameric one. This would have to result from only a small number of mutations. While mutations can abolish the ability of a protein to form multimers, it seems much less plausible that the number of subunits in a complex could be so finely-tuned by minimal mutation. It is easier to envision how a desaturase’s catalytic rate or tendency to synthesize products with particular end groups could be modified by mutation. Therefore, the relative ease and high frequency with which desaturation mutants have been discovered by directed evolution of bacterial desaturases are more easily rationalized in the light of altered specificity rather than multimeric state. 154 Evidence of a novel asymmetric C40 carotenoid biosynthetic pathway We stated earlier that carotenoid 1 is likely the 2+0 desaturation product of an asymmetric C40 (C15+C25) carotenoid backbone, as shown in Figure 3.4. Although 1 has the same mass and chromophore size as ζ-carotene, it is unlikely that 1 is ζ-carotene with the hypsochromic shift in its spectrum resulting from Z-isomerization. The spectrum of 1 (Figure 3.6) shows the hallmarks of a majority all-E sample population: the cis peaks at 286 and 295 are low (~10% of λmax) and the ratio of the height of the longest-wavelength absorption band (419 nm) to the absorption at λmax (the so-called “III/II” ratio (9)) is 1.0. In fact, the spectrum shown for ζ-carotene in Figure 3.6 is that of a sample with more Zisomer content than 1. In that spectrum, III/II is only 0.83 (for all-trans ζ-carotene, III/II is between 1.0 and 1.028 (14, 15)). A 2+0 desaturation pattern also results in a hypsochromic shift of 5 nm, as shown by comparison of the spectrum of the 2+0 desaturation product of phytoene, 7,8,11,12tetrahydrolycopene with that of ζ-carotene, a 1+1 desaturated carotenoid (9, 14, 15, 51). However, although the absorption spectrum of 7,8,11,12-tetrahydrolycopene is strikingly similar to that of 1 (9, 14, 15, 51), it is also unlikely that carotenoid 1 is 7,8,11,12tetrahydrolycopene, because E. uredovora CrtI desaturates phytoene to lycopene via ζcarotene (Table 3.3, ref. (24)) and has not been shown to synthesize 7,8,11,12tetrahydrolycopene. Furthermore, a 2-step desaturation product of phytoene like ζcarotene or 7,8,11,12-tetrahydrolycopene is not expected to accumulate in a culture expressing E. uredovora CrtI. As mentioned previously, this enzyme desaturates all the available phytoene to lycopene and even 3,4,3',4'-tetradehydrolycopene in vivo, with no intermediates being detected. Indeed, in the same cultures in which 1 was found, 155 lycopene was also present and was usually at least twice as abundant; tetradehydrolycopene was also detected in smaller amounts (data not shown). Finally, the presence of a 2-step C40 carotenoid cannot be explained by a “phytoene overload” that overwhelms CrtI, for even in engineered E. coli that accumulate orders of magnitude more carotenoids than XL1-Blue, this desaturase is capable of efficiently converting the vastly increased phytoene supply to lycopene despite being expressed from a low-copy plasmid (20). The most reasonable conclusion from the above evidence is that carotenoid 1 has an asymmetric C40 (C15+C25) carbon backbone that has undergone two desaturation steps on its C15-side. Although we were unable to separate the asymmetric C40 backbone 16isopentenyl-4'-apophytoene from phytoene by HPLC of culture extracts of E. coli cultures expressing only BstFPSY81A and a mutant of CrtM (Figures 3.7 and 3.8), it is reasonable to expect that the former backbone is made by these cultures, whose additional synthesis of C35, C45, and C50 carotenoid backbones proves that both C15PP and C25PP are present in the cells. Furthermore, it is not surprising that CrtI would desaturate 16-isopentenyl-4'-apophytoene differently than phytoene. Although equal in size, the former is the most asymmetric of the six possible carotenoid backbones shown in Figure 3.1, and this likely affects the catalytic action of CrtI. When presented with the asymmetric C40 backbone, CrtI apparently catalyzes two desaturation steps on the C15side of the substrate (which is all that this side can accommodate) rather easily, but has trouble desaturating the C25-side of the molecule; therefore, product 1 accumulates. (This scenario seems more probable than 2 steps on the C25-side and none on the C15-side since CrtI can desaturate the C30 (C15+C15) backbone more efficiently than the C50 (C25+C25) 156 backbone (Table 3.3).) We are unsure why we did not detect any asymmetric C40 pathway products with longer chromophores than 1. Given that CrtI can desaturate C45 and C50 backbones, it is possible that some 4-6 step asymmetric C40 pathway products were made but were not distinguished from symmetric C40 carotenoids in our analysis, leaving only product 1 to stand out because of the lack of ζ-carotene produced. Because of this possibility, we could not quantify the relative proportions of symmetric and asymmetric C40 carotenoids made in the cultures. Potential utility of novel desaturated C45 and C50 carotenoids In this chapter, we report the biosynthesis of at least 14 new carotenoids based on unnatural carbon backbones. However, it remains to be seen whether any of these new products will prove technologically useful. Carotenoids are primarily sold for use as pigments, nutriceuticals, and as food and animal feed supplements (34). In some circumstances, a specific natural carotenoid is required, e.g., astaxanthin for salmon feed. However, in other current and envisioned applications such as antioxidant research and even microelectronics (11), “designer” molecules with specific properties not seen in natural carotenoids may prove extremely useful. The chromophore of a carotenoid is the primary determinant of its color and chemical properties (8, 61, 63). C45 and C50 carotenoid backbones can in principle accommodate chromophores of 17 and 19 conjugated carbon-carbon double bonds, respectively, which is longer than the 15 possible on a C40 backbone. Carotenoids with such large chromophores can absorb light at wavelengths above 600 nm, and their colors range from dark red to bluish purple (29, 35). Such carotenoids should be extremely reactive toward free radicals and could prove useful as potent antioxidants or colorants. 157 Although we did not generate carotenoids with more than 15 conjugated double bonds in this work, we have made progress toward this goal, and we believe that it will be possible to discover a desaturase in nature or to evolve one in the laboratory that can fully desaturate a C45 or C50 backbone. The insights we have gained about CrtI show that to evolve a 7- or 8-step desaturase will not require the discovery of extraordinarily rare mutants able to form heptamers or octamers, but merely variants with an altered preference for synthesizing carotenoids with fully desaturated end groups. Also, it may be possible to chemically desaturate 6-step C45 and C50 carotenoids even further (64), leading to carotenoids with chromophores of 17 or 19 conjugated double bonds. Desaturated C45 carotenoids 2, 3, 4, 5, and 6 (Figure 3.2) and desaturated C50 carotenoids 10, 11, 12, and 13 (Figure 3.3) reported in this work may be of interest for research purposes. Studies comparing the reactivity of these molecules toward free radicals in artificial lipid membranes could help researchers dissect the individual contributions of a carotenoid’s chromophore, polarity, and end groups in determining this reactivity. For example, it is expected that the novel C45 and C50 carotenoids produced in this work should orient themselves deep within the hydrophobic core of a lipid bilayer, and such orientation effects are believed to strongly influence the in vivo antioxidant properties of a carotenoid (63). Finally, it has been demonstrated that the presence of a single terminal hydroxy group in a carotenoid can dramatically improve its antioxidative properties (4). Therefore, the hydroxylation of carotenoid backbones we have observed in E. coli may be advantageous for the generation of monohydroxylated C45 and C50 carotenoids with desirable antioxidative abilities. Although we only observed hydroxylation of carotenoid 158 backbones in vivo, we showed that the hydroxylated C45 backbone could be desaturated in vitro, generating 1- and 2-step monohydroxy C45 structures 8 and 9. Our results showing increased desaturation step number in vivo compared with in vitro (cf. Tables 3.1 and 3.3) point to a promising strategy for generating hydroxylated C45 and C50 carotenoids with longer chromophores: co-transform cells harboring pUCmodII-crtMF26LbstFPSY81A or pUCmodII-crtMF26A,W38A-bstFPSY81A with another plasmid containing crtI under the control of a tightly-regulated promoter, and induce desaturase expression late in the culture. This approach would allow the cells to first accumulate monohydroxylated C45 and C50 backbones, which would then be desaturated in vivo upon desaturase expression. In nature, carotenoids are desaturated before they are hydroxylated. Therefore, it is interesting to note that this scheme could potentially produce highly desaturated monohydroxy C45 and C50 carotenoids with beneficial characteristics by an inverse biocatalytic route. Origins of in vivo-hydroxylated carotenoids We remain uncertain of the mechanism by which the carotenoid backbones are hydroxylated in vivo. Krubasik et al. observed some hydroxylation of the C50 flavuxanthin in recombinant E. coli cells (30) and C30 carotenoids synthesized in E. coli have also been reported to be hydroxylated by unknown processes (31, 40). Lee et al. postulated that their C30 diapocarotenoids were hydroxylated by free peroxy radicals present in E. coli membranes (31). Like us (56), they did not observe hydroxylation of C40 carotenoids in E. coli. Albrecht et al. reported a significant amount of epoxidation and hydroxylation of phytoene in cells of the green algae Scenedesmus acutus whose phytoene desaturase was inhibited by the herbicide norflurazon (2). Their report 159 suggested that the origins of the oxygenated phytoene derivatives might be enzymatic, but the oxidation was later attributed to reaction with free radicals (G. Sandmann, personal communication). As mentioned, XL1-Blue cultures harboring the plasmids pUC18m-bstFPSY81A and pAC-crtMF26A,W38A produced no hydroxylated backbones (Figure 3.8). These cultures also produced fewer total carotenoids than the single-plasmid cultures (see Figure 3.8 caption). This expression vector-dependency of carotenoid backbone hydroxylation suggests that E. coli cells selectively induce carotenoid oxidation only under certain conditions. Perhaps the lack of a lac operator in the pUCmodII-based plasmids and the resulting high-level constitutive expression of the carotenoid biosynthetic genes therein elicits this activation in E. coli. Plasmids pUC18m-bstFPSY81A and pAC-crtMF26A,W38A have their carotenogenic genes under the control of a lac promoter and operator, which should limit gene expression somewhat and possibly avoid the same response in the cells. Alternatively, the induction of carotenoid backbone hydroxylation might be triggered when the quantity of large carotenoid backbones in the cell membrane reaches a critical threshold. It is possible that, in response to excessive loss of membrane fluidity brought on by the accumulation of highly nonpolar C45 and C50 carotenoid backbones, the cells up-regulate an oxidase or radical-producing enzyme that helps to rectify this problem by effecting hydroxylation of the offending molecules, thereby increasing their polarity. Similarly, accumulation of these carotenoids may disrupt a portion of the respiratory electron transport chain only when their concentration reaches a certain value, causing electron leakage and the production of reactive oxygen species. These hypotheses, although attractive, are only weakly supported by the fact that the carotenoid titer of 160 XL1-Blue(pUCmodII-crtMF26L-bstFPSY81A) is a mere ~50% higher than that of XL1Blue(pUC18m-bstFPSY81A + pAC-crtMF26A,W38A) (see Figure 3.8 caption). Coexpressing CrtI along with BstFPSY81A and either CrtMF26L or CrtMF26A,W38A abolished almost all carotenoid backbone hydroxylation in the cells even though C50 backbones were quite abundant and accounted for ~50 mol% of total carotenoids. In these cultures, hydroxylated C50 backbones represented only ~1 mol% of the carotenoid pool. A possible reason for this is that free radicals preferentially react with and are quenched by desaturated carotenoids, whose extended chromophores are much more reactive toward radical species compared with undesaturated carotenoid backbones (17, 57, 61, 63). The above evidence points to radical oxygen species as the culprit in carotenoid backbone hydroxylation. However, the sharp, single HPLC peaks in Figure 3.7 suggest a high degree of regiospecificity of the hydroxylation reactions and therefore direct enzymatic oxidation. If multiple positions of these backbones were hydroxylated, as might be expected if the mechanism were chemical oxidation by reactive oxygen species, we should observe multiple clustered HPLC peaks, each corresponding to a different positional isomer of a hydroxylated backbone. (Different hydroxylated regioisomers should have much more distinct chromatographic properties than symmetric or asymmetric versions of a C40 backbone.) Indeed, an HPLC chromatogram showing multiple clustered peaks corresponding to different regioisomers of hydroxylated phytoene was generated by Albrecht et al. under chromatographic conditions similar to ours (2). On the other hand, the apparent regiospecific hydroxylation of our carotenoid backbones may result from their orientation in the cell membranes. For example, it is 161 possible that the backbones are positioned in such a manner that one end of the molecule protrudes from the membrane and consequently becomes prone to free-radical oxidation. Clearly, additional research will be required to uncover the origins of carotenoid backbone hydroxylation in E. coli. It would probably be simplest to first conduct in vitro investigations of the reactions of the various backbones with free radicals generated in situ in a manner similar to that described by Woodall et al. (61). If hydroxylated products from these reactions closely match those we have reported, this result would support the hypothesis that similar radical reactions are responsible for carotenoid hydroxylation in vivo. On the other hand, if the products are not a close match, and especially if multiple clustered peaks are observed under the same HPLC conditions, then the possibility of enzymatic hydroxylation might warrant further investigation. We anticipate, however, that the search for an enzyme responsible for these transformations would be a very challenging experiment. For one, screening of genomic libraries would be very difficult since this could not be done in E. coli, and selection of another host organism does not seem straightforward. However, the fact that carotenoid hydroxylation only occurs with certain strain and plasmid combinations suggests that microarray identification of differentially expressed genes might be fruitful. Properties of nascent biosynthetic pathways—lessons for biology and metabolic pathway engineering In addition to producing several novel carotenoids based on unnatural carbon scaffolds, this work has allowed us to investigate the precise biomolecular phenomena that resulted in the evolution of three novel biosynthetic pathways to carotenoid pigments. In this section, we analyze the specific mechanisms by which novel chemical diversity 162 was generated and propagated along these new pathways by their constituent enzymes. We then discuss key properties our pathways likely share with nascent biosynthetic pathways in general. The Y81A amino acid substitution in BstFPSY81A dramatically broadens the specificity of this enzyme, converting it from a strict C15PP synthase into an enzyme that synthesizes a mixture of C15PP, C20PP, and C25PP. This mutation has been studied in detail, and its effect on the enzyme’s product range has been shown to result from an enlarged product elongation pocket (37). The Y81A mutation transforms BstFPS into a “statistical” biocatalyst. Although capable of synthesizing products up to C25PP by catalyzing two additional condensations of IPP with the growing prenyl chain, BstFPSY81A also releases intermediates C15PP and C20PP; hence a distribution of prenyl diphosphate products with 3, 4, and 5 isoprene units is generated. The diversity of this product mixture is then amplified by the next enzyme in the pathway, a mutant of the S. aureus C30 carotenoid synthase CrtM. In Chapter 1, we discussed the molecular effects of mutations at F26 and W38 in CrtM. A homology model with human squalene synthase allowed us to map these residues to the site of the second half-reaction and led us to propose that their substitution with smaller amino acids increases the size of the cavity where cyclopropyl intermediates are rearranged into carotenoid backbones. From this analysis, we conjectured that wildtype CrtM could accept C20PP and even C25PP as substrates and form cyclopropyl intermediates from these precursors, but cannot rearrange intermediates larger than C35 into carotenoid backbones. When additional space is created in the rearrangement pocket by replacement of F26 and/or W38 with smaller amino acids, conversion of the larger 163 intermediates becomes possible, resulting in the synthesis of carotenoid backbones up to C50. Like BstFPSY81A, these CrtM mutants have lost much of their capacity to regulate the size of their products. When coexpressed with BstFPSY81A in vivo, the CrtM mutants condense every possible pairwise combination among C15PP, C20PP, and C25PP except, intriguingly, the wild-type’s combination of two molecules of C15PP (a consequence of the relatively low C15PP concentration combined with the intrinsically poor ability of the CrtM variants to make C30 carotenoids). The result is a mixture of C35, symmetric (C20+C20), and asymmetric (C15+C25) C40, C45, and C50 carotenoid backbone products. The desaturase CrtI then further diversifies the five carotenoid backbones generated by the two previous enzymes. CrtI possesses no mutations, but its inherent promiscuity allows it to accept all of the above backbones to some degree. In the C45 and C50 pathways, the step number of CrtI is not very well defined (except for the absence of certain products discussed above), and there was no clear majority desaturation product in these pathways in vivo (Table 3.1). Therefore, the stuttering action of CrtI on the C45 and C50 backbones is the primary catalytic basis for the branching of these new pathways. As previously discussed, CrtI very efficiently catalyzes four desaturation steps on its native substrate phytoene in vivo. Under less optimal in vitro conditions, however, substantial stuttering occurs with the same substrate, and all possible intermediates in the desaturation sequence are detected (Table 3.3). In the more favorable milieu of a cell membrane, however, CrtI can still be made to stutter when presented with unnaturally large carotenoid backbones. We do not know the exact reason for this, but expect it is due to a decreased catalytic efficiency on these substrates. CrtI also produces carotenoids with unusual desaturation patterns like 1, 11b, and 12b/c (Figures 3.3, 3.4, and 3.6; 164 Table 3.1), indicating that unnaturally large or asymmetric substrates can cause the enzyme to become slightly “confused” and carry out non-standard desaturation sequences. It is interesting that the unusual catalytic behavior that can result when an iterative enzyme is challenged with a new substrate can serve as a diversity-generating mechanism in the evolution of novel biosynthetic pathways. This work demonstrates the rapid product diversification that is possible when biosynthetic pathways are constructed from multiple broad-specificity enzymes arranged consecutively. Such arrangements were likely very common in the early evolution of metabolism. The widely accepted “patchwork” model states that the first metabolic pathways were assembled from promiscuous enzymes whose specificities were then narrowed by natural selection, yielding the relatively specific pathways we see in nature today, especially in so-called primary metabolism (27, 41, 62). Our laboratory-generated carotenoid biosynthetic pathways also probably share key features with recently evolved metabolic pathways in nature. Most notably, a lack of overall pathway specificity characterized by the generation of multiple products is a trait likely common to nascent pathways created both in nature and in the laboratory. Directed evolution experiments on a wide range of enzymes demonstrate that it is rare for enzymes to completely shift their substrate or product specificity after accumulating only a small number (1-2) of mutations. Rather, mutants with broadened specificity are the norm, even if the selection pressure of the experiment requires only one particular reaction to be catalyzed (1). In nature, enzymes that have recently evolved the ability to accept non-native substrates such as man-made antibiotics also tend to have broadened rather than shifted specificities, hence the emergence of so-called “extended-spectrum” beta-lactamases (13). Therefore, 165 new biosynthetic pathways (or pathway branches) that have emerged in nature as a result of enzyme mutation probably possess low product specificity, similar to our nascent carotenoid pathways, especially when multiple enzymes have been mutated. In many if not most cases, it remains to be seen how many more mutations would be required and how strong the selection pressures would have to be in order to convert newly emerged pathways into mature ones capable of specifically synthesizing a particular complex end product. Analysis of the means by which our novel carotenoid pathways have emerged also helps to clarify some aspects of a popular theory about the evolution of natural product biosynthetic pathways. The “screening hypothesis” put forth by Jones and Firn argues that natural product pathways have evolved under selection for particular traits, such as pathway branching and enzymatic promiscuity, because such traits promote the production and retention of product diversity at minimal cost (Chapter 1, refs. (21-23, 28)). However, our highly branched carotenoid pathways comprising laboratory-evolved promiscuous enzymes emerged despite a lack of selection for these properties. In no instance was selection for a diverse array of products applied in the laboratory evolution and subsequent site-directed mutagenesis experiments that resulted in the discovery of mutants BstFPSY81A, CrtMF26L, and CrtMF26A,W38A (37, 38, 54-56). Yet, in all these cases, as is typical in directed evolution (see previous paragraph), enzyme variants with broadened specificity were obtained. This implies that traits such as enzyme promiscuity and the types of pathway branching to which it can lead do not require selection to arise or be maintained, but merely represent the default state of enzymes and metabolic pathways in the absence of strong and sustained selective pressure to be highly specific. 166 Therefore, we believe that the low specificity of many natural product biosynthetic enzymes and pathways is not the outcome of positive selection for promiscuity, but is more aptly attributed to genetic drift caused by weak selection pressure for narrow specificity, or to selection pressures that change rapidly and hence do not allow sufficient evolutionary time for any particular narrow specificity to fully develop. Challenges for achieving new pathway specificity In the Results section, we described several unsuccessful experiments aimed at establishing more specific pathways in E. coli to particular novel-backboned carotenoids. For example, it should be possible to increase the proportion of C50 carotenoids by increasing the proportion of C25PP relative to C15PP and C20PP. If it were possible to drive the fraction of C25PP to nearly 100%, it would not be necessary to further evolve a carotenoid synthase for increased C50 product specificity because only one substrate would be available and therefore only the C50 carotenoid backbone would be possible. As mentioned earlier, C25PP is a very rare molecule in nature. Its only biological role found to date is as a precursor for the C25-C25 and C20-C25 ether-linked membrane lipids of some archaea such as Aeropyrum pernix and Natronomonas pharaonis (6, 49, 50). C25PP synthase enzymes are correspondingly very rare in nature, and only one such enzyme has been cloned to date: the farnesylgeranyl diphosphate synthase from Aeropyrum pernix, ApFGS (50). We cloned the apFGS gene from A. pernix genomic DNA, but found it inferior to BstFPSY81A for producing C25PP in E. coli cells. ApFGS actually behaved more like a C20PP synthase with peripheral C25PP synthase activity in our carotenogenic E. coli (Figure 3.10). 167 In their paper describing the first cloning of ApFGS, Tachibana et al. showed that the enzyme produces a mixture of C10PP to C25PP products, with C20PP being the most abundant, when supplied with the C5PP starter unit DMAPP and the C5PP extender unit IPP in vitro (50). (See Figure 1.4 for structures.) Only when supplied with C20PP did ApFGS exhibit specific C25PP synthase ability, but neither the rate nor the extent of the reaction was reported. The extensive production of C40 carotenoids in E. coli expressing ApFGS and CrtMF26A,W38A (Figure 3.10) appears to stem from the ability of the latter enzyme to incorporate C20PP into carotenoids faster than it can be readmitted to ApFGS for further prenyl chain elongation to C25PP. A similar effect likely occurs with BstFPSY81A. When supplied with C15PP and IPP in vitro, this enzyme synthesizes C25PP as the major product, with much smaller amounts of C20PP being detected (Figure 3.12 and ref. (37)). However, when BstFPSY81A is coexpressed with a CrtM variant in E. coli, significant amounts of C40 and C45 carotenoids are synthesized (Figure 3.8), indicating that C20PP is frequently released by BstFPSY81A in vivo. Production of C20PP by BstFPSY81A is more common in the elongation of the 5-carbon DMAPP (see below), a substrate also present in E. coli. Whereas in vitro, released C20PP is readily readmitted to BstFPSY81A and extended to C25PP (37), in the above cells, BstFPSY81A must compete with a CrtM variant for C20PP. Therefore, in E. coli cells also expressing CrtMF26L or CrtMF26A,W38A, much of the C20PP released by BstFPSY81A is instead used to synthesize C40 and C45 carotenoids. An important lesson from these observations is that the performance of an enzyme in vitro may not be representative of its performance as part of an in vivo biosynthetic pathway. 168 In the course of other work aimed at increasing the total quantity of carotenoids synthesized by our cultures, we overexpressed E. coli isopentenyl diphosphate isomerase (Idi) along with BstFPSY81A and a CrtM variant on plasmids (Figure 3.11). The isomerization of IPP to DMAPP is a rate-limiting step for the production of isoprenoids in E. coli (59). IPP is the basic isoprene unit synthesized by both the mevalonate and nonmevalonate pathways of isoprenoid biosynthesis in nature (7). However, IPP serves as an extender unit in prenyl chain elongation, and its isomer, DMAPP, which serves as the starter unit, is only synthesized by Idi-catalyzed isomerization of IPP (7). Overexpression of Idi increases carbon flux to DMAPP, which in turn increases flux through downstream isoprenoid biosynthetic pathways (59). When we transformed E. coli XL1-Blue cells with the plasmids pUC18mbstFPSY81A-idi and pAC-crtMF26A,W38A, the resulting liquid cultures did indeed synthesize about an order of magnitude more total carotenoids compared with XL1-Blue(pUC18mbstFPSY81A + pAC-crtMF26A,W38A) cultures (Figure 3.11 caption). However, the distribution of carotenoid backbones was also dramatically shifted toward the production of C40 carotenoids (Figure 3.11). This result can be rationalized by the “statistical” nature of BstFPSY81A and the increased level of DMAPP in cells overexpressing Idi. Fivecarbon DMAPP, the smallest isoprenyl diphosphate starter unit, is in addition to C15PP and C20PP, an acceptable substrate for BstFPSY81A (37). With the isoprenyl diphosphate pool of cells overexpressing Idi enriched in DMAPP, BstFPSY81A will admit this substrate more often. As a “statistical” iterative biocatalyst, BstFPSY81A tends to discharge shorter products on average when supplied with shorter substrates, and indeed, the enzyme frequently releases C20PP as it catalyzes prenyl chain elongation starting 169 from DMAPP (37). It follows that an increased level of DMAPP in the cells will result in increased production of C20PP by BstFPSY81A. Since the CrtM variants can condense a variety of prenyl diphosphates into different carotenoids, the larger proportion of C20PP in their substrate pool results in the observed shift toward the production of C40 carotenoids. This example illuminates the importance of the composition of the first enzyme’s substrate pool in determining the mixture of end-products of biosynthetic pathways composed of a succession of mutant enzymes with low substrate specificity. As stated previously, C50 carotenoids were only desaturated to a relatively small extent in vivo by CrtI, and unmetabolized C50 carotenoid backbones comprised approximately 50 mol% of the carotenoid pool in cultures of XL1-Blue(pUCmodIIcrtMF26A,W38A-crtI-bstFPSY81A). If we could evolve a desaturase to more efficiently convert C50 backbones, it might be possible to use colorimetric screening of bacterial colonies in order to further evolve either BstFPSY81A for more specific production of C25PP, or to evolve a CrtM variant for more specific synthesis of either C45 or C50 carotenoid backbones. Such a screen would require that a given desaturase variant could proficiently desaturate both C45 and C50 backbones, and also that the major desaturation product of each pathway be a different color. However, before we could attempt to evolve CrtI or another desaturase for improved performance on a C50 substrate, we encountered an unexpected roadblock. The first indication of this issue occurred when we noticed that E. coli colonies expressing BstFPSY81A, a CrtM variant, and CrtI from one or two plasmids reproducibly displayed a dramatically deeper red color than cell pellets from liquid cultures harboring the same plasmid(s). HPLC analysis revealed that the distribution of carotenoids in our recombinant E. coli colonies was shifted toward C40 170 products, with C50 and C45 carotenoids each representing less than 10% of total carotenoids (Figure 3.11). The similarity of this shift to that brought on by Idi overexpression in liquid cultures leads us to hypothesize that our E. coli cells grown in colonies on agar plates contain a higher proportion of DMAPP than cells harboring the same plasmids grown in liquid culture. As we have seen with Idi, such a difference in the relative proportions of C5-C25 prenyl diphosphates between the two physiological states would be sufficient to explain the different carotenoid distributions. However, we can only speculate on the origins of this putative difference in the isoprenyl diphosphate pools of cells cultivated in liquid medium versus those grown on agar plates. One of our early goals was to generate biosynthetic pathways to C60 carotenoids. When we formulated that objective, the C45 and C50 pathways had not yet been generated, and it was not known for certain which aspects of the C60 project would be the most problematic. Now, in retrospect, we have substantially more understanding of the experimental bottlenecks to expect. The first step of the pathway, generation of a C30PP precursor, has already been discovered by nature. Unlike C25PP, C30PP is found in bacteria, archaea, and eukaryotes, serving as a precursor to the side chain of quinones (26, 60). Isoprenyl diphosphate synthases that synthesize C30PP are therefore rather widespread in nature. The results of our work as well as that of Shimizu et al. with the C30PP synthase HexPS from M. luteus demonstrate that it is quite efficient and specific at converting C15PP to C30PP (Figure 3.12 and ref. (47)). Despite the ability of HexPS to supply C30PP in E. coli, enzymes capable of catalyzing C60 carotenoid backbone synthesis and desaturation remain undiscovered. We found that neither the C40 synthase CrtB nor CrtM mutants capable of C50 carotenoid 171 backbone synthesis could convert C30PP into a C60 backbone. Furthermore, screening for a carotenoid synthase variant capable of producing C60 backbones will likely not be a simple procedure. Our preferred screening method for evolving carotenoid biosynthetic enzymes, colorimetric screening of colonies, is probably not possible at present in a C60 pathway, since it cannot be assumed that any known carotenoid desaturase will impart pigmentation on a C60 backbone. We believe it is unlikely that any wild-type carotenoid desaturase would detectably desaturate a C60 substrate, since even processing of C50 backbones poses a great challenge to the broad-specificity desaturase CrtI. On the other hand, if a C60 carotenoid synthase were to be discovered first, screening for a desaturase variant capable of accepting C60 backbones should be relatively straightforward. Since C30PP is the only substrate available for carotenoid biosynthesis in E. coli expressing HexPS, C60 carotenoid backbones should be the only carotenoids possible in cells expressing HexPS and a C60 synthase. Therefore, screening E. coli colonies additionally transformed with a library of variant desaturases for the emergence of color should be a reliable method to search for desaturase variants capable of converting C60 backbones into pigmented C60 products. The production of hydroxylated carotenoid backbones we have reported in this work is an example of another type of hurdle to pathway specificity that can be encountered by metabolic pathway engineers. Although assembling and coexpressing a series of foreign biosynthetic genes in a heterologous host may look simple on paper, it is not possible to predict all the unwanted side reactions that might occur in the complex environment of a living cell. As we have shown, even E. coli, the most studied of all organisms, will carry out unexpected chemical modification of the products of foreign 172 biosynthetic genes it is forced to express. This is probably especially common when such products are harmful to the cell in some way and elicit poorly understood “emergency” responses. Therefore, given the current state of the art in the heterologous production of small molecules in microorganisms, the old adage, “expect the unexpected” is definitely sage advice. CONCLUSIONS The complexity and variety of small molecules in nature is a testament to the power of evolution to innovate and diversify. Our experiments on carotenoid biosynthetic enzymes and pathways represent an attempt to simultaneously harness and study these remarkable features of evolution. By capturing entire new pathways in the very earliest stages of their emergence, we have learned that new enzyme specificities are discovered rather easily upon mutation, and that new chemical diversity generated early in a pathway can be multiplied by downstream enzymes via many different chemical mechanisms. It is likely that our nascent pathways resemble their counterparts in nature in their rapid gain of access to a variety of new products upon very limited genetic change. However, the evolutionary “pruning” process by which the unwanted majority of a nascent pathway’s products are discarded in favor of a desired few remains unreproduced in the laboratory and, consequently, less well understood. Therefore, the generation of new pathways in the laboratory by directed evolution of biosynthetic enzymes, especially those located early in a pathway, remains primarily a tool for molecular discovery. It is hoped that future directed evolution experiments will shed light on how biosynthetic pathways shift their focus toward the synthesis of advantageous new products. If such research proves 173 fruitful, the exciting prospect of a commercial-scale whole-cell process for the specific production of a useful new molecule originally discovered in the laboratory by directed evolution may become a reality. MATERIALS AND METHODS Genes and plasmids Plasmid maps and sequences can be found in Appendix A. Genes are listed in transcriptional order in the names of all the plasmids in this report. Plasmids based on the high-copy pUCmodII vector (46, 54) are designated by names beginning with “pUCmodII.” The carotenoid biosynthetic genes on these plasmids are expressed as an operon under the control of a single lac promoter with no lac operator. In plasmids pUCmodII-crtMF26L-bstFPSY81A and pUCmodII-crtMF26A,W38A-bstFPSY81A, a variant of the C30 carotenoid synthase gene crtM from Staphylococcus aureus (crtMF26L or crtMF26A,W38A, respectively (54-56)) is flanked by XbaI and XhoI restriction sites. bstFPSY81A, which encodes the Y81A mutant of the farnesyl diphosphate synthase from Bacillus stearothermophilus (37, 54), is flanked by EcoRI and NcoI restriction sites and directly follows the crtM variant. Plasmids pUCmodII-crtMF26L-crtI-bstFPSY81A and pUCmodII-crtMF26A,W38A-crtI-bstFPSY81A additionally contain the gene encoding the carotenoid desaturase CrtI from Erwinia uredovora (current approved name: Pantoea ananatis), which is inserted between the crtM and bstFPS variants and is flanked by XhoI and EcoRI restriction sites. Plasmid pUCmodII-crtI, used to express E. uredovora CrtI alone for in vitro desaturation experiments, contains crtI flanked by EcoRI and NcoI restriction sites. 174 The genes on plasmids based on the high-copy vector pUC18m (56) are expressed as an operon under the control of a lac promoter and operator. Plasmid pUC18mbstFPSY81A contains the bstFPSY81A gene flanked by XbaI and XhoI restriction sites. Plasmid pUC18m-bstFPSY81A-idi additionally contains the idi gene encoding E. coli isopentenyl diphosphate isomerase, which is inserted between XhoI and ApaI restriction sites. Plasmid pUC18m-crtMF26A,W38A contains crtMF26A,W38A flanked by XbaI and XhoI sites. We cloned apFGS, the FGPP (C25PP) synthase gene from Aeropyrum pernix (50) from A. pernix genomic DNA (ATCC no. 700893D) by PCR. pUC18m-apFGS contains the apFGS gene flanked by NdeI and EcoRI sites. Plasmid pUC18m-apFGScrtMF26A,W38A additionally contains crtMF26A,W38A flanked by XbaI and XhoI sites. Plasmid pUC18m-hexPS contains the operon from Micrococcus luteus strain B-P 26 encoding the two polypeptide components of hexaprenyl diphosphate (C30PP) synthase (47). This operon, referred to as “hexPS,” is flanked by EcoRI and XbaI restriction sites. pUC18mhexPS-crtM-crtN additionally includes wild-type crtM flanked by XbaI and XhoI sites and crtN, the S. aureus C30 carotenoid desaturase gene, between XhoI and ApaI sites. In plasmid pUC18m-crtM-crtN, crtM and crtN are flanked by the same sites as in pUC18mhexPS-crtM-crtN. Plasmid pUC18m-hexPS-crtB-crtI has the same construction as pUC18m-hexPS-crtM-crtN but contains crtB, the C40 carotenoid synthase gene from E. uredovora, in place of crtM and crtI from the same bacterium in place of crtN. The plasmids pUC18m-hexPS-crtMF26L and pUC18m-hexPS-crtMF26A,W38A have the same construction as pUC18m-hexPS-crtM-crtN but lack crtN. pUC18m-hexPS-crtB is the same as pUC18m-hexPS-crtB-crtI but lacks crtI, while plasmid pUC18m-crtE-crtB-crtI 175 has the same construction as pUC18m-hexPS-crtB-crtI but has crtE, the gene encoding the GGPP (C20PP) synthase from E. uredovora, in place of hexPS. Plasmids based on the medium-copy vector pACmod (pACYC184 with the XbaI site removed) (46) were constructed by insertion of a fragment containing the entire operon from a pUC18m-based plasmid (including the lac promoter and operator) into pACmod. In plasmid pAC-crtMF26A,W38A, crtMF26A,W38A is inserted between XbaI and XhoI restriction sites. In pAC-crtMF26A,W38A-crtI, crtI from E. uredovora is also present and is flanked by XhoI and ApaI sites. Plasmid pAC-crtE contains crtE flanked by EcoRI and XbaI sites. In all plasmids listed above, an optimized Shine-Dalgarno ribosomal binding sequence (AGGAGG) followed by eight spacer nucleotides is situated directly upstream of each gene’s start codon. Even for the plasmids with lac operator sequences, leaky transcription was sufficient to effect the expression of carotenogenic genes. Therefore, all experiments described in this report were performed without IPTG (isopropyl-β-Dthiogalactopyranoside) induction. Bacterial cultures and carotenoid extraction E. coli XL1-Blue cells (Stratagene, La Jolla, CA) were transformed with plasmid DNA and plated on Luria-Bertani (LB)-agar plates supplemented with 50 mg/l of each appropriate antibiotic (carbenicillin for pUC-based plasmids, chloramphenicol for pACbased plasmids). Colonies were usually visible after 12 h at 37 °C, at which point 2-ml precultures of LB+antibiotics (50 mg/l each) were inoculated with single colonies and shaken at 37 °C and 250 rpm for 12-18 h. One milliliter of preculture was inoculated into 1 liter of Terrific broth (TB)+antibiotics (50 mg/l each) in a 2.8-liter Erlenmeyer flask. 176 One-liter cultures were shaken at 28 °C and 250 rpm for 48 h. Optical densities at 600 nm of 1-liter cultures (OD600nm) were measured after 10-fold dilution into fresh TB medium. Dry cell masses were determined from OD600nm values using a calibration curve generated for XL1-Blue cultures. Cells were pelleted by centrifugation at 2500 × g for 15 min. For accurate quantification of total carotenoid titers, a known amount of β,β-carotene (Fluka/Sigma, St. Louis, MO) was added to pellets as an internal standard before extraction. Cell lysis and initial carotenoid extraction was achieved by addition of 100 ml of acetone supplemented with 30 mg/l of 3,5-di-tert-butyl-4-hydroxytoluene (BHT; Sigma) followed by vigorous shaking. After this point, to avoid difficulties with mass spectrometry (MS), contact with plasticware was avoided and only glassware was used. After filtration and concentration to ~5 ml under a stream of N2, lipids including carotenoids were partitioned twice into 8 ml of hexanes and then concentrated to ~4 ml under a stream of N2. This extract was then washed 5 times with 2 ml of deionized water, dewatered with anhydrous MgSO4, filtered, and then evaporated to dryness under a stream of N2. After resuspension in 2 ml of acetone + BHT (30 mg/l), a significant amount of fatty material usually precipitated on the sides of the vial. The mixture was sonicated at 40 °C for 10-20 min. to dissolve carotenoids trapped by the precipitate and was then filtered and evaporated to dryness under a stream of N2. Dried extracts were stored under argon gas at -20 °C. Extracts were dissolved into 0.1-1 ml of acetonitrile prior to separation and analysis. For analysis of carotenoids synthesized by E. coli colonies, LB-agar plates were removed from 37 °C after colonies had formed (usually 12 h). The plates were incubated 177 at 25 °C for 48 h to promote carotenoid biosynthesis. Colonies were lifted onto white nitrocellulose membranes (Pall, Port Washington, NY) for imaging on a flatbed scanner. For extraction of carotenoids from colonies, TB medium was used to suspend the colonies, after which the mixture was centrifuged at 2500 × g for 15 min. After decanting the liquid, dry cell masses were determined from measured wet cell masses using a calibration curve generated for XL1-Blue cells. The same steps listed above for carotenoid extraction from liquid culture pellets were followed but all volumes were scaled by a factor of 0.2 due to the smaller cell pellets obtained from scraping colonies compared with pellets from liquid cultures. We generally found that ~0.5 g of wet cells was sufficient to obtain enough extract for HPLC analysis. Separation and analysis of carotenoids The above extracts dissolved in acetonitrile were injected into an Xterra MS C18 column (3.0 × 150 mm, 3.5-μm particle size; Waters, Milford, MA) outfitted with a guard cartridge (3.0 × 20 mm, identical particles) using an Alliance 2690 HPLC system (Waters) equipped with a photodiode array detector (PDA) set to 1.2-nm resolution. For isocratic elution, the mobile phase was acetonitrile:isopropanol 93:7 (by volume) and the flowrate was 0.4 ml/min. For more rapid elution of highly nonpolar C45 and C50 carotenoids, a gradient method with the same flowrate was employed: 0-35 min, acetonitrile:isopropanol 93:7; 35-37 min, linear gradient to acetonitrile:isopropanol 50:50; 37-50 min, acetonitrile:isopropanol 50:50. Carotenoids injected to HPLC were quantified by comparing their chromatogram peak areas (determined at the wavelength of maximum absorption for each carotenoid in the sample) to a calibration curve generated using known amounts of β,β-carotene and then multiplying by the ratio of molar 178 extinction coefficients (εβ,β-carotene/εsample carotenoid) (9). The calibration curve and internal standard peak areas enabled the calculation of scaling factors, which permitted the computation of total carotenoid titers from the HPLC data. Fractions of the HPLC eluent containing separated carotenoids were collected and evaporated to dryness under N2. Mass spectra of carotenoids were obtained using either an 1100 Series HPLC-PDA-MS system (Hewlett Packard/Agilent, Palo Alto, CA) equipped with an atmospheric pressure chemical ionization (APCI) interface or a Finnigan LCQ mass spectrometer equipped with an electrospray ionization (ESI) source (Thermo Electron, San Jose, CA). Previously separated carotenoids were resuspended in either hexanes (for APCI-MS) or methanol:dichloromethane 85:15 (by volume) (for ESIMS) and flow-injected into the mobile phase, which was the same as the solvent used to dissolve the sample. Carotenoids were identified and the putative structures of novel carotenoids were assigned based on their HPLC retention times, UV-visible spectra, and mass spectra. Acetylation of hydroxylated carotenoid backbones To confirm the presence of a hydroxy group on carotenoid backbones, the acetylation protocol suggested by Eugster (19) was followed with slight modification. Briefly, 5-10 nmol of a hydroxylated carotenoid backbone was dissolved in 0.5 ml of pyridine (dried over BaO powder). Fifty microliters of acetic anhydride was then added, and the reactions were carried out at room temperature for 1 h. The reactions were terminated by addition of 4 ml of deionized water, and carotenoids were extracted by partitioning twice with 1 ml of hexanes. After evaporation of the solvent under a stream of N2, the product mixture was analyzed and separated by HPLC as described above. The 179 separated product and unreacted fractions were dried under N2, resuspended in hexanes, and analyzed by APCI-MS as described above. In vitro desaturation of carotenoid backbones Cell lysate of E. coli cultures expressing CrtI was prepared for in vitro desaturation reactions as follows. 150-ml cultures of XL1-Blue(pUCmodII-crtI) were shaken in TB medium supplemented with carbenicillin (50 mg/l) at 28 °C and 113 rpm in upright 175 cm2 tissue culture flasks (BD Falcon, Bedford, MA) until they reached an OD600nm of 5-6 (~48 h). Cells were centrifuged at 2500 × g for 15 min., and each pellet from a 150-ml culture was resuspended in 20 ml of Tris-HCl buffer (50 mM, pH 8) containing 1 mM phenylmethylsulfonylfluoride (PMSF). Cells were lysed by French press, and the lysate was stored at -20 °C in 1-ml aliquots until use. Carotenoid backbone substrates for in vitro desaturation reactions were separated and purified as described above from cultures of XL1-Blue(pUCmodII-crtMF26LbstFPSY81A), XL1-Blue(pUCmodII-crtMF26A,W38A-bstFPSY81A), or XL1-Blue(pUC18mcrtE-crtB) (synthesizing authentic phytoene only (56)). After resuspension in a known amount of hexanes, carotenoid backbones were quantified by their absorbance at 286 nm using a Cary 100 Bio UV-visible spectrophotometer (Varian, Palo Alto, CA). For each in vitro desaturation reaction, 10 nmol of a carotenoid backbone was resuspended in 10 μl of acetone and added to a thawed 1-ml aliquot of XL1-Blue(pUCmodII-crtI) lysate supplemented with additional flavin adenine dinucleotide (FAD, 1mM) and MgCl2 (4 mM). Reaction mixtures were then incubated at 30 °C with gentle end-over-end rotation for 12-18 h. 180 To extract carotenoids from in vitro reactions for HPLC analysis, the reaction mixtures were centrifuged at 14,000 × g for 5 min. and the pellets were separated from the supernatants. Pellets were extracted with 1 ml of acetone + BHT (30 mg/l), thoroughly vortexed, and then filtered. Carotenoids were extracted from the aqueous supernatants by partitioning twice with 1 ml of hexanes. The hexane and acetone extracts of each reaction mixture were pooled and evaporated to dryness under a stream of N2. Carotenoids were then resuspended in 150 μl of acetonitrile and analyzed by HPLC as described above. Iodine-catalyzed photoisomerization To enrich mixtures of E- and Z-carotenoids in all-E (trans) isomers or verify the all-E configuration of specific carotenoids, individual carotenoids or culture extracts were subjected to iodine-catalyzed photoisomerization following the protocol suggested by Schiedt and Liaaen-Jensen (44). After photoisomerization, samples were analyzed by HPLC and changes in E/Z isomeric configuration were identified by the bathochromic (or hypsochromic) shifts in their absorption spectra and the intensity change of cis-peaks (9) compared with control samples not subjected to photoisomerization. Thin-layer chromatography and autoradiography analysis of isoprenyl diphosphate synthase reactions In vitro investigations of isoprenyl diphosphate synthase reactions were performed by Adam Hartwick as follows. E.coli XL1-Blue cells transformed with pUC18m-crtE, pUC18m-bstFPSY81A, or pUC18m-hexPS were cultured for 24 h in 100 ml of TB medium supplemented with carbenicillin (50 mg/l) at 37 °C in 500-ml Erlenmeyer 181 flasks shaken at 250 rpm for 24 h. Each culture was divided into 4 equal aliquots, which were centrifuged at 4 °C for 10 min. at 3000 × g. The cell pellets were stored at -80 °C. Pellets were thawed on ice and then resuspended in 5 ml of Tris-HCl buffer (25 mM, pH 8.5) supplemented with 1 mM EDTA and 10 mM 2-mercaptoethanol. The resuspended cells were lysed by microtip sonication and then centrifuged at 4500 × g for 20 min. The supernatants were stored in 250-μl aliquots at -80 °C until use. Enzyme reactions were carried out by mixing the following: 100 μl of reaction buffer (50 mM HEPES buffer, pH 8.2 supplemented with 40 mM MgCl2, 40 mM MnCl2, and 200 mM 2-mercaptoethanol), 100 μl of FPP (C15PP) buffer (100 μM FPP in 25 mM HEPES buffer, pH 8.2), 100 μl of 14C-IPP buffer (12 μM 14C-labeled IPP in 25 mM HEPES buffer, pH 8.2), and 100 μl of one of the above lysates. The reaction mixtures were shaken at 37 °C and 1000 rpm for 4 h. Radiolabeled isoprenyl diphosphate products were extracted from the reactions by addition of 200 μl of 1-butanol followed by vortexing and centrifugation at 14000 × g for 30 sec. The butanol epiphase was withdrawn and used directly in the subsequent dephosphorylation reaction by potato acid phosphatase (Sigma). The butanol extracts were combined with 400 μl of methanol, 100 μl of acetate buffer (1 M, pH 5.6), 100 μl of 1% (w/v) Triton X-100, and 200 μl of acid phosphatase buffer (44 units enzyme/ml in acetate buffer). The dephosphorylation reactions were then shaken at 37 °C and 1000 rpm for 24 h. Following dephosphorylation, 14C-labeled isoprenyl alcohols were extracted with 0.1 ml of n-pentane. After vortexing and centrifugation, the organic layer was removed by pipette. A portion of each pentane extract was spotted onto a C18 reverse-phase TLC 182 plate, which was developed with a mobile phase of acetone:water 9:1 (by volume). TLC plates were then exposed to a phosphor plate for ~24 h. Autoradiogram images were obtained by scanning the phosphor plates with a Typhoon Imager (Amersham). 183 Table 3.1. Properties of novel desaturated carotenoids synthesized by XL1Blue(pUCmodII-crtMF26A,W38A-crtI-bstFPSY81A) Backbone Conjugated double bonds Retention timea (min) Molecular ion (m/z)b Mol%c UV-visible spectrum (Fig. 3.6) and putative structure (Figs. 3.2-3.4) C40 7 19.2 540.2 5 1 C45 7 30.0 608.4 0.5 3 C45 9 28.5 606.2 1 4 C45 13 15.6, 16.4 602.0 4 5 C45 15 13.9 600.2 2 6 C50 7 42.0 676.2 2 10 C50 9 39.6, 40.4 674.2 5 11a C50 9 38.0 674.2 0.5 11b C50 11 35.9 672.3 3 12a C50 11 34.8 672.3 2 12b/c C50 15 20.3, 21.4 668.1 5 13 a. Using the column and gradient method described in Materials and Methods. Multiple times refer to E/Z isomers of the same carotenoid. b. Determined by electrospray mass spectrometry. Carotenoids underwent direct electrochemical oxidation to give the radical molecular cation [M⋅]+. c. Approximate, of all carotenoids detected in the culture extract by HPLC. Unmetabolized 16,16'-diisopentenylphytoene (C50 backbone) represented ~50 mol% of this population. 184 Table 3.2. Names of numbered carotenoid structures depicted in Figures 3.2-3.4 Structure number Trivial namea IUPAC-IUB semi-systematic name 1 16-isopentenyl-7,8,11,12tetrahydro-4'-apolycopene 16-(3-methylbut-2-enyl)-7,8,11,12tetrahydro-4'-apo-ψ,ψ-carotene 2a C45-phytofluene (9-13') 16-(3-methylbut-2-enyl)-7,8,7',8',11',12'hexahydro-ψ,ψ-carotene 2b C45-phytofluene (13-9') 16-(3-methylbut-2-enyl)-7,8,11,12,7',8'hexahydro-ψ,ψ-carotene 3 C45-ζ-carotene 4a C45-neurosporene (5-9') 16-(3-methylbut-2-enyl)-7,8,7',8'tetrahydro-ψ,ψ-carotene 16-(3-methylbut-2-enyl)-7',8'-dihydro-ψ,ψcarotene 4b C45-neurosporene (9-5') 5a C45-didehydrolycopene (1-5') 5b C45-didehydrolycopene (5-1') 6 C45-tetradehydrolycopene (1-1') 10 C50-ζ-carotene 11a C50-neurosporene (5-9') 11b C50-neurosporene (1-13') 12a C50-lycopene (5-5') 12b C50-lycopene (9-1') 12c C50-lycopene (13-3'') 13 C50-tetradehydrolycopene 16-(3-methylbut-2-enyl)-7,8-dihydro-ψ,ψcarotene 16-(3-methylbut-2-enyl)-3,4-didehydroψ,ψ-carotene 16-(3-methylbut-2-enyl)-3',4'-didehydroψ,ψ-carotene 16-(3-methylbut-2-enyl)-3,4,3',4'tetradehydro-ψ,ψ-carotene 16,16'-di-(3-methylbut-2-enyl)-7,8,7',8'tetrahydro-ψ,ψ-carotene 16,16'-di-(3-methylbut-2-enyl)-7,8dihydro-ψ,ψ-carotene 16,16'-di-(3-methylbut-2-enyl)-3,4didehydro-7',8',11',12'-tetrahydro-ψ,ψcarotene 16,16'-di-(3-methylbut-2-enyl)-ψ,ψcarotene 16,16'-di-(3-methylbut-2-enyl)-3,4didehydro-7',8'-dihydro-ψ,ψ-carotene 16-(3-methylbut-2-enylidene),16'-(3methylbut-2-enyl)-3,4-didehydro7',8',11',12'-dihydro-ψ,ψ-carotene 16,16'-di-(3-methylbut-2-enyl)-3,4,3',4'tetradehydro-ψ,ψ-carotene a. Numbers in brackets refer to the carbon atoms that mark the ends of the conjugated double-bond system. The double prime in the trivial name for carotenoid 12c refers to the numbering of the 3-methylbut-2-enylidene group on the right side of the molecule as shown in Figure 3.3. 185 Table 3.3. Results of in vitro desaturation experiments with XL1-Blue(pUCmodII-crtI) lysate on various carotenoid backbonesa Backbone Conversion (%) Desaturation products (mol% of product mixture) 1-step 2-step 3-step 4-step C30 1 28 41 9 22 phytoeneb 19 14 13c 7 66 C40-OHd 30 11 12 19 58 C45 5 71 [2]e 29 [3] – – C45-OH [7] 14 48 [8] 52 [9] – – C50 0 – – – – C50-OH [14] 0 – – – Numbers in square brackets refer to products shown in Figures 3.2 and 3.5. – a. Values represent the average of at least two independent experiments rounded to the closest percentage point. Coefficients of variation were less than 0.25. b. The native substrate of CrtI and positive control. Phytoene was purified from cultures of XL1-Blue(pUC18m-crtE-crtB) (56), which produces authentic phytoene only. c. Identified by its absorbance spectrum as ζ-carotene. d. Most likely predominantly OH-phytoene but may have contained some hydroxylated 16-isopentenyl-4'-apophytoene (asymmetric C40 backbone). e. This product was detected only from in vitro desaturation of 16-isopentenylphytoene (C45 backbone) and was not found in vivo. 186 Figure 3.1. Six carotenoid biosynthetic pathways from three prenyl diphosphate precursors. Only the C30 and symmetric C40 pathways synthesized from C15PP and C20PP, respectively, have been identified in nature. E. coli cells expressing BstFPSY81A synthesize the rare C25PP precursor FGPP, which can be incorporated into three unnatural carotenoid backbones—C45, C50 (54), and asymmetric C40—upon coexpression of one of a number of CrtM mutants with altered specificity, CrtMmut. Wild-type and variants of CrtM can also synthesize C35 carotenoids by fusion of C15PP and C20PP as reported previously (53, 56). Prenyl diphosphate precursors endogenous to E. coli are depicted in blue. Carotenoid backbones are depicted as the 15Z isomer synthesized by these bacterial carotenoid synthases. CrtB, phytoene synthase; IPP, isopentenyl diphosphate; FPP, farnesyl diphosphate; GGPP, geranylgeranyl diphosphate; FGPP, farnesylgeranyl diphosphate. 187 Figure 3.2. Desaturation in the C45 pathway. Simultaneous coexpression of BstFPSY81A, CrtMF26L or CrtMF26A,W38A (CrtMmut), and the carotenoid desaturase CrtI from E. uredovora resulted in the biosynthesis of desaturated C45 carotenoids with putative structures 3, 4, 5, and 6, reported for the first time in this work. Carotenoid 2 was only detected from in vitro desaturation of 16-isopentenylphytoene. Colored boxes highlighting carotenoid chromophores depict the approximate color of the molecule in white light. Double arrows signify two desaturation steps. Structure numbers (and letters for different desaturation isomers) are used throughout the text and other figures. Names for the numbered structures are listed in Table 3.2. Prenyl diphosphate precursors endogenous to E. coli are depicted in blue. IPP, isopentenyl diphosphate; FPP, farnesyl diphosphate; GGPP, geranylgeranyl diphosphate; FGPP, farnesylgeranyl diphosphate. 188 Figure 3.3 189 Figure 3.3. Desaturation in the C50 pathway. Simultaneous coexpression of BstFPSY81A, CrtMF26L or CrtMF26A,W38A (CrtMmut), and the carotenoid desaturase CrtI from E. uredovora resulted in the biosynthesis of desaturated C50 carotenoids with putative structures 10, 11, 12, and 13, reported for the first time in this work. Colored boxes highlighting carotenoid chromophores depict the approximate color of the molecule in white light. Double arrows signify two desaturation steps. Structure numbers (and letters for different desaturation isomers) are used throughout the text and other figures. Names for the numbered structures are listed in Table 3.2. Prenyl diphosphate precursors endogenous to E. coli are depicted in blue. IPP, isopentenyl diphosphate; FPP, farnesyl diphosphate; GGPP, geranylgeranyl diphosphate; FGPP, farnesylgeranyl diphosphate. 190 Figure 3.4 191 Figure 3.4. An asymmetric C40 pathway. Simultaneous coexpression of BstFPSY81A, CrtMF26L or CrtMF26A,W38A (CrtMmut), and the carotenoid desaturase CrtI from E. uredovora resulted in the biosynthesis of 2-step carotenoid 1, putatively the first carotenoid from the novel asymmetric C40 carotenoid biosynthetic pathway (blue shading) to be isolated. Several lines of evidence support the precise structure of 1 (named in Table 3.2) shown in the figure, including its biosynthesis via 2+0 desaturation of an asymmetric C40 carotenoid backbone formed by condensation of C15PP and C25PP (see Discussion). Symmetric C40 pathway carotenoids phytoene, phytofluene, ζ-carotene, neurosporene, and lycopene are shown for comparison; lycopene was also detected in the same cultures as 1. The structure of 7,8,11,12-tetrahydrolycopene, with the same 2+0 desaturation pattern as 1, is also shown for comparison. This carotenoid is not known to be made by E. uredovora CrtI (crossed-out arrow). Colored boxes highlighting carotenoid chromophores depict the approximate color of the molecule in white light. Prenyl diphosphate precursors endogenous to E. coli are depicted in blue. CrtB, phytoene synthase; IPP, isopentenyl diphosphate; FPP, farnesyl geranylgeranyl diphosphate; FGPP, farnesylgeranyl diphosphate. diphosphate; GGPP, 192 Figure 3.5 193 Figure 3.5. Hydroxylation and subsequent in vitro desaturation of carotenoid backbones. E. coli cells harboring plasmid pUCmodII-crtMF26L-bstFPSY81A or pUCmodII-crtMF26A,W38A-bstFPSY81A accumulate monohydroxylated phytoene as well as monohydroxylated C45 and C50 carotenoid backbones 7 and 14, respectively (Figures 3.73.9). Neither the mechanism nor the specific sites of hydroxylation are known. In vitro, E. uredovora CrtI catalyzes 4 desaturation steps on the hydroxylated C40 backbone, with each intermediate in the desaturation sequence being detected (Table 3.3). In vitro desaturation of the hydroxylated C45 backbone 7 yielded 1-step product 8 and 2-step product 9. The hydroxylated C50 backbone 14 was not detectably desaturated by CrtI in vitro (crossed-out arrow). CrtB, phytoene synthase; CrtMmut, mutant synthase CrtMF26L or CrtMF26A,W38A; IPP, isopentenyl diphosphate; FPP, farnesyl diphosphate; GGPP, geranylgeranyl diphosphate; FGPP, farnesylgeranyl diphosphate. 194 Figure 3.6 195 Figure 3.6. UV-visible absorption spectra of novel carotenoids biosynthesized by recombinant E. coli. Numeric labels refer to structures depicted in Figures 3.2-3.4; multiple letters indicate that the spectrum may be that of either or both structures. Spectra were measured by photodiode array directly after HPLC separation, with a mobile phase of acetonitrile:isopropanol 93:7 (by volume, see Materials and Methods). Spectra were taken before and after iodine-catalyzed photoisomerization; each spectrum shown is the most bathochromically shifted of the two. Absorption spectra of ζ-carotene, neurosporene, and lycopene generated by in vitro desaturation of authentic phytoene are shown for comparison (See Figure 3.4 for structures of these C40 carotenoids). Absorption maxima are labeled with the corresponding wavelength. Table 3.1 lists additional properties of these molecules; Table 3.2 lists their names. 196 Figure 3.7. HPLC trace of carotenoid backbones extracted from a culture of XL1Blue(pUCmodII-crtMF26L-bstFPSY81A). Carotenoids were eluted using the gradient method described in Materials and Methods. The identity of each peak was confirmed by MS; the presence of monohydroxy substituents was further confirmed by acetylation and subsequent MS (see Figure 3.9). The C40 and C40-OH peaks likely represent mixtures of symmetric and asymmetric C40 backbones that did not separate under these elution conditions. Labeled major peaks represent 15Z isomers; minor peaks eluting just after major peaks represent all-E isomers. Numbers in square brackets refer to products shown in Figure 3.5. 197 Figure 3.8. Relative molar quantities of the carotenoid backbones produced by recombinant XL1-Blue cultures expressing BstFPSY81A and a CrtM variant. Transformed plasmid(s) are shown on the horizontal axis. Bar heights represent the average of measurements of at least three independent cultures; error bars, standard deviations. Total carotenoid titers varied to a greater extent than relative molar quantities, approximate values were: pUCmodII-crtMF26L-bstFPSY81A, ~100 nmol/g dry cells; pUCmodII-crtMF26A,W38A-bstFPSY81A, ~300 nmol/g dry cells; pUC18m-bstFPSY81A + pAC-crtMF26A,W38A, ~70 nmol/g dry cells. ND, not detected. The C40 and C40-OH data series likely represent mixtures of symmetric and asymmetric C40 backbones that did not separate by the HPLC methods described in Materials and Methods. 198 Figure 3.9 199 Figure 3.9. APCI mass spectra of unmodified, hydroxylated, and acetylated carotenoid backbones. Unmodified carotenoid backbones ionize by protonation in APCI-MS, giving [M+H]+ quasimolecular ions (calculated monoisotopic masses for carotenoid backbones: C40, 544.5 Da; C45, 612.6 Da; C50, 680.6 Da). Hydroxylated carotenoid backbones ionize by protonation followed by loss of water, yielding an [(M+H)-H2O]+ ion (m/z = 543.9 for C40-OH, 611.5 for C45-OH, and 679.5 for C50-OH) in addition to the [M+H]+ quasimolecular ion (m/z = 561.5 for C40-OH, 629.5 for C45-OH, and 697.5 for C50-OH). Hydroxylated backbones were acetylated by reaction with acetic anhydride. Mass spectra of the acetylated products reveal a similar mode of ionization to their hydroxylated counterparts, yielding the [(M+H)-CH3COOH]+ ion (identical to the [(M+H)-H2O]+ ions listed above) in addition to the [M+H]+ quasimolecular ion (m/z = 603.9 for C40-OAc, 671.5 for C45-OAc, and 739.5 for C50-OAc). Numbers in square brackets refer to products shown in Figure 3.5. 200 Figure 3.10. Relative molar quantities of the carotenoid backbones produced by recombinant XL1-Blue cultures expressing ApFGS and CrtMF26A,W38A. Transformed plasmid(s) are shown on the horizontal axis. Bar heights represent the average of measurements on two independent cultures; error bars, standard deviations. Total carotenoid titers varied to a greater extent than relative molar quantities, approximate values were: pUC18m-crtMF26A,W38A, ~30 nmol/g dry cells; pUC18m-apFGScrtMF26A,W38A, ~100 nmol/g dry cells; pAC-crtE + pUC18m-apFGS-crtMF26A,W38A, ~300 nmol/g dry cells; pUC18m-apFGS + pAC-crtMF26A,W38A, ~100 nmol/g dry cells. ND, not detected. The relatively low proportion of C50 backbones in the cultures expressing ApFGS indicates a low C25PP supply in the cells. Therefore, ApFGS acts predominantly as a C20PP synthase under these conditions, and the C40 backbone population should thus consist almost exclusively of phytoene. 201 Figure 3.11 202 Figure 3.11. Idi overexpression and physiological state strongly influence the distribution of carotenoid backbones in recombinant XL1-Blue cells expressing BstFPSY81A and CrtMF26A,W38A. Transformed plasmid(s) and physiological state (liquid culture or colonies) are shown on the horizontal axis. For the first data set, which is repeated from Figure 3.8, bar heights represent the average of measurements on four replicate cultures. For the other sets, bar heights represent the average of measurements on two independent TB liquid cultures (second set) or on collected colonies from two independent LB-agar plates (third set). Total carotenoid titers varied to a greater extent than relative molar quantities, approximate values were: pUC18m-bstFPSY81A + pACcrtMF26A,W38A (liquid culture), ~70 nmol/g dry cells; pUC18m-bstFPSY81A-idi + pACcrtMF26A,W38A (liquid culture), ~700 nmol/g dry cells; pUC18m-bstFPSY81A + pACcrtMF26A,W38A (colonies), ~70 nmol/g dry cells. ND, not detected. The relatively low proportion of C50 backbones in the second and third data sets indicates a low C25PP supply in the cells; therefore, the C40 backbone population should consist predominantly of phytoene. 203 Figure 3.12 204 Figure 3.12. Product specificity of M. luteus hexaprenyl diphosphate synthase (HexPS). (a) Pigmentation of E. coli XL1-Blue colonies expressing different plasmids and imaged on white nitrocellulose: panel 1, pUC18m-crtM-crtN; panel 2, pUC18mhexPS-crtM-crtN; panel 3, pUC18m-crtE-crtB-crtI; panel 4, pUC18m-hexPS-crtB-crtI. (b) TLC-autoradiogram of the hydrolyzed products from in vitro reactions of FPP (C15PP) with 14C-labeled IPP catalyzed by various isoprenyl diphosphate synthases: lane 1, E. uredovora CrtE; lane 2, BstFPSY81A; lane 3, HexPS. Prenyl diphosphate products were hydrolyzed with acid phosphatase to the corresponding alcohol and then separated by reverse-phase TLC (see Materials and Methods). The direction of mobile phase flow was bottom to top. This autoradiogram was obtained by Adam Hartwick. 205 REFERENCES 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. Aharoni, A., L. Gaidukov, O. Khersonsky, Q. G. S. Mc, C. Roodveldt, and D. S. Tawfik. 2005. The 'evolvability' of promiscuous protein functions. Nat. Genet. 37:73-6. Albrecht, M., G. Sandmann, D. Musker, and G. Britton. 1991. Identification of epoxy- and hydroxyphytoene from norflurazon-treated Scenedesmus. J. Agric. Food Chem. 39:566-569. Albrecht, M., S. Takaichi, N. Misawa, G. Schnurr, P. Böger, and G. Sandmann. 1997. Synthesis of atypical cyclic and acyclic hydroxy carotenoids in Escherichia coli transformants. J. Biotechnol. 58:177-185. Albrecht, M., S. Takaichi, S. Steiger, Z. Y. Wang, and G. Sandmann. 2000. Novel hydroxycarotenoids with improved antioxidative properties produced by gene combination in Escherichia coli. Nat. Biotechnol. 18:843-846. Aragón, C. M., F. J. Murillo, M. D. de la Guardia, and E. Cerdá-Olmedo. 1976. An enzyme complex for the dehydrogenation of phytoene in Phycomyces. Eur. J. Biochem. 63:71-5. Boucher, Y., M. Kamekura, and W. F. Doolittle. 2004. Origins and evolution of isoprenoid lipid biosynthesis in archaea. Mol. Microbiol. 52:515-27. Britton, G. 1998. Overview of carotenoid biosynthesis, p. 13-147. In G. Britton, S. Liaaen-Jensen, and H. Pfander (ed.). Carotenoids, vol. 3: Biosynthesis and Metabolism. Birkhäuser Verlag, Basel. Britton, G. 1995. Structure and properties of carotenoids in relation to function. Faseb J. 9:1551-8. Britton, G. 1995. UV/Visible Spectroscopy, p. 13-62. In G. Britton, S. LiaaenJensen, and H. Pfander (ed.). Carotenoids, vol. 1B: Spectroscopy. Birkhäuser Verlag, Basel. Buckingham, J. 2004. Dictionary of Natural Products. Chapman & Hall/CRC Press. http://www.chemnetbase.com/scripts/dnpweb.exe. Burch, R. R., Y. Dong, C. Fincher, M. Goldfinger, and P. Rouviere. 2004. Electrical properties of polyunsaturated natural products: field effect mobility of carotenoid polyenes. Synth. Met. 146:43-46. Candau, R., E. R. Bejarano, and E. Cerdá-Olmedo. 1991. In vivo channeling of substrates in an enzyme aggregate for beta-carotene biosynthesis. Proc. Natl. Acad. Sci. U.S.A. 88:4936-40. Colodner, R. 2005. Extended-spectrum beta-lactamases: a challenge for clinical microbiologists and infection control specialists. Am. J. Infect. Control 33:104-7. Davies, B. H., C. J. Hallett, R. A. London, and A. F. Rees. 1974. The nature of "theta-carotene." Phytochemistry 13:1209-1217. Davis, J. B., L. M. Jackman, P. T. Siddons, and B. C. L. Weedon. 1966. Carotenoids and related compounds Part XV: The structure and synthesis of phytoene, phytofluene, zeta-carotene, and neurosporene. J. Chem. Soc. (C):21542165. 206 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. De la Guardia, M. D., C. M. Aragón, F. J. Murillo, and E. Cerdá-Olmedo. 1971. A carotenogenic enzyme aggregate in Phycomyces: evidence from quantitive complementation. Proc. Natl. Acad. Sci. U.S.A. 68:2012-5. Edge, R., D. J. McGarvey, and T. G. Truscott. 1997. The carotenoids as antioxidants—a review. J. Photochem. Photobiol. B. 41:189-200. Englert, G. 1995. NMR Spectroscopy, p. 147-260. In G. Britton, S. LiaaenJensen, and H. Pfander (ed.). Carotenoids, vol. 1B: Spectroscopy. Birkhäuser Verlag, Basel. Eugster, C. H. 1995. Chemical Derivatization: Microscale Tests for the Presence of Common Functional Groups in Carotenoids, p. 71-80. In G. Britton, S. LiaaenJensen, and H. Pfander (ed.). Carotenoids, vol. 1A: Isolation and Analysis. Birkhäuser Verlag, Basel. Farmer, W. R., and J. C. Liao. 2000. Improving lycopene production in Escherichia coli by engineering metabolic control. Nat. Biotechnol. 18:533-537. Firn, R. D., and C. G. Jones. 2000. The evolution of secondary metabolism—a unifying model. Mol. Microbiol. 37:989-994. Firn, R. D., and C. G. Jones. 1996. An explanation of secondary product "redundancy," p. 295-312. In J. T. Romeo, J. A. Saunders, and P. Barbosa (ed.), Recent Advances in Phytochemistry, vol. 30. Phytochemical Diversity and Redundancy in Ecological Interactions. Plenum Press, New York. Firn, R. D., and C. G. Jones. 2003. Natural products—a simple model to explain chemical diversity. Nat. Prod. Rep. 20:382-391. Fraser, P. D., N. Misawa, H. Linden, S. Yamano, K. Kobayashi, and G. Sandmann. 1992. Expression in Escherichia coli, purification, and reactivation of the recombinant Erwinia uredovora phytoene desaturase. J. Biol. Chem. 267:19891-19895. Hausmann, A., and G. Sandmann. 2000. A single five-step desaturase is involved in the carotenoid biosynthesis pathway to beta-carotene and torulene in Neurospora crassa. Fungal Genetics and Biology 30:147-153. Hemmi, H., S. Ikejiri, S. Yamashita, and T. Nishino. 2002. Novel mediumchain prenyl diphosphate synthase from the thermoacidophilic archaeon Sulfolobus solfataricus. J. Bacteriol. 184:615-20. Jensen, R. A. 1976. Enzyme recruitment in evolution of new function. Annu. Rev. Microbiol. 30:409-25. Jones, C. G., and R. D. Firn. 1991. On the evolution of plant secondary chemical diversity. Philos. Trans. R. Soc. Lond. Ser. B-Biol. Sci. 333:273-280. Karrer, P., and C. H. Eugster. 1951. Carotinoidsynthesen 8. Synthese des dodecapreno-beta-carotins. Helv. Chim. Acta 34:1805-1814. Krubasik, P., M. Kobayashi, and G. Sandmann. 2001. Expression and functional analysis of a gene cluster involved in the synthesis of decaprenoxanthin reveals the mechanisms for C50 carotenoid formation. Eur. J. Biochem. 268:37023708. Lee, P. C., A. Z. R. Momen, B. N. Mijts, and C. Schmidt-Dannert. 2003. Biosynthesis of structurally novel carotenoids in Escherichia coli. Chem. Biol. 10:453-462. 207 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. Liaaen-Jensen, S. 1995. Combined Approach: Identification and Structure Elucidation of Carotenoids, p. 343-354. In G. Britton, S. Liaaen-Jensen, and H. Pfander (ed.). Carotenoids, vol. 1B: Spectroscopy. Birkhäuser Verlag, Basel. Linden, H., N. Misawa, D. Chamovitz, I. Pecker, J. Hirschberg, and G. Sandmann. 1991. Functional complementation in Escherichia coli of different phytoene desaturase genes and analysis of accumulated carotenes. Z. Naturforsch. (C) 46:1045-1051. Lorenz, R. T., and G. R. Cysewski. 2000. Commercial potential for Haematococcus microalgae as a natural source of astaxanthin. Trends Biotechnol. 18:160-7. Mijts, B. N., P. C. Lee, and C. Schmidt-Dannert. 2005. Identification of a carotenoid oxygenase synthesizing acyclic xanthophylls: combinatorial biosynthesis and directed evolution. Chem. Biol. 12:453-60. Murillo, F. J., S. Torres-Martinez, C. M. Aragón, and E. Cerdá-Olmedo. 1981. Substrate transfer in carotene biosynthesis in Phycomyces. Eur. J. Biochem. 119:511-6. Ohnuma, S., K. Narita, T. Nakazawa, C. Ishida, Y. Takeuchi, C. Ohto, and T. Nishino. 1996. A role of the amino acid residue located on the fifth position before the first aspartate-rich motif of farnesyl diphosphate synthase on determination of the final product. J. Biol. Chem. 271:30748-30754. Ohnuma, S. I., T. Nakazawa, H. Hemmi, A. M. Hallberg, T. Koyama, K. Ogura, and T. Nishino. 1996. Conversion from farnesyl diphosphate synthase to geranylgeranyl diphosphate synthase by random chemical mutagenesis. J. Biol. Chem. 271:10087-10095. Raisig, A., G. Bartley, P. Scolnik, and G. Sandmann. 1996. Purification in an active state and properties of the 3-step phytoene desaturase from Rhodobacter capsulatus overexpressed in Escherichia coli. J. Biochem. (Tokyo) 119:559-64. Raisig, A., and G. Sandmann. 2001. Functional properties of diapophytoene and related desaturases of C30 and C40 carotenoid biosynthetic pathways. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 1533:164-170. Rison, S. C., and J. M. Thornton. 2002. Pathway evolution, structurally speaking. Curr. Opin. Struct. Biol. 12:374-82. Sandmann, G. 2002. Combinatorial biosynthesis of carotenoids in a heterologous host: A powerful approach for the biosynthesis of novel structures. ChemBioChem 3:629-635. Sandmann, G., M. Albrecht, G. Schnurr, O. Knorzer, and P. Boger. 1999. The biotechnological potential and design of novel carotenoids by gene combination in Escherichia coli. Trends Biotechnol. 17:233-237. Schiedt, K., and S. Liaaen-Jensen. 1995. Isolation and Analysis, p. 81-108. In G. Britton, S. Liaaen-Jensen, and H. Pfander (ed.). Carotenoids, vol. 1A: Isolation and Analysis. Birkhäuser Verlag, Basel. Schmidt-Dannert, C. 2000. Engineering novel carotenoids in microorganisms. Curr. Opin. Biotechnol. 11:255-261. Schmidt-Dannert, C., D. Umeno, and F. H. Arnold. 2000. Molecular breeding of carotenoid biosynthetic pathways. Nat. Biotechnol. 18:750-753. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 208 Shimizu, N., T. Koyama, and K. Ogura. 1998. Molecular cloning, expression, and characterization of the genes encoding the two essential protein components of Micrococcus luteus B-P 26 hexaprenyl diphosphate synthase. J. Bacteriol. 180:1578-81. Steiger, S., S. Takaichi, and G. Sandmann. 2002. Heterologous production of two unusual acyclic carotenoids, 1,1'-dihydroxy-3,4-didehydrolycopene and 1hydroxy-3,4,3',4'-tetradehydrolycopene by combination of the crtC and crtD genes from Rhodobacter and Rubrivivax. J. Biotechnol. 97:51-8. Tachibana, A. 1994. A novel prenyltransferase, farnesylgeranyl diphosphate synthase, from the haloalkaliphilic archaeon, Natronobacterium pharaonis. FEBS Lett. 341:291-4. Tachibana, A., Y. Yano, S. Otani, N. Nomura, Y. Sako, and M. Taniguchi. 2000. Novel prenyltransferase gene encoding farnesylgeranyl diphosphate synthase from a hyperthermophilic archaeon, Aeropyrum pernix: Molecular evolution with alteration in product specificity. Eur. J. Biochem. 267:321-8. Takaichi, S. 2000. Characterization of carotenes in a combination of a C18 HPLC column with isocratic elution and absorption spectra with a photodiode-array detector. Photosynth. Res. 65:93-99. Tao, L., A. Schenzle, J. M. Odom, and Q. Cheng. 2005. Novel carotenoid oxidase involved in biosynthesis of 4,4'-diapolycopene dialdehyde. Appl. Environ. Microbiol. 71:3294-301. Umeno, D., and F. H. Arnold. 2003. A C35 carotenoid biosynthetic pathway. Appl. Environ. Microbiol. 69:3573-3579. Umeno, D., and F. H. Arnold. 2004. Evolution of a pathway to novel long-chain carotenoids. J. Bacteriol. 186:1531-1536. Umeno, D., K. Hiraga, and F. H. Arnold. 2003. Method to protect a targeted amino acid residue during random mutagenesis. Nucleic Acids Res. 31:e91. Umeno, D., A. V. Tobias, and F. H. Arnold. 2002. Evolution of the C30 carotenoid synthase CrtM for function in a C40 pathway. J. Bacteriol. 184:66906699. Vershinin, A. 1999. Biological functions of carotenoids—diversity and evolution. Biofactors 10:99-104. Wang, C. W., and J. C. Liao. 2001. Alteration of product specificity of Rhodobacter sphaeroides phytoene desaturase by directed evolution. J. Biol. Chem. 276:41161-41164. Wang, C. W., M. K. Oh, and J. C. Liao. 1999. Engineered isoprenoid pathway enhances astaxanthin production in Escherichia coli. Biotechnol. Bioeng. 62:235241. Wang, K., and S. Ohnuma. 1999. Chain-length determination mechanism of isoprenyl diphosphate synthases and implications for molecular evolution. Trends Biochem. Sci. 24:445-451. Woodall, A. A., S. W. M. Lee, R. J. Weesie, M. J. Jackson, and G. Britton. 1997. Oxidation of carotenoids by free radicals: relationship between structure and reactivity. Biochim. Biophys. Acta-Gen. Subj. 1336:33-42. Ycas, M. 1974. On earlier states of the biochemical system. J. Theor. Biol. 44:145-60. 63. 64. 209 Young, A. J., and G. M. Lowe. 2001. Antioxidant and prooxidant properties of carotenoids. Arch. Biochem. Biophys. 385:20-7. Zechmeister, L., and B. K. Koe. 1954. Stepwise dehydrogenation of the colorless polyenes phytoene and phytofluene with N-bromosuccinimide to carotenoid pigments. J. Am. Chem. Soc. 76:2923-2926. 210 APPENDIX A Plasmid Sequences and Maps 211 Plasmid name pUC18m (empty vector); 2486 bp Construction The lacZ gene from pUC18 was cut out and replaced by a lac promoter/operator and the multi-cloning site: NdeI-EcoRI-XbaI-XhoI-ApaI-EheI/KasI. Plasmid map pUC18m sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacaCATATGGAATTCTCTAGACTCGAGGG GCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatc tgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggc atccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacg aaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatg tgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataata ttgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcaccca 212 gaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaa gatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattg acgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatc ttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaac gatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagct gaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcg aactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggccctt ccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggta agccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagatagg tgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaagga tctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaa gatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtt tgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtag ccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagt ggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttc gtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgctt cccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccaggg ggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcgg agcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatc ccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtc agtgagcgaggaagcggaaga 213 Plasmid name pUCmodII (empty vector); 2456 bp Construction Based on pUC19. The lac operator and multi cloning site from pUC19 were removed and replaced with multi cloning site: XbaI-SmaI-EcoRI-NcoI-NotI/EagI (see plasmid map below). Remarks High copy number (several hundred). Since the lac operator has been removed, the genes cloned into the MCS are expressed constitutively in E. coli. Plasmid map pUCmodII sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcgTCTAGAgcgCCCGGGGAATTCCCATGGGCGGCCGCtgcggtattttct ccttacgcatctgtgcggtatttcacaccgCATATGgtgcactctcagtacaatctgctctgatgccgcatagttaagccagc cccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtc tccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttat 214 aggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttct aaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattca acatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgct gaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaa cgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgc cgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaatt atgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccg cttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcg tgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaat taatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatct ggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacg acggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtca gaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatg accaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttct gcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttc cgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactct gtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttgga ctcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaac gacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtat ccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcg ggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcgg cctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcct ttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 215 Plasmid name pACmod (empty vector); 4245 bp; medium copy Construction Identical to commercially available pACYC184 except the XbaI site in that plasmid (TCTAGA) has been mutated to TCAAGA. Although this mutation is in the p15A origin of replication, the plasmid seems fine. Sequence landmarks Chloramphenicol resistance gene 3805-219 (reverse orientation); tetracycline resistance gene 1581-2771; p15A origin 581-1493 Plasmid map pACmod sequence gaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaa aaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccat tgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgc ccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccaggg cttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcg ggtgatgctgccaacttactgatttagtgtatgatggtgtttttgaggtgctccagtggcttctgtttctatcagctgtccctcctgttca gctactgacggggtggtgcgtaacggcaaaagcaccgccggacatcagcgctagcggagtgtatactggcttactatgttggc 216 actgatgagggtgtcagtgaagtgcttcatgtggcaggagaaaaaaggctgcaccggtgcgtcagcagaatatgtgatacagg atatattccgcttcctcgctcactgactcgctacgctcggtcgttcgactgcggcgagcggaaatggcttacgaacggggcgga gatttcctggaagatgccaggaagatacttaacagggaagtgagagggccgcggcaaagccgtttttccataggctccgcccc cctgacaagcatcacgaaatctgacgctcaaatcagtggtggcgaaacccgacaggactataaagataccaggcgtttccccct ggcggctccctcgtgcgctctcctgttcctgcctttcggtttaccggtgtcattccgctgttatggccgcgtttgtctcattccacgcc tgacactcagttccgggtaggcagttcgctccaagctggactgtatgcacgaaccccccgttcagtccgaccgctgcgccttatc cggtaactatcgtcttgagtccaacccggaaagacatgcaaaagcaccactggcagcagccactggtaattgatttagaggagtt agtcttgaagtcatgcgccggttaaggctaaactgaaaggacaagttttggtgactgcgctcctccaagccagttacctcggttca aagagttggtagctcagagaaccttcgaaaaaccgccctgcaaggcggttttttcgttttcagagcaagagattacgcgcagacc aaaacgatctcaagaagatcatcttattaatcagataaaatatttcaagatttcagtgcaatttatctcttcaaatgtagcacctgaagt cagccccatacgatataagttgtaattctcatgtttgacagcttatcATCGATaagctttaatgcggtagtttatcacagttaaatt gctaacgcagtcaggcaccgtgtatgaaatctaacaatgcgctcatcgtcatcctcggcaccgtcaccctggatgctgtaggcat aggcttggttatgccggtactgccgggcctcttgcgggatatcgtccattccgacagcatcgccagtcactatggcgtgctgcta gcgctatatgcgttgatgcaatttctatgcgcacccgttctcggagcactgtccgaccgctttggccgccgcccagtcctgctcgc ttcgctacttggagccactatcgactacgcgatcatggcgaccacacccgtcctgtGGATCCtctacgccggacgcatcgt ggccggcatcaccggcgccacaggtgcggttgctggcgcctatatcgccgacatcaccgatggggaagatcgggctcgcca cttcgggctcatgagcgcttgtttcggcgtgggtatggtggcaggccccgtggccgggggactgttgggcgccatctccttgcat gcaccattccttgcggcggcggtgctcaacggcctcaacctactactgggctgcttcctaatgcaggagtcgcataagggagag cGTCGACcgatgcccttgagagccttcaacccagtcagctccttccggtgggcgcggggcatgactatcgtcgccgcactt atgactgtcttctttatcatgcaactcgtaggacaggtgccggcagcgctctgggtcattttcggcgaggaccgctttcgctggag cgcgacgatgatcggcctgtcgcttgcggtattcggaatcttgcacgccctcgctcaagccttcgtcactggtcccgccaccaaa cgtttcggcgagaagcaggccattatcgccggcatggcggccgacgcgctgggctacgtcttgctggcgttcgcgacgcgag gctggatggccttccccattatgattcttctcgcttccggcggcatcgggatgcccgcgttgcaggccatgctgtccaggcaggt agatgacgaccatcagggacagcttcaaggatcgctcgcggctcttaccagcctaacttcgatcactggaccgctgatcgtcac ggcgatttatgccgcctcggcgagcacatggaacgggttggcatggattgtaggcgccgccctataccttgtctgcctccccgc gttgcgtcgcggtgcatggagccgggccacctcgacctgaatggaagccggcggcacctcgctaacggattcaccactccaa gaattggagccaatcaattcttgcggagaactgtgaatgcgcaaaccaacccttggcagaacatatccatcgcgtccgccatctc cagcagccgcacgcggcgcatctcgggcagcgttgggtcctggccacgggtgcgcatgatcgtgctcctgtcgttgaggacc cggctaggctggcggggttgccttactggttagcagaatgaatcaccgatacgcgagcgaacgtgaagcgactgctgctgcaa aacgtctgcgacctgagcaacaacatgaatggtcttcggtttccgtgtttcgtaaagtctggaaacgcggaagtcccctacgtgct gctgaagttgcccgcaacagagagtggaaccaaccggtgataccacgatactatgactgagagtcaacgccatgagcggcct catttcttattctgagttacaacagtccgcaccgctgtccggtagctccttccggtgggcgcggggcatgactatcgtcgccgcac ttatgactgtcttctttatcatgcaactcgtaggacaggtgccggcagcgcccaacagtcccccggccacggggcctgccaccat acccacgccgaaacaagcgccctgcaccattatgttccggatctgcatcgcaggatgctgctggctaccctgtggaacacctac atctgtattaacgaagcgctaaccgtttttatcaggctctgggaggcagaataaatgatcatatcgtcaattattacctccacgggg agagcctgagcaaactggcctcaggcatttgagaagcacacggtcacactgcttccggtagtcaataaaccggtaaaccagca atagacataagcggctatttaacgaccctgccctgaaccgacgaccgggtcgaatttgctttcgaatttctgccattcatccgcttat tatcacttattcaggcgtagcaccaggcgtttaagggcaccaataactgccttaaaaaaattacgccccgccctgccactcatcgc AGTACTgttgtaattcattaagcattctgccgacatggaagccatcacagacggcatgatgaacctgaatcgccagcggca tcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaa aactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcacc gtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcag tttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacg 217 Plasmid name pUC18m-crtE-crtB-crtI; 5807 bp Based on vector pUC18m. Construction All 3 genes are on a single operon, regulated by a single lac promoter and operator. Just upstream of each gene is an optimized Shine-Dalgarno site (AGGAGG) followed by 8 spacer nucleotides. The gene crtE from Erwinia uredovora, (GGPP synthase) is inserted between the EcoRI and XbaI sites. The gene crtB from Erwinia uredovora (C40 carotenoid synthase) is inserted between the XbaI and XhoI sites. The gene crtI from Erwinia uredovora (C40 carotenoid desaturase) is inserted between the XhoI and ApaI sites. Plasmid map pUC18m-crtE-crtB-crtI sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaa cgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca ggaaacaCATATGGAATTCaggaggattacaaaatgacggtctgcgcaaaaaaacacgttcatctcactcgcgatgctgcggagcagttactg gctgatattgatcgacgccttgatcagttattgcccgtggagggagaacgggatgttgtgggtgccgcgatgcgtgaaggtgcgctggcaccgggaaaac gtattcgccccatgttgctgttgctgaccgcccgcgatctgggttgcgctgtcagccatgacggattactggatttggcctgtgcggtggaaatggtccacgc ggcttcgctgatccttgacgatatgccctgcatggacgatgcgaagctgcggcgcggacgccctaccattcattctcattacggagagcatgtggcaatact ggcggcggttgccttgctgagtaaagcctttggcgtaattgccgatgcagatggcctcacgccgctggcaaaaaatcgggcggtttctgaactgtcaaacg ccatcggcatgcaaggattggttcagggtcagttcaaggatctgtctgaaggggataagccgcgcagcgctgaagctattttgatgacgaatcactttaaaa ccagcacgctgttttgtgcctccatgcagatggcctcgattgttgcgaatgcctccagcgaagcgcgtgattgcctgcatcgtttttcacttgatcttggtcagg 218 catttcaactgctggacgatttgaccgatggcatgaccgacaccggtaaggatagcaatcaggacgccggtaaatcgacgctggtcaatctgttaggcccg agggcggttgaagaacgtctgagacaacatcttcagcttgccagtgagcatctctctgcggcctgccaacacgggcacgccactcaacattttattcaggcc tggtttgacaaaaaactcgctgccgtcagttaaTCTAGAaggaggattacaaaatggcagttggctcgaaaagttttgcgacagcctcaaagttatttga tgcaaaaacccggcgcagcgtactgatgctctacgcctggtgccgccattgtgacgatgttattgacgatcagacgctgggctttcaggcccggcagcctg ccttacaaacgcccgaacaacgtctgatgcaacttgagatgaaaacgcgccaggcctatgcaggatcgcagatgcacgaaccggcgtttgcggcttttcag gaagtggctatggctcatgatatcgccccggcttacgcgtttgatcatctggaaggcttcgccatggatgtacgcgaagcgcaatacagccaactggatgat acgctgcgctattgctatcacgttgcaggcgttgtcggcttgatgatggcgcaaatcatgggcgtgcgggataacgccacgctggaccgcgcctgtgacctt gggctggcatttcagttgaccaatattgctcgcgatattgtggacgatgcgcatgcgggccgctgttatctgccggcaagctggctggagcatgaaggtctg aacaaagagaattatgcggcacctgaaaaccgtcaggcgctgagccgtatcgcccgtcgtttggtgcaggaagcagaaccttactatttgtctgccacagc cggcctggcagggttgcccctgcgttccgcctgggcaatcgctacggcgaagcaggtttaccggaaaataggtgtcaaagttgaacaggccggtcagca agcctgggatcagcggcagtcaacgaccacgcccgaaaaattaacgctgctgctggccgcctctggtcaggcccttacttcccggatgcgggctcatcct ccccgccctgcgcatctctggcagcgcccgctctagCTCGAGaggaggattacaaaatgaaaccaactacggtaattggtgcaggcttcggtggcct ggcactggcaattcgtctacaagctgcggggatccccgtcttactgcttgaacaacgtgataaacccggcggtcgggcttatgtctacgaggatcaggggtt tacctttgatgcaggcccgacggttatcaccgatcccagtgccattgaagaactgtttgcactggcaggaaaacagttaaaagagtatgtcgaactgctgcc ggttacgccgttttaccgcctgtgttgggagtcagggaaggtctttaattacgataacgatcaaacccggctcgaagcgcagattcagcagtttaatccccgc gatgtcgaaggttatcgtcagtttctggactattcacgcgcggtgtttaaagaaggctatctaaagctcggtactgtcccttttttatcgttcagagacatgcttcg cgccgcacctcaactggcgaaactgcaggcatggagaagcgtttacagtaaggttgccagttacatcgaagatgaacatctgcgccaggcgttttctttcca ctcgctgttggtgggcggcaatcccttcgccacctcatccatttatacgttgatacacgcgctggagcgtgagtggggcgtctggtttccgcgtggcggcac cggcgcattagttcaggggatgataaagctgtttcaggatctgggtggcgaagtcgtgttaaacgccagagtcagccatatggaaacgacaggaaacaag attgaagccgtgcatttagaggacggtcgcaggttcctgacgcaagccgtcgcgtcaaatgcagatgtggttcatacctatcgcgacctgttaagccagcac cctgccgcggttaagcagtccaacaaactgcagactaagcgcatgagtaactctctgtttgtgctctattttggtttgaatcaccatcatgatcagctcgcgcat cacacggtttgtttcggcccgcgttaccgcgagctgattgacgaaatttttaatcatgatggcctcgcagaggacttctcactttatctgcacgcgccctgtgtc acggattcgtcactggcgcctgaaggttgcggcagttactatgtgttggcgccggtgccAcatttaggcaccgcgaacctcgactggacggttgaggggc caaaactacgcgaccgtatttttgcgtaccttgagcagcattacatgcctggcttacggagtcagctggtcacgcaccggatgtttacgccgtttgattttcgcg accagcttaatgcctatcatggctcagccttttctgtggagcccgttcttacccagagcgcctggtttcggccgcataaccgcgataaaaccattactaatctct acctggtcggcgcaggcacgcatcccggcgcaggcattcctggcgtcatcggctcggcaaaagcgacagcaggtttgatgctggaggatctgatttgaG GGCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcat agttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgg gagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatgg tttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccct gataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcaccca gaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgc cccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatac actattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagt gataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgtt gggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaac tacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgct gataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggag tcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagat tgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagac cccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccg gatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaa gaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgat agttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacag cgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgaggga gcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctat ggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtatta ccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 219 Plasmid name pUC18m-crtE-crtM-crtI; 5781 bp Based on vector pUC18m Construction All 3 genes are on a single operon, regulated by a single lac promoter and operator. Just upstream of each gene is an optimized Shine-Dalgarno site (AGGAGG) followed by 8 spacer nucleotides. The gene crtE from Erwinia uredovora encoding a GGPP synthase is inserted between the EcoRI and XbaI sites. The gene crtM from Staphylococcus aureus encoding a C30 carotenoid synthase is inserted between the XbaI and XhoI sites. The gene crtI from Erwinia uredovora encoding a C40 carotenoid desaturase (4-step) is inserted between the XhoI and ApaI sites. Plasmid map pUC18m-crtE-crtM-crtI sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagt gagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagc ggataacaatttcacacaggaaacaCATATGGAATTCaggaggattacaaaatgacggtctgcgcaaaaaaacacgttcatctca ctcgcgatgctgcggagcagttactggctgatattgatcgacgccttgatcagttattgcccgtggagggagaacgggatgttgtgggtgccg cgatgcgtgaaggtgcgctggcaccgggaaaacgtattcgccccatgttgctgttgctgaccgcccgcgatctgggttgcgctgtcagccat gacggattactggatttggcctgtgcggtggaaatggtccacgcggcttcgctgatccttgacgatatgccctgcatggacgatgcgaagctg cggcgcggacgccctaccattcattctcattacggagagcatgtggcaatactggcggcggttgccttgctgagtaaagcctttggcgtaatt gccgatgcagatggcctcacgccgctggcaaaaaatcgggcggtttctgaactgtcaaacgccatcggcatgcaaggattggttcagggtc agttcaaggatctgtctgaaggggataagccgcgcagcgctgaagctattttgatgacgaatcactttaaaaccagcacgctgttttgtgcctc catgcagatggcctcgattgttgcgaatgcctccagcgaagcgcgtgattgcctgcatcgtttttcacttgatcttggtcaggcatttcaactgct ggacgatttgaccgatggcatgaccgacaccggtaaggatagcaatcaggacgccggtaaatcgacgctggtcaatctgttaggcccgag ggcggttgaagaacgtctgagacaacatcttcagcttgccagtgagcatctctctgcggcctgccaacacgggcacgccactcaacattttat 220 tcaggcctggtttgacaaaaaactcgctgccgtcagttaaTCTAGAaggaggattacaaaatgacaatgatgaatatgaattttaaatatt gtcataaaatcatgaagaaacattcaaaaagcttttcttacgcttttgacttgttaccagaagatcaaagaaaagcggtttgggcaatttatgctgt gtgtcgtaaaattgatgacagtatagatgtttatggcgatattcaatttttaaatcaaataaaagaagatatacaatctattgaaaaatacccatatg aacatcatcactttcaaagtgatcgtagaatcatgatggcgcttcagcatgttgcacaacataaaaatatcgcctttcaatctttttataatctcattg atactgtatataaagatcaacattttacaatgtttgaaacggacgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattg acgccgattttaagtgatcatgaaacacatcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgt cggtgaagattttgacaatgaacggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaa taatcattatattgacttatgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattgaagcac aaccaatcatagaattagcagcacgtatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtttttgtggata agaggaaaaaggcaaagttgtttcatgaaaataaatagtaaatatcatagaatatagCTCGAGaggaggattacaaaatgaaaccaact acggtaattggtgcaggcttcggtggcctggcactggcaattcgtctacaagctgcggggatccccgtcttactgcttgaacaacgtgataaa cccggcggtcgggcttatgtctacgaggatcaggggtttacctttgatgcaggcccgacggttatcaccgatcccagtgccattgaagaactg tttgcactggcaggaaaacagttaaaagagtatgtcgaactgctgccggttacgccgttttaccgcctgtgttgggagtcagggaaggtcttta attacgataacgatcaaacccggctcgaagcgcagattcagcagtttaatccccgcgatgtcgaaggttatcgtcagtttctggactattcacg cgcggtgtttaaagaaggctatctaaagctcggtactgtcccttttttatcgttcagagacatgcttcgcgccgcacctcaactggcgaaactgc aggcatggagaagcgtttacagtaaggttgccagttacatcgaagatgaacatctgcgccaggcgttttctttccactcgctgttggtgggcgg caatcccttcgccacctcatccatttatacgttgatacacgcgctggagcgtgagtggggcgtctggtttccgcgtggcggcaccggcgcatt agttcaggggatgataaagctgtttcaggatctgggtggcgaagtcgtgttaaacgccagagtcagccatatggaaacgacaggaaacaag attgaagccgtgcatttagaggacggtcgcaggttcctgacgcaagccgtcgcgtcaaatgcagatgtggttcatacctatcgcgacctgtta agccagcaccctgccgcggttaagcagtccaacaaactgcagactaagcgcatgagtaactctctgtttgtgctctattttggtttgaatcacca tcatgatcagctcgcgcatcacacggtttgtttcggcccgcgttaccgcgagctgattgacgaaatttttaatcatgatggcctcgcagaggact tctcactttatctgcacgcgccctgtgtcacggattcgtcactggcgcctgaaggttgcggcagttactatgtgttggcgccggtgccAcattt aggcaccgcgaacctcgactggacggttgaggggccaaaactacgcgaccgtatttttgcgtaccttgagcagcattacatgcctggcttac ggagtcagctggtcacgcaccggatgtttacgccgtttgattttcgcgaccagcttaatgcctatcatggctcagccttttctgtggagcccgttc ttacccagagcgcctggtttcggccgcataaccgcgataaaaccattactaatctctacctggtcggcgcaggcacgcatcccggcgcagg cattcctggcgtcatcggctcggcaaaagcgacagcaggtttgatgctggaggatctgatttgaGGGCCCGGCGCCtgatgcggt attttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccg acacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctg catgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataa tggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatga gacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcatttt gccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatct caacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatccc gtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatctta cggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggagga ccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaa cgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaac aattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagc cggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcag gcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatact ttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttcc actgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccg ctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtcc ttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgcc agtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgca cacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggaga aaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttata gtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcg gcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtg agctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 221 Plasmid name pUC18m-crtE-M8-crtI; 5781 bp Based on vector pUC18m Construction This plasmid is identical to pUC18m-crtE-crtM-crtI except in the place of wild-type crtM is M8, a mutant of the C30 carotenoid synthase crtM from Staphylococcus aureus that is capable of synthesizing C40 carotenoids. Plasmid map See pUC18m-crtE-crtM-crtI plasmid map. Mutations Point mutations in M8 (compared with wild-type crtM) are shown below in the plasmid sequence in bold, underlined capital letters and are summarized below (numbered according to their position in the crtM ORF; amino acid substitutions are listed in brackets). T78A (F26L) A345G (silent) pUC-crtE-M8-crtI sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacaCATATGGAATTCaggaggattacaaaatgacggtct gcgcaaaaaaacacgttcatctcactcgcgatgctgcggagcagttactggctgatattgatcgacgccttgatcagttattgccc gtggagggagaacgggatgttgtgggtgccgcgatgcgtgaaggtgcgctggcaccgggaaaacgtattcgccccatgttgct gttgctgaccgcccgcgatctgggttgcgctgtcagccatgacggattactggatttggcctgtgcggtggaaatggtccacgcg gcttcgctgatccttgacgatatgccctgcatggacgatgcgaagctgcggcgcggacgccctaccattcattctcattacggag agcatgtggcaatactggcggcggttgccttgctgagtaaagcctttggcgtaattgccgatgcagatggcctcacgccgctgg caaaaaatcgggcggtttctgaactgtcaaacgccatcggcatgcaaggattggttcagggtcagttcaaggatctgtctgaagg ggataagccgcgcagcgctgaagctattttgatgacgaatcactttaaaaccagcacgctgttttgtgcctccatgcagatggcct cgattgttgcgaatgcctccagcgaagcgcgtgattgcctgcatcgtttttcacttgatcttggtcaggcatttcaactgctggacga tttgaccgatggcatgaccgacaccggtaaggatagcaatcaggacgccggtaaatcgacgctggtcaatctgttaggcccga gggcggttgaagaacgtctgagacaacatcttcagcttgccagtgagcatctctctgcggcctgccaacacgggcacgccactc aacattttattcaggcctggtttgacaaaaaactcgctgccgtcagttaaTCTAGAaggaggattacaaaatgacaatgatga atatgaattttaaatattgtcataaaatcatgaagaaacattcaaaaagcttttcttacgctttAgacttgttaccagaagatcaaaga aaagcggtttgggcaatttatgctgtgtgtcgtaaaattgatgacagtatagatgtttatggcgatattcaatttttaaatcaaataaaa gaagatatacaatctattgaaaaatacccatatgaacatcatcactttcaaagtgatcgtagaatcatgatggcgcttcagcatgttg cacaacataaaaatatcgcctttcaatctttttataatctcattgatactgtatataaagatcaGcattttacaatgtttgaaacggacg ctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattgacgccgattttaagtgatcatgaaacacatcagaca tacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgtcggtgaagattttgacaatgaacggatat attttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaataatcattatattgacttatggg aatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattgaagcacaaccaatcataga attagcagcacgtatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtttttgtggataagag gaaaaaggcaaagttgtttcatgaaaataaatagtaaatatcatagaatatagCTCGAGaggaggattacaaaatgaaacca actacggtaattggtgcaggcttcggtggcctggcactggcaattcgtctacaagctgcggggatccccgtcttactgcttgaaca 222 acgtgataaacccggcggtcgggcttatgtctacgaggatcaggggtttacctttgatgcaggcccgacggttatcaccgatccc agtgccattgaagaactgtttgcactggcaggaaaacagttaaaagagtatgtcgaactgctgccggttacgccgttttaccgcct gtgttgggagtcagggaaggtctttaattacgataacgatcaaacccggctcgaagcgcagattcagcagtttaatccccgcgat gtcgaaggttatcgtcagtttctggactattcacgcgcggtgtttaaagaaggctatctaaagctcggtactgtcccttttttatcgttc agagacatgcttcgcgccgcacctcaactggcgaaactgcaggcatggagaagcgtttacagtaaggttgccagttacatcgaa gatgaacatctgcgccaggcgttttctttccactcgctgttggtgggcggcaatcccttcgccacctcatccatttatacgttgatac acgcgctggagcgtgagtggggcgtctggtttccgcgtggcggcaccggcgcattagttcaggggatgataaagctgtttcag gatctgggtggcgaagtcgtgttaaacgccagagtcagccatatggaaacgacaggaaacaagattgaagccgtgcatttaga ggacggtcgcaggttcctgacgcaagccgtcgcgtcaaatgcagatgtggttcatacctatcgcgacctgttaagccagcaccc tgccgcggttaagcagtccaacaaactgcagactaagcgcatgagtaactctctgtttgtgctctattttggtttgaatcaccatcat gatcagctcgcgcatcacacggtttgtttcggcccgcgttaccgcgagctgattgacgaaatttttaatcatgatggcctcgcaga ggacttctcactttatctgcacgcgccctgtgtcacggattcgtcactggcgcctgaaggttgcggcagttactatgtgttggcgcc ggtgccAcatttaggcaccgcgaacctcgactggacggttgaggggccaaaactacgcgaccgtatttttgcgtaccttgagca gcattacatgcctggcttacggagtcagctggtcacgcaccggatgtttacgccgtttgattttcgcgaccagcttaatgcctatcat ggctcagccttttctgtggagcccgttcttacccagagcgcctggtttcggccgcataaccgcgataaaaccattactaatctctac ctggtcggcgcaggcacgcatcccggcgcaggcattcctggcgtcatcggctcggcaaaagcgacagcaggtttgatgctgg aggatctgatttgaGGGCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatgg tgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacg ggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcac cgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtg gcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccct gataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgcct tcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactgg atctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgc ggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccag tcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggcca acttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgt tgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgca aactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccactt ctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcact ggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacaga tcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcattt ttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcaga ccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctacc agcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactg tccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagt ggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggct gaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgaga aagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagg gagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgt caggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttc tttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccga gcgcagcgagtcagtgagcgaggaagcggaaga 223 Plasmid name pUC18m-crtE-M9-crtI; 5781 bp Based on vector pUC18m Construction This plasmid is identical to pUC18m-crtE-crtM-crtI except in the place of wild-type crtM is M9, a mutant of the C30 carotenoid synthase crtM from Staphylococcus aureus that is capable of synthesizing C40 carotenoids. Plasmid map See pUC18m-crtE-crtM-crtI plasmid map. Mutations Point mutations in M9 (compared with wild-type crtM) are shown below in the plasmid sequence in bold, underlined capital letters and are summarized below (numbered according to their position in the crtM ORF; amino acid substitutions are listed in brackets). T77C (F26S) T119C (I40T) T135C (silent) T141C (silent) A850G (after stop codon) pUC-crtE-M9-crtI sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacaCATATGGAATTCaggaggattacaaaatgacggtct gcgcaaaaaaacacgttcatctcactcgcgatgctgcggagcagttactggctgatattgatcgacgccttgatcagttattgccc gtggagggagaacgggatgttgtgggtgccgcgatgcgtgaaggtgcgctggcaccgggaaaacgtattcgccccatgttgct gttgctgaccgcccgcgatctgggttgcgctgtcagccatgacggattactggatttggcctgtgcggtggaaatggtccacgcg gcttcgctgatccttgacgatatgccctgcatggacgatgcgaagctgcggcgcggacgccctaccattcattctcattacggag agcatgtggcaatactggcggcggttgccttgctgagtaaagcctttggcgtaattgccgatgcagatggcctcacgccgctgg caaaaaatcgggcggtttctgaactgtcaaacgccatcggcatgcaaggattggttcagggtcagttcaaggatctgtctgaagg ggataagccgcgcagcgctgaagctattttgatgacgaatcactttaaaaccagcacgctgttttgtgcctccatgcagatggcct cgattgttgcgaatgcctccagcgaagcgcgtgattgcctgcatcgtttttcacttgatcttggtcaggcatttcaactgctggacga tttgaccgatggcatgaccgacaccggtaaggatagcaatcaggacgccggtaaatcgacgctggtcaatctgttaggcccga gggcggttgaagaacgtctgagacaacatcttcagcttgccagtgagcatctctctgcggcctgccaacacgggcacgccactc aacattttattcaggcctggtttgacaaaaaactcgctgccgtcagttaaTCTAGAaggaggattacaaaatgacaatgatga atatgaattttaaatattgtcataaaatcatgaagaaacattcaaaaagcttttcttacgcttCtgacttgttaccagaagatcaaaga aaagcggtttgggcaaCttatgctgtgtgtcgCaaaatCgatgacagtatagatgtttatggcgatattcaatttttaaatcaaata aaagaagatatacaatctattgaaaaatacccatatgaacatcatcactttcaaagtgatcgtagaatcatgatggcgcttcagcat gttgcacaacataaaaatatcgcctttcaatctttttataatctcattgatactgtatataaagatcaacattttacaatgtttgaaacgga cgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattgacgccgattttaagtgatcatgaaacacatcag acatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgtcggtgaagattttgacaatgaacgg atatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaataatcattatattgacttat gggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattgaagcacaaccaatcat 224 agaattagcagcacgtatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtttttgtggataa gaggaaaaaggcaaagttgtttcatgaaaataaatagtaaGtatcatagaatatagCTCGAGaggaggattacaaaatgaa accaactacggtaattggtgcaggcttcggtggcctggcactggcaattcgtctacaagctgcggggatccccgtcttactgcttg aacaacgtgataaacccggcggtcgggcttatgtctacgaggatcaggggtttacctttgatgcaggcccgacggttatcaccg atcccagtgccattgaagaactgtttgcactggcaggaaaacagttaaaagagtatgtcgaactgctgccggttacgccgttttac cgcctgtgttgggagtcagggaaggtctttaattacgataacgatcaaacccggctcgaagcgcagattcagcagtttaatcccc gcgatgtcgaaggttatcgtcagtttctggactattcacgcgcggtgtttaaagaaggctatctaaagctcggtactgtccctttttta tcgttcagagacatgcttcgcgccgcacctcaactggcgaaactgcaggcatggagaagcgtttacagtaaggttgccagttac atcgaagatgaacatctgcgccaggcgttttctttccactcgctgttggtgggcggcaatcccttcgccacctcatccatttatacgt tgatacacgcgctggagcgtgagtggggcgtctggtttccgcgtggcggcaccggcgcattagttcaggggatgataaagctg tttcaggatctgggtggcgaagtcgtgttaaacgccagagtcagccatatggaaacgacaggaaacaagattgaagccgtgcat ttagaggacggtcgcaggttcctgacgcaagccgtcgcgtcaaatgcagatgtggttcatacctatcgcgacctgttaagccagc accctgccgcggttaagcagtccaacaaactgcagactaagcgcatgagtaactctctgtttgtgctctattttggtttgaatcacca tcatgatcagctcgcgcatcacacggtttgtttcggcccgcgttaccgcgagctgattgacgaaatttttaatcatgatggcctcgc agaggacttctcactttatctgcacgcgccctgtgtcacggattcgtcactggcgcctgaaggttgcggcagttactatgtgttggc gccggtgccAcatttaggcaccgcgaacctcgactggacggttgaggggccaaaactacgcgaccgtatttttgcgtaccttga gcagcattacatgcctggcttacggagtcagctggtcacgcaccggatgtttacgccgtttgattttcgcgaccagcttaatgccta tcatggctcagccttttctgtggagcccgttcttacccagagcgcctggtttcggccgcataaccgcgataaaaccattactaatct ctacctggtcggcgcaggcacgcatcccggcgcaggcattcctggcgtcatcggctcggcaaaagcgacagcaggtttgatg ctggaggatctgatttgaGGGCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatat atggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctg acgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcat caccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcag gtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataac cctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttg ccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaac tggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtgg cgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcac cagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcgg ccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgat cgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgc gcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggacc acttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcag cactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaataga cagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaactt catttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgt cagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgc taccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaat actgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttac cagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcg ggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctat gagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcac gagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatg ctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcaca tgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgac cgagcgcagcgagtcagtgagcgaggaagcggaaga 225 Plasmid name pUC18m-crtE-M10-crtI; 5781 bp Based on vector pUC18m Construction This plasmid is identical to pUC18m-crtE-crtM-crtI except in the place of wild-type crtM is M10, a mutant of the C30 carotenoid synthase crtM from Staphylococcus aureus that is capable of synthesizing C40 carotenoids. Plasmid map See pUC18m-crtE-crtM-crtI plasmid map. Mutations Point mutations in M10 (compared with wild-type crtM) are shown below in the plasmid sequence in bold, underlined capital letters and are summarized below (numbered according to their position in the crtM ORF; amino acid substitutions are listed in brackets). A10G (M4V) A35G (H12R) A39G (silent) T176C (F59S) A242G (Q81R) A539G (E180G) pUC-crtE-M10-crtI sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcggg cagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgga attgtgagcggataacaatttcacacaggaaacaCATATGGAATTCaggaggattacaaaatgacggtctgcgcaaaaaa acacgttcatctcactcgcgatgctgcggagcagttactggctgatattgatcgacgccttgatcagttattgcccgtggagggagaac gggatgttgtgggtgccgcgatgcgtgaaggtgcgctggcaccgggaaaacgtattcgccccatgttgctgttgctgaccgcccgcg atctgggttgcgctgtcagccatgacggattactggatttggcctgtgcggtggaaatggtccacgcggcttcgctgatccttgacgata tgccctgcatggacgatgcgaagctgcggcgcggacgccctaccattcattctcattacggagagcatgtggcaatactggcggcgg ttgccttgctgagtaaagcctttggcgtaattgccgatgcagatggcctcacgccgctggcaaaaaatcgggcggtttctgaactgtca aacgccatcggcatgcaaggattggttcagggtcagttcaaggatctgtctgaaggggataagccgcgcagcgctgaagctattttga tgacgaatcactttaaaaccagcacgctgttttgtgcctccatgcagatggcctcgattgttgcgaatgcctccagcgaagcgcgtgatt gcctgcatcgtttttcacttgatcttggtcaggcatttcaactgctggacgatttgaccgatggcatgaccgacaccggtaaggatagca atcaggacgccggtaaatcgacgctggtcaatctgttaggcccgagggcggttgaagaacgtctgagacaacatcttcagcttgcca gtgagcatctctctgcggcctgccaacacgggcacgccactcaacattttattcaggcctggtttgacaaaaaactcgctgccgtcagtt aaTCTAGAaggaggattacaaaatgacaatgGtgaatatgaattttaaatattgtcGtaaGatcatgaagaaacattcaaaaagc ttttcttacgcttttgacttgttaccagaagatcaaagaaaagcggtttgggcaatttatgctgtgtgtcgtaaaattgatgacagtatagatg tttatggcgatattcaatCtttaaatcaaataaaagaagatatacaatctattgaaaaatacccatatgaacatcatcactttcGaagtgat cgtagaatcatgatggcgcttcagcatgttgcacaacataaaaatatcgcctttcaatctttttataatctcattgatactgtatataaagatc aacattttacaatgtttgaaacggacgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattgacgccgattttaa gtgatcatgaaacacatcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgtcggtgaag attttgacaatgGacggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaataat cattatattgacttatgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattgaagca caaccaatcatagaattagcagcacgtatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtttttgt 226 ggataagaggaaaaaggcaaagttgtttcatgaaaataaatagtaaatatcatagaatatagCTCGAGaggaggattacaaaatg aaaccaactacggtaattggtgcaggcttcggtggcctggcactggcaattcgtctacaagctgcggggatccccgtcttactgcttga acaacgtgataaacccggcggtcgggcttatgtctacgaggatcaggggtttacctttgatgcaggcccgacggttatcaccgatccc agtgccattgaagaactgtttgcactggcaggaaaacagttaaaagagtatgtcgaactgctgccggttacgccgttttaccgcctgtgt tgggagtcagggaaggtctttaattacgataacgatcaaacccggctcgaagcgcagattcagcagtttaatccccgcgatgtcgaag gttatcgtcagtttctggactattcacgcgcggtgtttaaagaaggctatctaaagctcggtactgtcccttttttatcgttcagagacatgct tcgcgccgcacctcaactggcgaaactgcaggcatggagaagcgtttacagtaaggttgccagttacatcgaagatgaacatctgcg ccaggcgttttctttccactcgctgttggtgggcggcaatcccttcgccacctcatccatttatacgttgatacacgcgctggagcgtgag tggggcgtctggtttccgcgtggcggcaccggcgcattagttcaggggatgataaagctgtttcaggatctgggtggcgaagtcgtgtt aaacgccagagtcagccatatggaaacgacaggaaacaagattgaagccgtgcatttagaggacggtcgcaggttcctgacgcaag ccgtcgcgtcaaatgcagatgtggttcatacctatcgcgacctgttaagccagcaccctgccgcggttaagcagtccaacaaactgca gactaagcgcatgagtaactctctgtttgtgctctattttggtttgaatcaccatcatgatcagctcgcgcatcacacggtttgtttcggccc gcgttaccgcgagctgattgacgaaatttttaatcatgatggcctcgcagaggacttctcactttatctgcacgcgccctgtgtcacggat tcgtcactggcgcctgaaggttgcggcagttactatgtgttggcgccggtgccAcatttaggcaccgcgaacctcgactggacggttg aggggccaaaactacgcgaccgtatttttgcgtaccttgagcagcattacatgcctggcttacggagtcagctggtcacgcaccggat gtttacgccgtttgattttcgcgaccagcttaatgcctatcatggctcagccttttctgtggagcccgttcttacccagagcgcctggtttcg gccgcataaccgcgataaaaccattactaatctctacctggtcggcgcaggcacgcatcccggcgcaggcattcctggcgtcatcgg ctcggcaaaagcgacagcaggtttgatgctggaggatctgatttgaGGGCCCGGCGCCtgatgcggtattttctccttacgca tctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgcca acacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtc agaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggt ttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatg agacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcg gcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcg aactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtgg cgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccag tcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaactta cttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaacc ggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactgg cgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttc cggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagcc ctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactg attaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatc ctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttg agatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctacca actctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaaga actctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttgg actcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgac ctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggta agcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgcca cctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcct ggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgatacc gctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 227 Plasmid name pUC18m-crtM-crtN; 4901 bp Based on vector pUC18m Construction crtM, encoding the C30 carotenoid synthase from Staphylococcus aureus is inserted between the XbaI and XhoI sites. crtN, also from S. aureus, encoding a C30 carotenoid desaturase, is inserted between the XhoI and ApaI sites. Just upstream of each ORF is an optimized Shine-Dalgarno site (AGGAGG) followed by 8 spacer nucleotides. A single lac operator/promoter site regulates the entire operon, as shown in the plasmid map. Plasmid map pUC18m-crtM-crtN sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcggg cagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgga attgtgagcggataacaatttcacacaggaaacaCATATGGAATTCTCTAGAaggaggattacaaaatgacaatgat gAatatgaattttaaatattgtcataaaatcatgaagaaacattcaaaaagcttttcttacgcttttgacttgttaccagaagatcaaagaaa agcggtttgggcaatttatgctgtgtgtcgtaaaattgatgacagtatagatgtttatggcgatattcaatttttaaAtcaaataaaagaaga tatacaatctattgaaaaatacccatatgaacatcatcactttcaaagtgatcgtagaatcatgatggcgcttcagcatgttgcacaacata aaaatatcgcctttcaatctttttataatctcattgatactgtatataaagatcaacattttacaatgtttgaaacggacgctgaattattcggat 228 attgttatggtgttgctggtacagtaggtgaagtattgacgccgattttaagtgatcatgaaacacatcagacatacgatgtcgcaagaag acttggtgaatcgttgcaattgattaatatattaagagatgtcggtgaagattttgacaatgaacggatatattttagtaagcaacgattaaa gcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaataatcattatattgacttatgggaatattatgcagctatcgcagaaaa agattttcaagatgttatggatcaaatcaaagtatttagtattgaagcacaaccaatcatagaattagcagcacgtatatatattgaaatact ggacgaagtgagacaggctaactatacattacatgaacgtgtttttgtggataagaggaaaaaggcaaagttgtttcatgaaaAtaaat agtaaatatcatagaatatagCTCGAGaggaggattacaaaatgaagattgcagtaattggtgcaggtgtcacaggattagcagc ggcagcccgtattgcttctcaaggtcatgaagtgacgatatttgaaaaaaataataatgtaggcgggcgtatgaatcaattaaagaaag acggctttacatttgatatgggtcccacaattgtcatgatgccagatgtttataaagatgtttttacagcgtgtggtaaaaattatgaagatta tattgaattgagacaattacgttatatttacgatgtgtattttgaccacgatgatcgtataacggtgcctacagatttagctgaattacagcaa atgctagaaagtatagaacctggttcaacgcatggttttatgtcctttttaacggatgtttataaaaaatatgaaattgcacgtcgctatttctt agaaagaacgtatcgcaaaccgagtgacttttataatatgacgtcacttgtgcaaggtgctaagttaaaaacgttaaatcatgcagatca gctaattgaacattatattgataacgaaaagatacaaaagcttttagcgtttcaaacgttatacataggaattgatccaaaacgaggcccg tcactatattcaattattcctatgattgaaatgatgtttggtgtgcattttattaaaggcggtatgtatggcatggctcaagggctagcgcaat taaataaagacttaggcgttaatattgaactaaatgctgaaattgagcaaattattattgatcctaaattcaaacgggccgatgcgataaaa gtgaatggtgacataagaaaatttgataaaattttatgtacggctgatttccctagtgttgcggaatcattaatgccagattttgcacctatta aaaagtatccaccacataaaattgcagacttagattactcttgttcagcatttttaatgtatatcggtatagatattgatgtgacagatcaagt gagacttcataatgttattttttcagatgactttagaggcaatattgaagaaatatttgagggacgtttatcatatgatccttctatttatgtgtat gtaccagcggtcgctgataaatcacttgcgccagaaggcaaaactggtatttatgtgctaatgccgacgccggaacttaaaacaggta gcggaatcgattggtcagatgaagctttgacgcaacaaataaaggaaattatttatcgtaaattagcaacgattgaagtatttgaagatat aaaatcgcatattgtttcagaaacaatctttacgccaaatgattttgagcaaacgtatcatgcgaaatttggttcggcattcggtttaatgcc aactttagcgcaaagtaattattatcgtccacaaaatgtatcgcgagattataaagatttatattttgcaggtgcaagtacgcatccaggtg caggcgttcctattgtcttaacgagtgcgaaaataactgtagatgaaatgattaaagatattgagcggggcgtataagggagtagtctaa GGGCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatc tgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatcc gcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggc ctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacc cctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaaga gtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagta aaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccga agaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcg ccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatg cagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgc acaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacg atgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatg gaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtg ggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactat ggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttag attgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttcc actgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaacc accgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaa atactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttacca gtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctga acggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcg ccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttcca gggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcgg agcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccct gattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagc gaggaagcggaaga 229 Plasmid name pUC18m-M8-crtN; 4901 bp Based on vector pUC18m Construction This plasmid is identical to pUC18m-crtM-crtN except in the place of wild-type crtM is M8, a mutant of the C30 carotenoid synthase crtM from Staphylococcus aureus that is capable of synthesizing C40 carotenoids. Plasmid Map See pUC18m-crtM-crtN plasmid map. Mutations Point mutations in M8 (compared with wild-type crtM) are shown below in the plasmid sequence in bold, underlined capital letters and are summarized below (numbered according to their position in the crtM ORF; amino acid substitutions are listed in brackets). T78A (F26L) A345G (silent) pUC18m-M8-crtN sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacacatatgGAATTCTCTAGAaggaggattacaaaatga caatgatgaatatgaattttaaatattgtcataaaatcatgaagaaacattcaaaaagcttttcttacgctttAgacttgttaccagaag atcaaagaaaagcggtttgggcaatttatgctgtgtgtcgtaaaattgatgacagtatagatgtttatggcgatattcaatttttaaatc aaataaaagaagatatacaatctattgaaaaatacccatatgaacatcatcactttcaaagtgatcgtagaatcatgatggcgcttca gcatgttgcacaacataaaaatatcgcctttcaatctttttataatctcattgatactgtatataaagatcaGcattttacaatgtttgaa acggacgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattgacgccgattttaagtgatcatgaaacac atcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgtcggtgaagattttgacaatga acggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaataatcattatattga cttatgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattgaagcacaacca atcatagaattagcagcacgtatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtttttgtgg ataagaggaaaaaggcaaagttgtttcatgaaaataaatagtaaatatcatagaatatagCTCGAGaggaggattacaaaat gaagattgcagtaattggtgcaggtgtcacaggattagcagcggcagcccgtattgcttctcaaggtcatgaagtgacgatatttg aaaaaaataataatgtaggcgggcgtatgaatcaattaaagaaagacggctttacatttgatatgggtcccacaattgtcatgatgc cagatgtttataaagatgtttttacagcgtgtggtaaaaattatgaagattatattgaattgagacaattacgttatatttacgatgtgtat tttgaccacgatgatcgtataacggtgcctacagatttagctgaattacagcaaatgctagaaagtatagaacctggttcaacgcat ggttttatgtcctttttaacggatgtttataaaaaatatgaaattgcacgtcgctatttcttagaaagaacgtatcgcaaaccgagtgac ttttataatatgacgtcacttgtgcaaggtgctaagttaaaaacgttaaatcatgcagatcagctaattgaacattatattgataacga aaagatacaaaagcttttagcgtttcaaacgttatacataggaattgatccaaaacgaggcccgtcactatattcaattattcctatga ttgaaatgatgtttggtgtgcattttattaaaggcggtatgtatggcatggctcaagggctagcgcaattaaataaagacttaggcgt taatattgaactaaatgctgaaattgagcaaattattattgatcctaaattcaaacgggccgatgcgataaaagtgaatggtgacata agaaaatttgataaaattttatgtacggctgatttccctagtgttgcggaatcattaatgccagattttgcacctattaaaaagtatcca ccacataaaattgcagacttagattactcttgttcagcatttttaatgtatatcggtatagatattgatgtgacagatcaagtgagactt cataatgttattttttcagatgactttagaggcaatattgaagaaatatttgagggacgtttatcatatgatccttctatttatgtgtatgta 230 ccagcggtcgctgataaatcacttgcgccagaaggcaaaactggtatttatgtgctaatgccgacgccggaacttaaaacaggta gcggaatcgattggtcagatgaagctttgacgcaacaaataaaggaaattatttatcgtaaattagcaacgattgaagtatttgaag atataaaatcgcatattgtttcagaaacaatctttacgccaaatgattttgagcaaacgtatcatgcgaaatttggttcggcattcggtt taatgccaactttagcgcaaagtaattattatcgtccacaaaatgtatcgcgagattataaagatttatattttgcaggtgcaagtacg catccaggtgcaggcgttcctattgtcttaacgagtgcgaaaataactgtagatgaaatgattaaagatattgagcggggcgtata agggagtagtctaaGGGCCCggcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtg cactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacggg cttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccg aaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggc acttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctga taaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttc ctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggat ctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcg gtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagt cacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaa cttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgtt gggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgca aactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccactt ctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcact ggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacaga tcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcattt ttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcaga ccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctacc agcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactg tccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagt ggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggct gaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgaga aagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagg gagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgt caggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttc tttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccga gcgcagcgagtcagtgagcgaggaagcggaaga 231 Plasmid name pUC18m-M9-crtN; 4901 bp Based on vector pUC18m Construction This plasmid is identical to pUC18m-crtM-crtN except in the place of wild-type crtM is M9, a mutant of the C30 carotenoid synthase crtM from Staphylococcus aureus that is capable of synthesizing C40 carotenoids. Plasmid Map See pUC18m-crtM-crtN plasmid map. Mutations Point mutations in M9 (compared with wild-type crtM) are shown below in the plasmid sequence in bold, underlined capital letters and are summarized below (numbered according to their position in the crtM ORF; amino acid substitutions are listed in brackets). T77C (F26S) T119C (I40T) T135C (silent) T141C (silent) A850G (after stop codon) pUC18m-M9-crtN sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacacatatgGAATTCTCTAGAaggaggattacaaaatga caatgatgaatatgaattttaaatattgtcataaaatcatgaagaaacattcaaaaagcttttcttacgcttCtgacttgttaccagaag atcaaagaaaagcggtttgggcaaCttatgctgtgtgtcgCaaaatCgatgacagtatagatgtttatggcgatattcaatttttaa atcaaataaaagaagatatacaatctattgaaaaatacccatatgaacatcatcactttcaaagtgatcgtagaatcatgatggcgct tcagcatgttgcacaacataaaaatatcgcctttcaatctttttataatctcattgatactgtatataaagatcaacattttacaatgtttg aaacggacgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattgacgccgattttaagtgatcatgaaac acatcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgtcggtgaagattttgacaat gaacggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaataatcattatatt gacttatgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattgaagcacaac caatcatagaattagcagcacgtatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtttttgt ggataagaggaaaaaggcaaagttgtttcatgaaaataaatagtaaGtatcatagaatatagCTCGAGaggaggattacaa aatgaagattgcagtaattggtgcaggtgtcacaggattagcagcggcagcccgtattgcttctcaaggtcatgaagtgacgatat ttgaaaaaaataataatgtaggcgggcgtatgaatcaattaaagaaagacggctttacatttgatatgggtcccacaattgtcatga tgccagatgtttataaagatgtttttacagcgtgtggtaaaaattatgaagattatattgaattgagacaattacgttatatttacgatgt gtattttgaccacgatgatcgtataacggtgcctacagatttagctgaattacagcaaatgctagaaagtatagaacctggttcaac gcatggttttatgtcctttttaacggatgtttataaaaaatatgaaattgcacgtcgctatttcttagaaagaacgtatcgcaaaccgag tgacttttataatatgacgtcacttgtgcaaggtgctaagttaaaaacgttaaatcatgcagatcagctaattgaacattatattgataa cgaaaagatacaaaagcttttagcgtttcaaacgttatacataggaattgatccaaaacgaggcccgtcactatattcaattattcct atgattgaaatgatgtttggtgtgcattttattaaaggcggtatgtatggcatggctcaagggctagcgcaattaaataaagacttag gcgttaatattgaactaaatgctgaaattgagcaaattattattgatcctaaattcaaacgggccgatgcgataaaagtgaatggtg 232 acataagaaaatttgataaaattttatgtacggctgatttccctagtgttgcggaatcattaatgccagattttgcacctattaaaaagt atccaccacataaaattgcagacttagattactcttgttcagcatttttaatgtatatcggtatagatattgatgtgacagatcaagtga gacttcataatgttattttttcagatgactttagaggcaatattgaagaaatatttgagggacgtttatcatatgatccttctatttatgtgt atgtaccagcggtcgctgataaatcacttgcgccagaaggcaaaactggtatttatgtgctaatgccgacgccggaacttaaaac aggtagcggaatcgattggtcagatgaagctttgacgcaacaaataaaggaaattatttatcgtaaattagcaacgattgaagtatt tgaagatataaaatcgcatattgtttcagaaacaatctttacgccaaatgattttgagcaaacgtatcatgcgaaatttggttcggcat tcggtttaatgccaactttagcgcaaagtaattattatcgtccacaaaatgtatcgcgagattataaagatttatattttgcaggtgcaa gtacgcatccaggtgcaggcgttcctattgtcttaacgagtgcgaaaataactgtagatgaaatgattaaagatattgagcggggc gtataagggagtagtctaaGGGCCCggcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatat ggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctga cgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatc accgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcagg tggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataacc ctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgc cttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaact ggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggc gcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcacc agtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggc caacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatc gttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcg caaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggacca cttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagc actggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagac agatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttc atttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtc agaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgct accagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaata ctgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttacc agtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgg gctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatg agaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacg agggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgct cgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacat gttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgac cgagcgcagcgagtcagtgagcgaggaagcggaaga 233 Plasmid name pUC18m-M10-crtN; 4901 bp Based on vector pUC18m Construction This plasmid is identical to pUC18m-crtM-crtN except in the place of wild-type crtM is M10, a mutant of the C30 carotenoid synthase crtM from Staphylococcus aureus that is capable of synthesizing C40 carotenoids. Plasmid Map See pUC18m-crtM-crtN plasmid map. Mutations Point mutations in M10 (compared with wild-type crtM) are shown below in the plasmid sequence in bold, underlined capital letters and are summarized below (numbered according to their position in the crtM ORF; amino acid substitutions are listed in brackets). A10G (M4V) A35G (H12R) A39G (silent) T176C (F59S) A242G (Q81R) A539G (E180G) pUC18m-M10-crtN sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacacatatgGAATTCTCTAGAaggaggattacaaaatga caatgGtgaatatgaattttaaatattgtcGtaaGatcatgaagaaacattcaaaaagcttttcttacgcttttgacttgttaccaga agatcaaagaaaagcggtttgggcaatttatgctgtgtgtcgtaaaattgatgacagtatagatgtttatggcgatattcaatCttta aatcaaataaaagaagatatacaatctattgaaaaatacccatatgaacatcatcactttcGaagtgatcgtagaatcatgatggc gcttcagcatgttgcacaacataaaaatatcgcctttcaatctttttataatctcattgatactgtatataaagatcaacattttacaatgt ttgaaacggacgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattgacgccgattttaagtgatcatgaa acacatcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgtcggtgaagattttgac aatgGacggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaataatcatt atattgacttatgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattgaagca caaccaatcatagaattagcagcacgtatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtt tttgtggataagaggaaaaaggcaaagttgtttcatgaaaataaatagtaaatatcatagaatatagCTCGAGaggaggatta caaaatgaagattgcagtaattggtgcaggtgtcacaggattagcagcggcagcccgtattgcttctcaaggtcatgaagtgacg atatttgaaaaaaataataatgtaggcgggcgtatgaatcaattaaagaaagacggctttacatttgatatgggtcccacaattgtca tgatgccagatgtttataaagatgtttttacagcgtgtggtaaaaattatgaagattatattgaattgagacaattacgttatatttacga tgtgtattttgaccacgatgatcgtataacggtgcctacagatttagctgaattacagcaaatgctagaaagtatagaacctggttca acgcatggttttatgtcctttttaacggatgtttataaaaaatatgaaattgcacgtcgctatttcttagaaagaacgtatcgcaaaccg agtgacttttataatatgacgtcacttgtgcaaggtgctaagttaaaaacgttaaatcatgcagatcagctaattgaacattatattgat aacgaaaagatacaaaagcttttagcgtttcaaacgttatacataggaattgatccaaaacgaggcccgtcactatattcaattattc ctatgattgaaatgatgtttggtgtgcattttattaaaggcggtatgtatggcatggctcaagggctagcgcaattaaataaagactt 234 aggcgttaatattgaactaaatgctgaaattgagcaaattattattgatcctaaattcaaacgggccgatgcgataaaagtgaatgg tgacataagaaaatttgataaaattttatgtacggctgatttccctagtgttgcggaatcattaatgccagattttgcacctattaaaaa gtatccaccacataaaattgcagacttagattactcttgttcagcatttttaatgtatatcggtatagatattgatgtgacagatcaagt gagacttcataatgttattttttcagatgactttagaggcaatattgaagaaatatttgagggacgtttatcatatgatccttctatttatgt gtatgtaccagcggtcgctgataaatcacttgcgccagaaggcaaaactggtatttatgtgctaatgccgacgccggaacttaaa acaggtagcggaatcgattggtcagatgaagctttgacgcaacaaataaaggaaattatttatcgtaaattagcaacgattgaagt atttgaagatataaaatcgcatattgtttcagaaacaatctttacgccaaatgattttgagcaaacgtatcatgcgaaatttggttcgg cattcggtttaatgccaactttagcgcaaagtaattattatcgtccacaaaatgtatcgcgagattataaagatttatattttgcaggtg caagtacgcatccaggtgcaggcgttcctattgtcttaacgagtgcgaaaataactgtagatgaaatgattaaagatattgagcgg ggcgtataagggagtagtctaaGGGCCCggcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcat atatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccc tgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtc atcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtc aggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaat aaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcat tttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcg aactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatg tggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtact caccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactg cggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgcct tgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacg ttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcagg accacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattg cagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaat agacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaa acttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactga gcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaacca ccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagatacc aaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctg ttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcgg tcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagc tatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgc acgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtga tgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctca catgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacg accgagcgcagcgagtcagtgagcgaggaagcggaaga 235 Plasmid name pUC18m-crtB-crtN; 4950 bp Based on vector pUC18m Construction The gene crtB from Erwinia uredovora (C40 carotenoid synthase) is inserted between the XbaI and XhoI sites. The gene crtN from Staphylococcus aureus (C30 carotenoid desaturase) is inserted between the XhoI and ApaI sites. Just upstream of each ORF is an optimized Shine-Dalgarno site (AGGAGG) followed by 8 spacer nucleotides. A single lac operator/promoter site regulates the entire operon, as shown in the plasmid map. E. coli carrying this plasmid synthesize NO carotenoids, as CrtB accepts only GGPP as a substrate, and this is present only at low levels in E. coli that do not express an additional GGPP synthase. Plasmid map pUC18m-crtB-crtN sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcggg cagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgga attgtgagcggataacaatttcacacaggaaacaCATATGGAATTCTCTAGAaggaggattacaaaatggcagttgg ctcgaaaagttttgcgacagcctcaaagttatttgatgcaaaaacccggcgcagcgtactgatgctctacgcctggtgccgccattgtg acgatgttattgacgatcagacgctgggctttcaggcccggcagcctgccttacaaacgcccgaacaacgtctgatgcaacttgagat gaaaacgcgccaggcctatgcaggatcgcagatgcacgaaccggcgtttgcggcttttcaggaagtggctatggctcatgatatcgc cccggcttacgcgtttgatcatctggaaggcttcgccatggatgtacgcgaagcgcaatacagccaactggatgatacgctgcgctatt gctatcacgttgcaggcgttgtcggcttgatgatggcgcaaatcatgggcgtgcgggataacgccacgctggaccgcgcctgtgacc ttgggctggcatttcagttgaccaatattgctcgcgatattgtggacgatgcgcatgcgggccgctgttatctgccggcaagctggctgg agcatgaaggtctgaacaaagagaattatgcggcacctgaaaaccgtcaggcgctgagccgtatcgcccgtcgtttggtgcaggaag 236 cagaaccttactatttgtctgccacagccggcctggcagggttgcccctgcgttccgcctgggcaatcgctacggcgaagcaggttta ccggaaaataggtgtcaaagttgaacaggccggtcagcaagcctgggatcagcggcagtcaacgaccacgcccgaaaaattaacg ctgctgctggccgcctctggtcaggcccttacttcccggatgcgggctcatcctccccgccctgcgcatctctggcagcgcccgctcta gCTCGAGaggaggattacaaaatgaagattgcagtaattggtgcaggtgtcacaggattagcagcggcagcccgtattgcttctc aaggtcatgaagtgacgatatttgaaaaaaataataatgtaggcgggcgtatgaatcaattaaagaaagacggctttacatttgatatgg gtcccacaattgtcatgatgccagatgtttataaagatgtttttacagcgtgtggtaaaaattatgaagattatattgaattgagacaattacg ttatatttacgatgtgtattttgaccacgatgatcgtataacggtgcctacagatttagctgaattacagcaaatgctagaaagtatagaacc tggttcaacgcatggttttatgtcctttttaacggatgtttataaaaaatatgaaattgcacgtcgctatttcttagaaagaacgtatcgcaaa ccgagtgacttttataatatgacgtcacttgtgcaaggtgctaagttaaaaacgttaaatcatgcagatcagctaattgaacattatattgat aacgaaaagatacaaaagcttttagcgtttcaaacgttatacataggaattgatccaaaacgaggcccgtcactatattcaattattcctat gattgaaatgatgtttggtgtgcattttattaaaggcggtatgtatggcatggctcaagggctagcgcaattaaataaagacttaggcgtta atattgaactaaatgctgaaattgagcaaattattattgatcctaaattcaaacgggccgatgcgataaaagtgaatggtgacataagaaa atttgataaaattttatgtacggctgatttccctagtgttgcggaatcattaatgccagattttgcacctattaaaaagtatccaccacataaa attgcagacttagattactcttgttcagcatttttaatgtatatcggtatagatattgatgtgacagatcaagtgagacttcataatgttatttttt cagatgactttagaggcaatattgaagaaatatttgagggacgtttatcatatgatccttctatttatgtgtatgtaccagcggtcgctgata aatcacttgcgccagaaggcaaaactggtatttatgtgctaatgccgacgccggaacttaaaacaggtagcggaatcgattggtcagat gaagctttgacgcaacaaataaaggaaattatttatcgtaaattagcaacgattgaagtatttgaagatataaaatcgcatattgtttcaga aacaatctttacgccaaatgattttgagcaaacgtatcatgcgaaatttggttcggcattcggtttaatgccaactttagcgcaaagtaatta ttatcgtccacaaaatgtatcgcgagattataaagatttatattttgcaggtgcaagtacgcatccaggtgcagcgcttcctattgtcttaac gagtgcgaaaataactgtagatgaaatgattaaagatattgagcgggcgtataagggagtagtctaagagaaagatgtgagaaaagta taaGGGCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtaca atctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggca tccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaag ggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcgg aacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaagga agagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaa gtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccc cgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcgg tcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaatt atgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttt tgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacacca cgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactgga tggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgt gggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaacta tggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatacttta gattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgtt ccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaa ccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagatacc aaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttac cagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggct gaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaag cgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttc cagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggc ggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatccc ctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtga gcgaggaagcggaaga 237 Plasmid name pUC18m-crtE-crtB; 4314 bp Based on vector pUC18m Construction Both genes are on a single operon, regulated by a single lac promoter and operator. Just upstream of each gene is an optimized Shine-Dalgarno site (AGGAGG) followed by 8 spacer nucleotides. The gene crtE from Erwinia uredovora (GGPP synthase) is inserted between the EcoRI and XbaI sites. The gene crtB from Erwinia uredovora (C40 carotenoid synthase) is inserted between the XbaI and XhoI sites. Plasmid map pUC18m-crtE-crtB sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcggg cagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgga attgtgagcggataacaatttcacacaggaaacaCATATGGAATTCaggaggattacaaaatgacggtctgcgcaaaaaa acacgttcatctcactcgcgatgctgcggagcagttactggctgatattgatcgacgccttgatcagttattgcccgtggagggagaac 238 gggatgttgtgggtgccgcgatgcgtgaaggtgcgctggcaccgggaaaacgtattcgccccatgttgctgttgctgaccgcccgcg atctgggttgcgctgtcagccatgacggattactggatttggcctgtgcggtggaaatggtccacgcggcttcgctgatccttgacgata tgccctgcatggacgatgcgaagctgcggcgcggacgccctaccattcattctcattacggagagcatgtggcaatactggcggcgg ttgccttgctgagtaaagcctttggcgtaattgccgatgcagatggcctcacgccgctggcaaaaaatcgggcggtttctgaactgtca aacgccatcggcatgcaaggattggttcagggtcagttcaaggatctgtctgaaggggataagccgcgcagcgctgaagctattttga tgacgaatcactttaaaaccagcacgctgttttgtgcctccatgcagatggcctcgattgttgcgaatgcctccagcgaagcgcgtgatt gcctgcatcgtttttcacttgatcttggtcaggcatttcaactgctggacgatttgaccgatggcatgaccgacaccggtaaggatagca atcaggacgccggtaaatcgacgctggtcaatctgttaggcccgagggcggttgaagaacgtctgagacaacatcttcagcttgcca gtgagcatctctctgcggcctgccaacacgggcacgccactcaacattttattcaggcctggtttgacaaaaaactcgctgccgtcagtt aaTCTAGAaggaggattacaaaatggcagttggctcgaaaagttttgcgacagcctcaaagttatttgatgcaaaaacccggcgc agcgtactgatgctctacgcctggtgccgccattgtgacgatgttattgacgatcagacgctgggctttcaggcccggcagcctgcctt acaaacgcccgaacaacgtctgatgcaacttgagatgaaaacgcgccaggcctatgcaggatcgcagatgcacgaaccggcgtttg cggcttttcaggaagtggctatggctcatgatatcgccccggcttacgcgtttgatcatctggaaggcttcgccatggatgtacgcgaag cgcaatacagccaactggatgatacgctgcgctattgctatcacgttgcaggcgttgtcggcttgatgatggcgcaaatcatgggcgtg cgggataacgccacgctggaccgcgcctgtgaccttgggctggcatttcagttgaccaatattgctcgcgatattgtggacgatgcgc atgcgggccgctgttatctgccggcaagctggctggagcatgaaggtctgaacaaagagaattatgcggcacctgaaaaccgtcag gcgctgagccgtatcgcccgtcgtttggtgcaggaagcagaaccttactatttgtctgccacagccggcctggcagggttgcccctgc gttccgcctgggcaatcgctacggcgaagcaggtttaccggaaaataggtgtcaaagttgaacaggccggtcagcaagcctgggat cagcggcagtcaacgaccacgcccgaaaaattaacgctgctgctggccgcctctggtcaggcccttacttcccggatgcgggctcat cctccccgccctgcgcatctctggcagcgcccgctctagCTCGAGGGGCCCGGCGCCtgatgcggtattttctccttac gcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccg ccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatg tgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataa tggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctc atgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttg cggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacat cgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgt ggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcacc agtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaac ttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaa ccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaact ggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggccct tccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagc cctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcact gattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagat cctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttctt gagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctacc aactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaag aactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttg gactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacga cctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggt aagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgcc acctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttc ctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgatac cgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 239 Plasmid name pUC18m-crtE; 3409 bp Based on vector pUC18m Construction Identical to pUC18m-crtE-crtB but without the crtB gene. pUC18m-crtE sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcggg cagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgga attgtgagcggataacaatttcacacaggaaacaCATATGGAATTCaggaggattacaaaatgacggtctgcgcaaaaaa acacgttcatctcactcgcgatgctgcggagcagttactggctgatattgatcgacgccttgatcagttattgcccgtggagggagaac gggatgttgtgggtgccgcgatgcgtgaaggtgcgctggcaccgggaaaacgtattcgccccatgttgctgttgctgaccgcccgcg atctgggttgcgctgtcagccatgacggattactggatttggcctgtgcggtggaaatggtccacgcggcttcgctgatccttgacgata tgccctgcatggacgatgcgaagctgcggcgcggacgccctaccattcattctcattacggagagcatgtggcaatactggcggcgg ttgccttgctgagtaaagcctttggcgtaattgccgatgcagatggcctcacgccgctggcaaaaaatcgggcggtttctgaactgtca aacgccatcggcatgcaaggattggttcagggtcagttcaaggatctgtctgaaggggataagccgcgcagcgctgaagctattttga tgacgaatcactttaaaaccagcacgctgttttgtgcctccatgcagatggcctcgattgttgcgaatgcctccagcgaagcgcgtgatt gcctgcatcgtttttcacttgatcttggtcaggcatttcaactgctggacgatttgaccgatggcatgaccgacaccggtaaggatagca atcaggacgccggtaaatcgacgctggtcaatctgttaggcccgagggcggttgaagaacgtctgagacaacatcttcagcttgcca gtgagcatctctctgcggcctgccaacacgggcacgccactcaacattttattcaggcctggtttgacaaaaaactcgctgccgtcagtt aaTCTAGACTCGAGGGGCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatat atggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacg ggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccga aacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcactttt cggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgctt caataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcac ccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaag atccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgcc gggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatg gcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggacc gaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccatacca aacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttccc ggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgat aaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctaca cgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcag accaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaa aatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaat ctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactgg cttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacata cctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccgga taaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagataccta cagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacagg agagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgattttt gtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctc acatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgac cgagcgcagcgagtcagtgagcgaggaagcggaaga 240 Plasmid name pUC18m-crtMF26A,W38A; 3365 bp Based on vector pUC18m Construction The gene encoding the F26A, W38A double mutant of CrtM is inserted between the XbaI and XhoI sites of pUC18m. The codon mutations encoding the F26A and W38A amino acid substitutions are shown in bold, underlined capital letters in the sequence below. pUC18m-crtMF26A,W38A sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagt gagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagc ggataacaatttcacacaggaaacaCATATGGAATTCTCTAGAaggaggattacaaaatgacaatgatgaatatgaattttaa atattgtcataaaatcatgaagaaacattcaaaaagcttttcttacgctGCAgacttgttaccagaagatcaaagaaaagcggttGCAgca atttatgctgtgtgtcgtaaaattgatgacagtatagatgtttatggcgatattcaatttttaaAtcaaataaaagaagatatacaatctattgaaaa atacccatatgaacatcatcactttcaaagtgatcgtagaatcatgatggcgcttcagcatgttgcacaacataaaaatatcgcctttcaatcttttt ataatctcattgatactgtatataaagatcaacattttacaatgtttgaaacggacgctgaattattcggatattgttatggtgttgctggtacagtag gtgaagtattgacgccgattttaagtgatcatgaaacacatcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatat taagagatgtcggtgaagattttgacaatgaacggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaa atggtgttaataatcattatattgacttatgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagta ttgaagcacaaccaatcatagaattagcagcacgtatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtt tttgtggataagaggaaaaaggcaaagttgtttcatgaaaAtaaatagtaaatatcatagaatatagCTCGAGGGGCCCGGCG CCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcatagtta agccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtc tccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatg tcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgt atccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattccctt ttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacat cgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcg cggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacag aaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaa cgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaa gccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagc ttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgat aaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgac ggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagttt actcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgt gagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaa aaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagatac caaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccag tggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggg gggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcc cgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcct ggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgcc agcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattacc gcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 241 Plasmid name pUC18m-bstFPSY81A; 3394 bp Based on vector pUC18m Construction The farnesyl diphosphate synthase gene from Bacillus stearothermophilus (with a codon mutation resulting in the amino acid substitution Y81A) is inserted in the XbaI and XhoI sites of the vector. This ORF is named bstFPSY81A for short. Just upstream of the ORF is an optimized Shine-Dalgarno site (AGGAGG) followed by an 8-nucleotide spacer. Plasmid map pUC18m-bstFPSY81A sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacaCATATGGAATTCTCTAGAaggaggagtaagc gatggcgcagctttcagttgaacagtttctcaacgagcaaaaacaggcggtggaaacagcgctctcccgttatatagagcgctta gaagggccggcgaagctgaaaaaggcgatggcgtactcattggaggccggcggcaaacgaatccgtccgttgctgcttctgt ccaccgttcgggcgctcggcaaagacccggcggtcggattgcccgtcgcctgcgcgattgaaatgatccatacggcatctttga tccatgatgatttgccgagcatggacaacgatgatttgcggcgcggcaagccgacgaaccataaagtgttcggcgaggcgatg gccatcttggcgggggacgggttgttgacgtacgcgtttcaattgatcaccgaaatcgacgatgagcgcatccctccttccgtcc ggcttcggctcatcgaacggctggcgaaagcggccggtccggaagggatggtcgccggtcaggcagccgatatggaagga gaggggaaaacgctgacgctttcggagctcgaatacattcatcggcataaaaccgggaaaatgctgcaatacagcgtgcacgc cggcgccttgatcggcggcgctgatgcccggcaaacgcgggagcttgacgaattcgccgcccatctaggccttgcctttcaaat 242 tcgcgatgatattctcgatattgaaggggcagaagaaaaaatcggcaagccggtcggcagcgaccaaagcaacaacaaagcg acgtatccagcgttgctgtcgcttgccggcgcgaaggaaaagttggcgttccatatcgaggcggcgcagcgccatttacggaa cgctgacgttgacggcgccgcgctcgcctatatttgcgaactggtcgccgcccgcgaccattaaCTCGAGGGGCCC GGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctg atgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgct tacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaaggg cctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcg gaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaa aaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacg ctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttg agagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgg gcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggat ggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggag gaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaag ccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactactta ctctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctgg ctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcc cgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactg attaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaa gatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaagg atcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatc aagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttag gccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataag tcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacaca gcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaaggg agaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcct ggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatgga aaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgt ggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgag gaagcggaaga 243 Plasmid name pUC18m-bstFPSY81A-idi; 3957 bp Based on vector pUC18m Construction Identical to pUC18m-bstFPSY81A but with the addition of the idi gene encoding E. coli isopentenyl diphosphate isomerase between XhoI and ApaI sites. Plasmid map pUC18m-bstFPSY81A-idi sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacaCATATGGAATTCTCTAGAaggaggagtaagc gatggcgcagctttcagttgaacagtttctcaacgagcaaaaacaggcggtggaaacagcgctctcccgttatatagagcgctta gaagggccggcgaagctgaaaaaggcgatggcgtactcattggaggccggcggcaaacgaatccgtccgttgctgcttctgt ccaccgttcgggcgctcggcaaagacccggcggtcggattgcccgtcgcctgcgcgattgaaatgatccatacggcatctttga tccatgatgatttgccgagcatggacaacgatgatttgcggcgcggcaagccgacgaaccataaagtgttcggcgaggcgatg gccatcttggcgggggacgggttgttgacgtacgcgtttcaattgatcaccgaaatcgacgatgagcgcatccctccttccgtcc ggcttcggctcatcgaacggctggcgaaagcggccggtccggaagggatggtcgccggtcaggcagccgatatggaagga gaggggaaaacgctgacgctttcggagctcgaatacattcatcggcataaaaccgggaaaatgctgcaatacagcgtgcacgc cggcgccttgatcggcggcgctgatgcccggcaaacgcgggagcttgacgaattcgccgcccatctaggccttgcctttcaaat tcgcgatgatattctcgatattgaaggggcagaagaaaaaatcggcaagccggtcggcagcgaccaaagcaacaacaaagcg acgtatccagcgttgctgtcgcttgccggcgcgaaggaaaagttggcgttccatatcgaggcggcgcagcgccatttacggaa 244 cgctgacgttgacggcgccgcgctcgcctatatttgcgaactggtcgccgcccgcgaccattaaCTCGAGaggaggatta caaaatgcaaacggaacacgtcattttattgaatgcacagggagttcccacgggtacgctggaaaagtatgccgcacacacgg cagacacccgcttacatctcgcgttctccagttggctgtttaatgccaaaggacaattattagttacccgccgcgcactgagcaaa aaagcatggcctggcgtgtggactaactcggtttgtgggcacccacaactgggagaaagcaacgaagacgcagtgatccgcc gttgccgttatgagcttggcgtggaaattacgcctcctgaatctatctatcctgactttcgctaccgcgccaccgatccgagtggca ttgtggaaaatgaagtgtgtccggtatttgccgcacgcaccactagtgcgttacagatcaatgatgatgaagtgatggattatcaat ggtgtgatttagcagatgtattacacggtattgatgccacgccgtgggcgttcagtccgtggatggtgatgcaggcgacaaatcg cgaagccagaaaacgattatctgcatttacccagcttaaataaGGGCCCGGCGCCtgatgcggtattttctccttacgca tctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacaccc gccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagct gcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtc atgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattca aatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtg tcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagt tgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatg atgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacacta ttctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctg ccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaa catgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacga tgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactgg atggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtg agcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtc aggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagttta ctcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatccc ttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatct gctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaact ggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgc ctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgat agttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccg aactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcg gcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccac ctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggtt cctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagct gataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 245 Plasmid name pUC18m-apFGS; 3456 bp Based on vector pUC18m Construction The gene encoding farnesylgeranyl diphosphate (C25PP) synthase from Aeropyrum pernix is inserted between the NdeI and EcoRI sites of pUC18m. Plasmid map pUC18m-apFGS sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacaCATATGaggaggatactcgatgctcatagaccactatata atggattttatgagcataactcctgacaggcttagcggggcatcgctacacctcattaaggccggcgggaagaggctcagaccc ctgataacactcttgacggcgaggatgctggggggtctagaggctgaggcccgtgcaatccctcttgcagcatctatagagacg gcccacacgttttcgcttatacacgatgacatcatggatagggatgaggtgaggaggggcgtccccacaacccatgtagtctac ggcgatgactgggctatactggctggcgacacgctgcacgcggcggccttcaagatgatagccgattctagggagtggggga tgagccatgaacaggcctaccgggccttcaaagttctttctgaggctgctatacagatatccaggggtcaggcgtacgacatgct cttcgaggagacctgggatgttgatgtagccgactacctcaacatggtcaggctcaagactggcgctctcatagaggcggcgg cgcgcataggagccgtcgctgcgggggctggcagcgagattgagaagatgatgggtgaggtgggtatgaacgctggcatcg ccttccagataagggatgacatactgggcgttataggtgatccaaaggttactggcaagcctgtttacaacgacttgaggagggg gaagaagacgctgctggtgatatacgctgtcaagaaggcgggtcggagggagatcgtcgaccttattgggcccaaggcgagt 246 gaggatgatttgaagagggcggcatcgataatagtggactcgggtgccctcgactacgcggagtccagggctaggttctatgtt gaaagggctagggacatactatccagggtgccggcagttgacgcggagtcgaaggagcttctcaaccttcttctagactatattg tggagagggtgaagtagGAATTCTCTAGACTCGAGGGGCCCGGCGCCtgatgcggtattttctcctt acgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccga cacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgg gagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggtta atgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatac attcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttc cgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagat cagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttcc aatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatac actattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagt gctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgc acaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacacc acgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaataga ctggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagcc ggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacgggg agtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaa gtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaa atcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgt aatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaagg taactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagca ccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaag acgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgaccta caccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggt aagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttc gccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggccttttt acggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagt gagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 247 Plasmid name pUC18m-apFGS-crtMF26A,W38A; 4335 bp Based on vector pUC18m Construction Identical to pUC18m-apFGS but with the gene encoding the F26A, W38A double mutant of CrtM is inserted between the XbaI and XhoI sites. The codon mutations encoding the F26A and W38A amino acid substitutions are shown in bold, underlined capital letters in the sequence below. pUC18m-apFGS-crtMF26A,W38A sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacaCATATGaggaggatactcgatgctcatagaccactatata atggattttatgagcataactcctgacaggcttagcggggcatcgctacacctcattaaggccggcgggaagaggctcagaccc ctgataacactcttgacggcgaggatgctggggggtctagaggctgaggcccgtgcaatccctcttgcagcatctatagagacg gcccacacgttttcgcttatacacgatgacatcatggatagggatgaggtgaggaggggcgtccccacaacccatgtagtctac ggcgatgactgggctatactggctggcgacacgctgcacgcggcggccttcaagatgatagccgattctagggagtggggga tgagccatgaacaggcctaccgggccttcaaagttctttctgaggctgctatacagatatccaggggtcaggcgtacgacatgct cttcgaggagacctgggatgttgatgtagccgactacctcaacatggtcaggctcaagactggcgctctcatagaggcggcgg cgcgcataggagccgtcgctgcgggggctggcagcgagattgagaagatgatgggtgaggtgggtatgaacgctggcatcg ccttccagataagggatgacatactgggcgttataggtgatccaaaggttactggcaagcctgtttacaacgacttgaggagggg gaagaagacgctgctggtgatatacgctgtcaagaaggcgggtcggagggagatcgtcgaccttattgggcccaaggcgagt gaggatgatttgaagagggcggcatcgataatagtggactcgggtgccctcgactacgcggagtccagggctaggttctatgtt gaaagggctagggacatactatccagggtgccggcagttgacgcggagtcgaaggagcttctcaaccttcttctagactatattg tggagagggtgaagtagGAATTCTCTAGAaggaggattacaaaatgacaatgatgaatatgaattttaaatattgtcat aaaatcatgaagaaacattcaaaaagcttttcttacgctGCAgacttgttaccagaagatcaaagaaaagcggttGCAgcaa tttatgctgtgtgtcgtaaaattgatgacagtatagatgtttatggcgatattcaatttttaaAtcaaataaaagaagatatacaatctat tgaaaaatacccatatgaacatcatcactttcaaagtgatcgtagaatcatgatggcgcttcagcatgttgcacaacataaaaatat cgcctttcaatctttttataatctcattgatactgtatataaagatcaacattttacaatgtttgaaacggacgctgaattattcggatatt gttatggtgttgctggtacagtaggtgaagtattgacgccgattttaagtgatcatgaaacacatcagacatacgatgtcgcaagaa gacttggtgaatcgttgcaattgattaatatattaagagatgtcggtgaagattttgacaatgaacggatatattttagtaagcaacga ttaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaataatcattatattgacttatgggaatattatgcagctatc gcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattgaagcacaaccaatcatagaattagcagcacgtatat atattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtttttgtggataagaggaaaaaggcaaagttg tttcatgaaaAtaaatagtaaatatcatagaatatagCTCGAGGGGCCCGGCGCCtgatgcggtattttctccttac gcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgaca cccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccggga gctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaat gtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacatt caaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccg tgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatca gttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaa tgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacac tattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgct gccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcaca 248 acatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacg atgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactg gatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggt gagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagt caggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagttt actcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcc cttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatc tgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaac tggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgc ctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgat agttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccg aactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcg gcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccac ctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggtt cctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagct gataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 249 Plasmid name pUC18m-hexPS; 4629 bp Based on vector pUC18m Construction The operon from Micrococcus luteus strain B-P 26 encoding the two polypeptide components of hexaprenyl diphosphate (C30PP) synthase (hexPS) is inserted between the EcoRI and XbaI sites of pUC18m. pUC18m-hexPS sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacaCATATGGAATTCaggaggTAGATCAatgcgt tatttacataaaattgaactagaattaaaccgacttacaagtcgatatccatttttcaaaaaaattgcatttgatgctgaaatcataaag ctcgttgatgacctaaatgtcgatgaaaatgtaaaatgtgcgattgttgccattgacacgagtatgcgtatgcaggattttatcaatg aagataataaagacagttttgtactatcaacggatgttttgagtgctttattttataagtatttatcacagccattttatcagcatgatttttt agtactgacggattgtgtaagtcgtatcaatgaattaaaatcaataagagcaacgattacagacgaaattgctttgcataatattaat aaacaaattcattatatgttcatacaaccttatatgaacaatgagaaagtggtgtcttatgagtaaacagttaaatggacaggaaaaa agtgagcttgtacataatgtattccagaatgtatcgacaaagtatgaccgcctcaacgatatcataagttttaatcagcataaatcct ggcgtaaatatacgatgaaacagatgaatgttaaaaaagggtcgaaagcacttgatgtatgctgcggtacaggcgactggacaa ttcagatggcacaggctgtcggtaaaaatggtcatgttattggtcttgatttcagtgagaatatgttaagtgttgcacaaggaaaaac gaatcatatacaaaatattgaattaattcatggtaatgcgatggaattaccatttgaagataatatatttgattatacaacgattggtttt ggtttacgtaacttaccggattataaaaaaggattagaagaaatgtatcgtgtattaaaacctggcggcatgattgttgttttagaaa cgagccatccaacaatgccagtatttaaacaaggttacaaattatatttcaaatacgttatgcccctgtttgggaaagtatttgctaag tctatgaaggaatatagctggttacagcaaagtgcttttgaatttcctgataagtacacgttagcacttttaatggctgaaactggattt acacacattaaatttaaaggttttactggtggcgtgagtgcgatgcatcttgcatacaagccgaaagaaaaatagaatggatgatt gctttgagttataaagcgtttttaaacccatatatcattgaagttgaaaaaaggttatatgagtgtattcagagtgattctgaaacgata aacaaggcggcacaccatattttaagttcaggaggaaagcgcgtacgtccgatgtttgtattattaagtggttttctgaatgatacac aaaaggatgacttgattcgtacagcagtatctctggagctcgttcatatggcaagtctcgttcatgatgattacatcgataatagtga tatgcgtcgtggtaatacttcggttcatatagcttttgataaagacacagcaattcgcacaggacattttttattagcacgtgcgttac aaaatattgcaactatcaataattcgaaattccatcaaatttttagtaaaacgatacttgaagtttgttttggtgaatttgaccagatgg cagatcgatttaattatcctgtatcctttactgcatatttaagacgtattaatcgtaaaacagcgatactgatagaagcaagctgtcatt taggggctctcagctcacagcttgatgaacaatctacatatcatataaaacaatttgggcattgtattggaatgagttatcaaattatt gatgatattctcgattacacgagtgacgaagcaacactcggtaaacctgtcggtagcgatataagaaacggtcatattacgtatcc gcttatggccgctatcgctaatttgaaagagcaagatgacgataaacttgaagcagttgttaaacatttaacatcaacatcagatga tgaagtgtatcaatatattgtttcgcaagttaaacaatatggaattgaacctgcagaattgctgagcagaaaatatggtgataaagc gaaatatcacttgagtcaattacaggatagtaatattaaagattatttagaagaaatccacgaaaaaatgttaaaacgtgtttattaaT CTAGACTCGAGGGGCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatat atggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctg acgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcat caccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcag gtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataac cctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttg ccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaac tggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtgg cgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcac 250 cagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcgg ccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgat cgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgc gcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggacc acttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcag cactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaataga cagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaactt catttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgt cagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgc taccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaat actgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttac cagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcg ggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctat gagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcac gagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatg ctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcaca tgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgac cgagcgcagcgagtcagtgagcgaggaagcggaaga 251 Plasmid name pUC18m-hexPS-crtM-crtN; 7044 bp Based on vector pUC18m Construction Identical to plasmid pUC18m-crtM-crtN but with the additional operon from Micrococcus luteus strain B-P 26 encoding the two polypeptide components of hexaprenyl diphosphate (C30PP) synthase (hexPS) inserted between the EcoRI and XbaI sites. pUC18m-hexPS-crtM-crtN sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcggg cagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgga attgtgagcggataacaatttcacacaggaaacaCATATGGAATTCaggaggtagatcaatgcgttatttacataaaattgaa ctagaattaaaccgacttacaagtcgatatccatttttcaaaaaaattgcatttgatgctgaaatcataaagctcgttgatgacctaaatgtc gatgaaaatgtaaaatgtgcgattgttgccattgacacgagtatgcgtatgcaggattttatcaatgaagataataaagacagttttgtact atcaacggatgttttgagtgctttattttataagtatttatcacagccattttatcagcatgattttttagtactgacggattgtgtaagtcgtatc aatgaattaaaatcaataagagcaacgattacagacgaaattgctttgcataatattaataaacaaattcattatatgttcatacaaccttata tgaacaatgagaaagtggtgtcttatgagtaaacagttaaatggacaggaaaaaagtgagcttgtacataatgtattccagaatgtatcg acaaagtatgaccgcctcaacgatatcataagttttaatcagcataaatcctggcgtaaatatacgatgaaacagatgaatgttaaaaaa gggtcgaaagcacttgatgtatgctgcggtacaggcgactggacaattcagatggcacaggctgtcggtaaaaatggtcatgttattgg tcttgatttcagtgagaatatgttaagtgttgcacaaggaaaaacgaatcatatacaaaatattgaattaattcatggtaatgcgatggaatt accatttgaagataatatatttgattatacaacgattggttttggtttacgtaacttaccggattataaaaaaggattagaagaaatgtatcgt gtattaaaacctggcggcatgattgttgttttagaaacgagccatccaacaatgccagtatttaaacaaggttacaaattatatttcaaatac gttatgcccctgtttgggaaagtatttgctaagtctatgaaggaatatagctggttacagcaaagtgcttttgaatttcctgataagtacacg ttagcacttttaatggctgaaactggatttacacacattaaatttaaaggttttactggtggcgtgagtgcgatgcatcttgcatacaagccg aaagaaaaatagaatggatgattgctttgagttataaagcgtttttaaacccatatatcattgaagttgaaaaaaggttatatgagtgtattc agagtgattctgaaacgataaacaaggcggcacaccatattttaagttcaggaggaaagcgcgtacgtccgatgtttgtattattaagtg gttttctgaatgatacacaaaaggatgacttgattcgtacagcagtatctctggagctcgttcatatggcaagtctcgttcatgatgattaca tcgataatagtgatatgcgtcgtggtaatacttcggttcatatagcttttgataaagacacagcaattcgcacaggacattttttattagcac gtgcgttacaaaatattgcaactatcaataattcgaaattccatcaaatttttagtaaaacgatacttgaagtttgttttggtgaatttgaccag atggcagatcgatttaattatcctgtatcctttactgcatatttaagacgtattaatcgtaaaacagcgatactgatagaagcaagctgtcatt taggggctctcagctcacagcttgatgaacaatctacatatcatataaaacaatttgggcattgtattggaatgagttatcaaattattgatg atattctcgattacacgagtgacgaagcaacactcggtaaacctgtcggtagcgatataagaaacggtcatattacgtatccgcttatgg ccgctatcgctaatttgaaagagcaagatgacgataaacttgaagcagttgttaaacatttaacatcaacatcagatgatgaagtgtatca atatattgtttcgcaagttaaacaatatggaattgaacctgcagaattgctgagcagaaaatatggtgataaagcgaaatatcacttgagt caattacaggatagtaatattaaagattatttagaagaaatccacgaaaaaatgttaaaacgtgtttattaaTCTAGAaggaggatta caaaatgacaatgatgaatatgaattttaaatattgtcataaaatcatgaagaaacattcaaaaagcttttcttacgcttttgacttgttacca gaagatcaaagaaaagcggtttgggcaatttatgctgtgtgtcgtaaaattgatgacagtatagatgtttatggcgatattcaatttttaaAt caaataaaagaagatatacaatctattgaaaaatacccatatgaacatcatcactttcaaagtgatcgtagaatcatgatggcgcttcagc atgttgcacaacataaaaatatcgcctttcaatctttttataatctcattgatactgtatataaagatcaacattttacaatgtttgaaacggac gctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattgacgccgattttaagtgatcatgaaacacatcagacata cgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgtcggtgaagattttgacaatgaacggatatatttta gtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaataatcattatattgacttatgggaatattatg cagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattgaagcacaaccaatcatagaattagcagcacg tatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtttttgtggataagaggaaaaaggcaaagttg tttcatgaaaAtaaatagtaaatatcatagaatatagCTCGAGaggaggattacaaaatgaagattgcagtaattggtgcaggtgt 252 cacaggattagcagcggcagcccgtattgcttctcaaggtcatgaagtgacgatatttgaaaaaaataataatgtaggcgggcgtatga atcaattaaagaaagacggctttacatttgatatgggtcccacaattgtcatgatgccagatgtttataaagatgtttttacagcgtgtggta aaaattatgaagattatattgaattgagacaattacgttatatttacgatgtgtattttgaccacgatgatcgtataacggtgcctacagattta gctgaattacagcaaatgctagaaagtatagaacctggttcaacgcatggttttatgtcctttttaacggatgtttataaaaaatatgaaatt gcacgtcgctatttcttagaaagaacgtatcgcaaaccgagtgacttttataatatgacgtcacttgtgcaaggtgctaagttaaaaacgtt aaatcatgcagatcagctaattgaacattatattgataacgaaaagatacaaaagcttttagcgtttcaaacgttatacataggaattgatc caaaacgaggcccgtcactatattcaattattcctatgattgaaatgatgtttggtgtgcattttattaaaggcggtatgtatggcatggctc aagggctagcgcaattaaataaagacttaggcgttaatattgaactaaatgctgaaattgagcaaattattattgatcctaaattcaaacgg gccgatgcgataaaagtgaatggtgacataagaaaatttgataaaattttatgtacggctgatttccctagtgttgcggaatcattaatgcc agattttgcacctattaaaaagtatccaccacataaaattgcagacttagattactcttgttcagcatttttaatgtatatcggtatagatattg atgtgacagatcaagtgagacttcataatgttattttttcagatgactttagaggcaatattgaagaaatatttgagggacgtttatcatatga tccttctatttatgtgtatgtaccagcggtcgctgataaatcacttgcgccagaaggcaaaactggtatttatgtgctaatgccgacgccg gaacttaaaacaggtagcggaatcgattggtcagatgaagctttgacgcaacaaataaaggaaattatttatcgtaaattagcaacgatt gaagtatttgaagatataaaatcgcatattgtttcagaaacaatctttacgccaaatgattttgagcaaacgtatcatgcgaaatttggttcg gcattcggtttaatgccaactttagcgcaaagtaattattatcgtccacaaaatgtatcgcgagattataaagatttatattttgcaggtgca agtacgcatccaggtgcaggcgttcctattgtcttaacgagtgcgaaaataactgtagatgaaatgattaaagatattgagcggggcgt ataagggagtagtctaaGGGCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatgg tgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggctt gtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgc gcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgggg aaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataa tattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccaga aacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatcctt gagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggc aagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatg acagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaagg agctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgac gagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaac aattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctg gagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacgg ggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagt ttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatccctt aacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgct tgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagca gagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctc tgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcg cagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtg agctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgc acgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgct cgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttct ttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgc agcgagtcagtgagcgaggaagcggaaga 253 Plasmid name pUC18m-hexPS-crtB-crtI; 7027 bp Based on vector pUC18m Construction Identical to plasmid pUC18m-crtE-crtB-crtI but with the operon from Micrococcus luteus strain B-P 26 encoding the two polypeptide components of hexaprenyl diphosphate (C30PP) synthase (hexPS) in place of crtE between the EcoRI and XbaI sites. pUC18m-hexPS-crtB-crtI sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcggg cagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgga attgtgagcggataacaatttcacacaggaaacaCATATGGAATTCaggaggtagatcaatgcgttatttacataaaattgaa ctagaattaaaccgacttacaagtcgatatccatttttcaaaaaaattgcatttgatgctgaaatcataaagctcgttgatgacctaaatgtc gatgaaaatgtaaaatgtgcgattgttgccattgacacgagtatgcgtatgcaggattttatcaatgaagataataaagacagttttgtact atcaacggatgttttgagtgctttattttataagtatttatcacagccattttatcagcatgattttttagtactgacggattgtgtaagtcgtatc aatgaattaaaatcaataagagcaacgattacagacgaaattgctttgcataatattaataaacaaattcattatatgttcatacaaccttata tgaacaatgagaaagtggtgtcttatgagtaaacagttaaatggacaggaaaaaagtgagcttgtacataatgtattccagaatgtatcg acaaagtatgaccgcctcaacgatatcataagttttaatcagcataaatcctggcgtaaatatacgatgaaacagatgaatgttaaaaaa gggtcgaaagcacttgatgtatgctgcggtacaggcgactggacaattcagatggcacaggctgtcggtaaaaatggtcatgttattgg tcttgatttcagtgagaatatgttaagtgttgcacaaggaaaaacgaatcatatacaaaatattgaattaattcatggtaatgcgatggaatt accatttgaagataatatatttgattatacaacgattggttttggtttacgtaacttaccggattataaaaaaggattagaagaaatgtatcgt gtattaaaacctggcggcatgattgttgttttagaaacgagccatccaacaatgccagtatttaaacaaggttacaaattatatttcaaatac gttatgcccctgtttgggaaagtatttgctaagtctatgaaggaatatagctggttacagcaaagtgcttttgaatttcctgataagtacacg ttagcacttttaatggctgaaactggatttacacacattaaatttaaaggttttactggtggcgtgagtgcgatgcatcttgcatacaagccg aaagaaaaatagaatggatgattgctttgagttataaagcgtttttaaacccatatatcattgaagttgaaaaaaggttatatgagtgtattc agagtgattctgaaacgataaacaaggcggcacaccatattttaagttcaggaggaaagcgcgtacgtccgatgtttgtattattaagtg gttttctgaatgatacacaaaaggatgacttgattcgtacagcagtatctctggagctcgttcatatggcaagtctcgttcatgatgattaca tcgataatagtgatatgcgtcgtggtaatacttcggttcatatagcttttgataaagacacagcaattcgcacaggacattttttattagcac gtgcgttacaaaatattgcaactatcaataattcgaaattccatcaaatttttagtaaaacgatacttgaagtttgttttggtgaatttgaccag atggcagatcgatttaattatcctgtatcctttactgcatatttaagacgtattaatcgtaaaacagcgatactgatagaagcaagctgtcatt taggggctctcagctcacagcttgatgaacaatctacatatcatataaaacaatttgggcattgtattggaatgagttatcaaattattgatg atattctcgattacacgagtgacgaagcaacactcggtaaacctgtcggtagcgatataagaaacggtcatattacgtatccgcttatgg ccgctatcgctaatttgaaagagcaagatgacgataaacttgaagcagttgttaaacatttaacatcaacatcagatgatgaagtgtatca atatattgtttcgcaagttaaacaatatggaattgaacctgcagaattgctgagcagaaaatatggtgataaagcgaaatatcacttgagt caattacaggatagtaatattaaagattatttagaagaaatccacgaaaaaatgttaaaacgtgtttattaaTCTAGAaggaggatta caaaatggcagttggctcgaaaagttttgcgacagcctcaaagttatttgatgcaaaaacccggcgcagcgtactgatgctctacgcct ggtgccgccattgtgacgatgttattgacgatcagacgctgggctttcaggcccggcagcctgccttacaaacgcccgaacaacgtct gatgcaacttgagatgaaaacgcgccaggcctatgcaggatcgcagatgcacgaaccggcgtttgcggcttttcaggaagtggctat ggctcatgatatcgccccggcttacgcgtttgatcatctggaaggcttcgccatggatgtacgcgaagcgcaatacagccaactggat gatacgctgcgctattgctatcacgttgcaggcgttgtcggcttgatgatggcgcaaatcatgggcgtgcgggataacgccacgctgg accgcgcctgtgaccttgggctggcatttcagttgaccaatattgctcgcgatattgtggacgatgcgcatgcgggccgctgttatctgc cggcaagctggctggagcatgaaggtctgaacaaagagaattatgcggcacctgaaaaccgtcaggcgctgagccgtatcgcccgt cgtttggtgcaggaagcagaaccttactatttgtctgccacagccggcctggcagggttgcccctgcgttccgcctgggcaatcgctac ggcgaagcaggtttaccggaaaataggtgtcaaagttgaacaggccggtcagcaagcctgggatcagcggcagtcaacgaccacg cccgaaaaattaacgctgctgctggccgcctctggtcaggcccttacttcccggatgcgggctcatcctccccgccctgcgcatctctg gcagcgcccgctctagCTCGAGaggaggattacaaaatgaaaccaactacggtaattggtgcaggcttcggtggcctggcact 254 ggcaattcgtctacaagctgcggggatccccgtcttactgcttgaacaacgtgataaacccggcggtcgggcttatgtctacgaggatc aggggtttacctttgatgcaggcccgacggttatcaccgatcccagtgccattgaagaactgtttgcactggcaggaaaacagttaaaa gagtatgtcgaactgctgccggttacgccgttttaccgcctgtgttgggagtcagggaaggtctttaattacgataacgatcaaacccgg ctcgaagcgcagattcagcagtttaatccccgcgatgtcgaaggttatcgtcagtttctggactattcacgcgcggtgtttaaagaaggc tatctaaagctcggtactgtcccttttttatcgttcagagacatgcttcgcgccgcacctcaactggcgaaactgcaggcatggagaagc gtttacagtaaggttgccagttacatcgaagatgaacatctgcgccaggcgttttctttccactcgctgttggtgggcggcaatcccttcg ccacctcatccatttatacgttgatacacgcgctggagcgtgagtggggcgtctggtttccgcgtggcggcaccggcgcattagttcag gggatgataaagctgtttcaggatctgggtggcgaagtcgtgttaaacgccagagtcagccatatggaaacgacaggaaacaagatt gaagccgtgcatttagaggacggtcgcaggttcctgacgcaagccgtcgcgtcaaatgcagatgtggttcatacctatcgcgacctgtt aagccagcaccctgccgcggttaagcagtccaacaaactgcagactaagcgcatgagtaactctctgtttgtgctctattttggtttgaat caccatcatgatcagctcgcgcatcacacggtttgtttcggcccgcgttaccgcgagctgattgacgaaatttttaatcatgatggcctcg cagaggacttctcactttatctgcacgcgccctgtgtcacggattcgtcactggcgcctgaaggttgcggcagttactatgtgttggcgc cggtgccgcatttaggcaccgcgaacctcgactggacggttgaggggccaaaactacgcgaccgtatttttgcgtaccttgagcagc attacatgcctggcttacggagtcagctggtcacgcaccggatgtttacgccgtttgattttcgcgaccagcttaatgcctatcatggctc agccttttctgtggagcccgttcttacccagagcgcctggtttcggccgcataaccgcgataaaaccattactaatctctacctggtcgg cgcaggcacgcatcccggcgcaggcattcctggcgtcatcggctcggcaaaagcgacagcaggtttgatgctggaggatctgatttg aGGGCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaat ctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatc cgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaaggg cctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaac ccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaaga gtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagta aaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccga agaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcg ccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatg cagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgc acaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacg atgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatg gaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtg ggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactat ggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttag attgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttcc actgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaacc accgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaa atactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttacca gtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctga acggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcg ccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttcca gggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcgg agcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccct gattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagc gaggaagcggaaga 255 Plasmid name pUC18m-hexPS-crtB; 5534 bp Based on vector pUC18m Construction Identical to plasmid pUC18m-hexPS-crtB-crtI but lacking crtI. pUC18m-hexPS-crtB sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacaCATATGGAATTCaggaggtagatcaatgcgttattta cataaaattgaactagaattaaaccgacttacaagtcgatatccatttttcaaaaaaattgcatttgatgctgaaatcataaagctcgtt gatgacctaaatgtcgatgaaaatgtaaaatgtgcgattgttgccattgacacgagtatgcgtatgcaggattttatcaatgaagata ataaagacagttttgtactatcaacggatgttttgagtgctttattttataagtatttatcacagccattttatcagcatgattttttagtact gacggattgtgtaagtcgtatcaatgaattaaaatcaataagagcaacgattacagacgaaattgctttgcataatattaataaacaa attcattatatgttcatacaaccttatatgaacaatgagaaagtggtgtcttatgagtaaacagttaaatggacaggaaaaaagtgag cttgtacataatgtattccagaatgtatcgacaaagtatgaccgcctcaacgatatcataagttttaatcagcataaatcctggcgta aatatacgatgaaacagatgaatgttaaaaaagggtcgaaagcacttgatgtatgctgcggtacaggcgactggacaattcagat ggcacaggctgtcggtaaaaatggtcatgttattggtcttgatttcagtgagaatatgttaagtgttgcacaaggaaaaacgaatca tatacaaaatattgaattaattcatggtaatgcgatggaattaccatttgaagataatatatttgattatacaacgattggttttggtttac gtaacttaccggattataaaaaaggattagaagaaatgtatcgtgtattaaaacctggcggcatgattgttgttttagaaacgagcc atccaacaatgccagtatttaaacaaggttacaaattatatttcaaatacgttatgcccctgtttgggaaagtatttgctaagtctatga aggaatatagctggttacagcaaagtgcttttgaatttcctgataagtacacgttagcacttttaatggctgaaactggatttacacac attaaatttaaaggttttactggtggcgtgagtgcgatgcatcttgcatacaagccgaaagaaaaatagaatggatgattgctttga gttataaagcgtttttaaacccatatatcattgaagttgaaaaaaggttatatgagtgtattcagagtgattctgaaacgataaacaag gcggcacaccatattttaagttcaggaggaaagcgcgtacgtccgatgtttgtattattaagtggttttctgaatgatacacaaaag gatgacttgattcgtacagcagtatctctggagctcgttcatatggcaagtctcgttcatgatgattacatcgataatagtgatatgcg tcgtggtaatacttcggttcatatagcttttgataaagacacagcaattcgcacaggacattttttattagcacgtgcgttacaaaatat tgcaactatcaataattcgaaattccatcaaatttttagtaaaacgatacttgaagtttgttttggtgaatttgaccagatggcagatcg atttaattatcctgtatcctttactgcatatttaagacgtattaatcgtaaaacagcgatactgatagaagcaagctgtcatttaggggc tctcagctcacagcttgatgaacaatctacatatcatataaaacaatttgggcattgtattggaatgagttatcaaattattgatgatatt ctcgattacacgagtgacgaagcaacactcggtaaacctgtcggtagcgatataagaaacggtcatattacgtatccgcttatgg ccgctatcgctaatttgaaagagcaagatgacgataaacttgaagcagttgttaaacatttaacatcaacatcagatgatgaagtgt atcaatatattgtttcgcaagttaaacaatatggaattgaacctgcagaattgctgagcagaaaatatggtgataaagcgaaatatc acttgagtcaattacaggatagtaatattaaagattatttagaagaaatccacgaaaaaatgttaaaacgtgtttattaaTCTAG Aaggaggattacaaaatggcagttggctcgaaaagttttgcgacagcctcaaagttatttgatgcaaaaacccggcgcagcgta ctgatgctctacgcctggtgccgccattgtgacgatgttattgacgatcagacgctgggctttcaggcccggcagcctgccttaca aacgcccgaacaacgtctgatgcaacttgagatgaaaacgcgccaggcctatgcaggatcgcagatgcacgaaccggcgttt gcggcttttcaggaagtggctatggctcatgatatcgccccggcttacgcgtttgatcatctggaaggcttcgccatggatgtacg cgaagcgcaatacagccaactggatgatacgctgcgctattgctatcacgttgcaggcgttgtcggcttgatgatggcgcaaatc atgggcgtgcgggataacgccacgctggaccgcgcctgtgaccttgggctggcatttcagttgaccaatattgctcgcgatattg tggacgatgcgcatgcgggccgctgttatctgccggcaagctggctggagcatgaaggtctgaacaaagagaattatgcggca cctgaaaaccgtcaggcgctgagccgtatcgcccgtcgtttggtgcaggaagcagaaccttactatttgtctgccacagccggc ctggcagggttgcccctgcgttccgcctgggcaatcgctacggcgaagcaggtttaccggaaaataggtgtcaaagttgaaca ggccggtcagcaagcctgggatcagcggcagtcaacgaccacgcccgaaaaattaacgctgctgctggccgcctctggtcag gcccttacttcccggatgcgggctcatcctccccgccctgcgcatctctggcagcgcccgctctagCTCGAGGGGCC 256 CGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctc tgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccg cttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaag ggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcg cggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattga aaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaa cgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatcc ttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgcc gggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacgg atggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcgg aggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatga agccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactac ttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggct ggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccct cccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcac tgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtg aagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaag gatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggat caagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagtta ggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataa gtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacac agcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagg gagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgc ctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatgg aaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattct gtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcg aggaagcggaaga 257 Plasmid name pUC18m-hexPS-crtMF26L; 5508 bp Based on vector pUC18m Construction Identical to plasmid pUC18m-hexPS-crtB but with the gene crtMF26L encoding the F26L mutant of the C30 carotenoid synthase CrtM from Staphylococcus aureus in place of crtB between the XbaI and XhoI sites. The codon mutation encoding the F26L amino acid substitution in crtMF26L is shown in bold, underlined capital letters in the sequence below. pUC18m-hexPS-crtMF26L sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacaCATATGGAATTCaggaggtagatcaatgcgttattta cataaaattgaactagaattaaaccgacttacaagtcgatatccatttttcaaaaaaattgcatttgatgctgaaatcataaagctcgtt gatgacctaaatgtcgatgaaaatgtaaaatgtgcgattgttgccattgacacgagtatgcgtatgcaggattttatcaatgaagata ataaagacagttttgtactatcaacggatgttttgagtgctttattttataagtatttatcacagccattttatcagcatgattttttagtact gacggattgtgtaagtcgtatcaatgaattaaaatcaataagagcaacgattacagacgaaattgctttgcataatattaataaacaa attcattatatgttcatacaaccttatatgaacaatgagaaagtggtgtcttatgagtaaacagttaaatggacaggaaaaaagtgag cttgtacataatgtattccagaatgtatcgacaaagtatgaccgcctcaacgatatcataagttttaatcagcataaatcctggcgta aatatacgatgaaacagatgaatgttaaaaaagggtcgaaagcacttgatgtatgctgcggtacaggcgactggacaattcagat ggcacaggctgtcggtaaaaatggtcatgttattggtcttgatttcagtgagaatatgttaagtgttgcacaaggaaaaacgaatca tatacaaaatattgaattaattcatggtaatgcgatggaattaccatttgaagataatatatttgattatacaacgattggttttggtttac gtaacttaccggattataaaaaaggattagaagaaatgtatcgtgtattaaaacctggcggcatgattgttgttttagaaacgagcc atccaacaatgccagtatttaaacaaggttacaaattatatttcaaatacgttatgcccctgtttgggaaagtatttgctaagtctatga aggaatatagctggttacagcaaagtgcttttgaatttcctgataagtacacgttagcacttttaatggctgaaactggatttacacac attaaatttaaaggttttactggtggcgtgagtgcgatgcatcttgcatacaagccgaaagaaaaatagaatggatgattgctttga gttataaagcgtttttaaacccatatatcattgaagttgaaaaaaggttatatgagtgtattcagagtgattctgaaacgataaacaag gcggcacaccatattttaagttcaggaggaaagcgcgtacgtccgatgtttgtattattaagtggttttctgaatgatacacaaaag gatgacttgattcgtacagcagtatctctggagctcgttcatatggcaagtctcgttcatgatgattacatcgataatagtgatatgcg tcgtggtaatacttcggttcatatagcttttgataaagacacagcaattcgcacaggacattttttattagcacgtgcgttacaaaatat tgcaactatcaataattcgaaattccatcaaatttttagtaaaacgatacttgaagtttgttttggtgaatttgaccagatggcagatcg atttaattatcctgtatcctttactgcatatttaagacgtattaatcgtaaaacagcgatactgatagaagcaagctgtcatttaggggc tctcagctcacagcttgatgaacaatctacatatcatataaaacaatttgggcattgtattggaatgagttatcaaattattgatgatatt ctcgattacacgagtgacgaagcaacactcggtaaacctgtcggtagcgatataagaaacggtcatattacgtatccgcttatgg ccgctatcgctaatttgaaagagcaagatgacgataaacttgaagcagttgttaaacatttaacatcaacatcagatgatgaagtgt atcaatatattgtttcgcaagttaaacaatatggaattgaacctgcagaattgctgagcagaaaatatggtgataaagcgaaatatc acttgagtcaattacaggatagtaatattaaagattatttagaagaaatccacgaaaaaatgttaaaacgtgtttattaaTCTAG Aaggaggattacaaaatgacaatgatgaatatgaattttaaatattgtcataaaatcatgaagaaacattcaaaaagcttttcttacg ctCTCgacttgttaccagaagatcaaagaaaagcggtttgggcaatttatgctgtgtgtcgtaaaattgatgacagtatagatgtt tatggcgatattcaatttttaaatcaaataaaagaagatatacaatctattgaaaaatacccatatgaacatcatcactttcaaagtgat cgtagaatcatgatggcgcttcagcatgttgcacaacataaaaatatcgcctttcaatctttttataatctcattgatactgtatataaa gatcaacattttacaatgtttgaaacggacgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattgacgcc gattttaagtgatcatgaaacacatcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagat gtcggtgaagattttgacaatgaacggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaa atggtgttaataatcattatattgacttatgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaag 258 tatttagtattgaagcacaaccaatcatagaattagcagcacgtatatatattgaaatactggacgaagtgagacaggctaactata cattacatgaacgtgtttttgtggataagaggaaaaaggcaaagttgtttcatgaaaataaatagtaaatatcatagaatatagCT CGAGGGGCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactc tcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtc tgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacg cgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttc ggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatg cttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgttttt gctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaac agcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattat cccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacaga aaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttc tgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaacc ggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaa ctggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctc ggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggcca gatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgag ataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaa aaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgta gaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtg gtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttcta gtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgct gccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggg gggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgcc acgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttc cagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcagggg ggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgc gttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagc gagtcagtgagcgaggaagcggaaga 259 Plasmid name pUC18m-hexPS-crtMF26A,W38A; 5508 bp Based on vector pUC18m Construction Identical to plasmid pUC18m-hexPS-crtB but with the gene crtMF26A,W38A encoding the F26A, W38A mutant of the C30 carotenoid synthase CrtM from Staphylococcus aureus in place of crtB between the XbaI and XhoI sites. The codon mutations encoding the F26A and W38A amino acid substitutions in crtMF26A,W38A are shown in bold, underlined capital letters in the sequence below. pUC18m-hexPS-crtMF26A,W38A sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacaCATATGGAATTCaggaggtagatcaatgcgttattta cataaaattgaactagaattaaaccgacttacaagtcgatatccatttttcaaaaaaattgcatttgatgctgaaatcataaagctcgtt gatgacctaaatgtcgatgaaaatgtaaaatgtgcgattgttgccattgacacgagtatgcgtatgcaggattttatcaatgaagata ataaagacagttttgtactatcaacggatgttttgagtgctttattttataagtatttatcacagccattttatcagcatgattttttagtact gacggattgtgtaagtcgtatcaatgaattaaaatcaataagagcaacgattacagacgaaattgctttgcataatattaataaacaa attcattatatgttcatacaaccttatatgaacaatgagaaagtggtgtcttatgagtaaacagttaaatggacaggaaaaaagtgag cttgtacataatgtattccagaatgtatcgacaaagtatgaccgcctcaacgatatcataagttttaatcagcataaatcctggcgta aatatacgatgaaacagatgaatgttaaaaaagggtcgaaagcacttgatgtatgctgcggtacaggcgactggacaattcagat ggcacaggctgtcggtaaaaatggtcatgttattggtcttgatttcagtgagaatatgttaagtgttgcacaaggaaaaacgaatca tatacaaaatattgaattaattcatggtaatgcgatggaattaccatttgaagataatatatttgattatacaacgattggttttggtttac gtaacttaccggattataaaaaaggattagaagaaatgtatcgtgtattaaaacctggcggcatgattgttgttttagaaacgagcc atccaacaatgccagtatttaaacaaggttacaaattatatttcaaatacgttatgcccctgtttgggaaagtatttgctaagtctatga aggaatatagctggttacagcaaagtgcttttgaatttcctgataagtacacgttagcacttttaatggctgaaactggatttacacac attaaatttaaaggttttactggtggcgtgagtgcgatgcatcttgcatacaagccgaaagaaaaatagaatggatgattgctttga gttataaagcgtttttaaacccatatatcattgaagttgaaaaaaggttatatgagtgtattcagagtgattctgaaacgataaacaag gcggcacaccatattttaagttcaggaggaaagcgcgtacgtccgatgtttgtattattaagtggttttctgaatgatacacaaaag gatgacttgattcgtacagcagtatctctggagctcgttcatatggcaagtctcgttcatgatgattacatcgataatagtgatatgcg tcgtggtaatacttcggttcatatagcttttgataaagacacagcaattcgcacaggacattttttattagcacgtgcgttacaaaatat tgcaactatcaataattcgaaattccatcaaatttttagtaaaacgatacttgaagtttgttttggtgaatttgaccagatggcagatcg atttaattatcctgtatcctttactgcatatttaagacgtattaatcgtaaaacagcgatactgatagaagcaagctgtcatttaggggc tctcagctcacagcttgatgaacaatctacatatcatataaaacaatttgggcattgtattggaatgagttatcaaattattgatgatatt ctcgattacacgagtgacgaagcaacactcggtaaacctgtcggtagcgatataagaaacggtcatattacgtatccgcttatgg ccgctatcgctaatttgaaagagcaagatgacgataaacttgaagcagttgttaaacatttaacatcaacatcagatgatgaagtgt atcaatatattgtttcgcaagttaaacaatatggaattgaacctgcagaattgctgagcagaaaatatggtgataaagcgaaatatc acttgagtcaattacaggatagtaatattaaagattatttagaagaaatccacgaaaaaatgttaaaacgtgtttattaaTCTAG Aaggaggattacaaaatgacaatgatgaatatgaattttaaatattgtcataaaatcatgaagaaacattcaaaaagcttttcttacg ctGCAgacttgttaccagaagatcaaagaaaagcggttGCAgcaatttatgctgtgtgtcgtaaaattgatgacagtatagat gtttatggcgatattcaatttttaaAtcaaataaaagaagatatacaatctattgaaaaatacccatatgaacatcatcactttcaaagt gatcgtagaatcatgatggcgcttcagcatgttgcacaacataaaaatatcgcctttcaatctttttataatctcattgatactgtatata aagatcaacattttacaatgtttgaaacggacgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattgacg ccgattttaagtgatcatgaaacacatcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagag atgtcggtgaagattttgacaatgaacggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtacca 260 aaatggtgttaataatcattatattgacttatgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaa agtatttagtattgaagcacaaccaatcatagaattagcagcacgtatatatattgaaatactggacgaagtgagacaggctaacta tacattacatgaacgtgtttttgtggataagaggaaaaaggcaaagttgtttcatgaaaAtaaatagtaaatatcatagaatatagC TCGAGGGGCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcact ctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgt ctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaac gcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttt tcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaa tgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtt tttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctca acagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtatt atcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcaca gaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttac ttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttggga accggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaacta ttaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcg ctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactgggg ccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgct gagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatt taaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagacccc gtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcg gtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtcctt ctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggct gctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaac ggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagc gccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagc ttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcagg ggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcct gcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgca gcgagtcagtgagcgaggaagcggaaga 261 Plasmid name pAC-crtMF26A,W38A; 5356 bp Based on vector pACmod Construction A fragment containing a lac promoter/operator followed by an optimized Shine-Dalgarno sequence, 8 spacer nucleotides, and then crtMF26A,W38A (encoding the F26A, W38A variant of the C30 carotenoid synthase CrtM from S. aureus) was inserted in the SalI site of pACmod (disrupting the tetracycline resistance gene on the plasmid backbone). The resulting plasmid was sequenced to confirm the direction of the insertion, which is as shown on the plasmid map. crtMF26A,W38A is directly flanked by unique XbaI and XhoI restriction sites. The codon mutations encoding the F26A and W38A amino acid substitutions are shown in bold, underlined capital letters in the sequence below. Note that the sequence shows the reverse strand of crtMF26A,W38A. Plasmid map pAC-crtMF26A,W38A sequence gaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccg taatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacgg tggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatgg tgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggattta tttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttactgatttagtgtatgatggtgttt ttgaggtgctccagtggcttctgtttctatcagctgtccctcctgttcagctactgacggggtggtgcgtaacggcaaaagcaccgccggacat cagcgctagcggagtgtatactggcttactatgttggcactgatgagggtgtcagtgaagtgcttcatgtggcaggagaaaaaaggctgcac cggtgcgtcagcagaatatgtgatacaggatatattccgcttcctcgctcactgactcgctacgctcggtcgttcgactgcggcgagcggaaa tggcttacgaacggggcggagatttcctggaagatgccaggaagatacttaacagggaagtgagagggccgcggcaaagccgtttttccat 262 aggctccgcccccctgacaagcatcacgaaatctgacgctcaaatcagtggtggcgaaacccgacaggactataaagataccaggcgtttc cccctggcggctccctcgtgcgctctcctgttcctgcctttcggtttaccggtgtcattccgctgttatggccgcgtttgtctcattccacgcct gacactcagttccgggtaggcagttcgctccaagctggactgtatgcacgaaccccccgttcagtccgaccgctgcgccttatccggtaact atcgtcttgagtccaacccggaaagacatgcaaaagcaccactggcagcagccactggtaattgatttagaggagttagtcttgaagtcatgc gccggttaaggctaaactgaaaggacaagttttggtgactgcgctcctccaagccagttacctcggttcaaagagttggtagctcagagaacc ttcgaaaaaccgccctgcaaggcggttttttcgttttcagagcaagagattacgcgcagaccaaaacgatctcaagaagatcatcttattaatca gataaaatatttcaagatttcagtgcaatttatctcttcaaatgtagcacctgaagtcagccccatacgatataagttgtaattctcatgtttgacag cttatcATCGATaagctttaatgcggtagtttatcacagttaaattgctaacgcagtcaggcaccgtgtatgaaatctaacaatgcgctcat cgtcatcctcggcaccgtcaccctggatgctgtaggcataggcttggttatgccggtactgccgggcctcttgcgggatatcgtccattccga cagcatcgccagtcactatggcgtgctgctagcgctatatgcgttgatgcaatttctatgcgcacccgttctcggagcactgtccgaccgctttg gccgccgcccagtcctgctcgcttcgctacttggagccactatcgactacgcgatcatggcgaccacacccgtcctgtGGATCCtctac gccggacgcatcgtggccggcatcaccggcgccacaggtgcggttgctggcgcctatatcgccgacatcaccgatggggaagatcgggc tcgccacttcgggctcatgagcgcttgtttcggcgtgggtatggtggcaggccccgtggccgggggactgttgggcgccatctccttgcatg caccattccttgcggcggcggtgctcaacggcctcaacctactactgggctgcttcctaatgcaggagtcgcataagggagagcGTCG ACgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccGGGCCCCTCGAGctatattctatgatatttactat ttattttcatgaaacaactttgcctttttcctcttatccacaaaaacacgttcatgtaatgtatagttagcctgtctcacttcgtccagtatttcaatatat atacgtgctgctaattctatgattggttgtgcttcaatactaaatactttgatttgatccataacatcttgaaaatctttttctgcgatagctgcataata ttcccataagtcaatataatgattattaacaccattttggtacacttcagcaatatcaacttcatattgctttaatcgttgcttactaaaatatatccgtt cattgtcaaaatcttcaccgacatctcttaatatattaatcaattgcaacgattcaccaagtcttcttgcgacatcgtatgtctgatgtgtttcatgatc acttaaaatcggcgtcaatacttcacctactgtaccagcaacaccataacaatatccgaataattcagcgtccgtttcaaacattgtaaaatgttg atctttatatacagtatcaatgagattataaaaagattgaaaggcgatatttttatgttgtgcaacatgctgaagcgccatcatgattctacgatcac tttgaaagtgatgatgttcatatgggtatttttcaatagattgtatatcttcttttatttgatttaaaaattgaatatcgccataaacatctatactgtcatc aattttacgacacacagcataaattgcTGCaaccgcttttctttgatcttctggtaacaagtcTGCagcgtaagaaaagctttttgaatgtttc ttcatgattttatgacaatatttaaaattcatattcatcattgtcattttgtaatcctcctTCTAGAGAATTCCATATGtgtttcctgtgt gaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacat taattgcgttgcgctcactgcccgctttccagtcgggaaacctGTCGACcgatgcccttgagagccttcaacccagtcagctccttccgg tgggcgcggggcatgactatcgtcgccgcacttatgactgtcttctttatcatgcaactcgtaggacaggtgccggcagcgctctgggtcattt tcggcgaggaccgctttcgctggagcgcgacgatgatcggcctgtcgcttgcggtattcggaatcttgcacgccctcgctcaagccttcgtca ctggtcccgccaccaaacgtttcggcgagaagcaggccattatcgccggcatggcggccgacgcgctgggctacgtcttgctggcgttcg cgacgcgaggctggatggccttccccattatgattcttctcgcttccggcggcatcgggatgcccgcgttgcaggccatgctgtccaggcag gtagatgacgaccatcagggacagcttcaaggatcgctcgcggctcttaccagcctaacttcgatcactggaccgctgatcgtcacggcgat ttatgccgcctcggcgagcacatggaacgggttggcatggattgtaggcgccgccctataccttgtctgcctccccgcgttgcgtcgcggtg catggagccgggccacctcgacctgaatggaagccggcggcacctcgctaacggattcaccactccaagaattggagccaatcaattcttg cggagaactgtgaatgcgcaaaccaacccttggcagaacatatccatcgcgtccgccatctccagcagccgcacgcggcgcatctcgggc agcgttgggtcctggccacgggtgcgcatgatcgtgctcctgtcgttgaggacccggctaggctggcggggttgccttactggttagcagaa tgaatcaccgatacgcgagcgaacgtgaagcgactgctgctgcaaaacgtctgcgacctgagcaacaacatgaatggtcttcggtttccgtg tttcgtaaagtctggaaacgcggaagtcccctacgtgctgctgaagttgcccgcaacagagagtggaaccaaccggtgataccacgatacta tgactgagagtcaacgccatgagcggcctcatttcttattctgagttacaacagtccgcaccgctgtccggtagctccttccggtgggcgcgg ggcatgactatcgtcgccgcacttatgactgtcttctttatcatgcaactcgtaggacaggtgccggcagcgcccaacagtcccccggccac ggggcctgccaccatacccacgccgaaacaagcgccctgcaccattatgttccggatctgcatcgcaggatgctgctggctaccctgtgga acacctacatctgtattaacgaagcgctaaccgtttttatcaggctctgggaggcagaataaatgatcatatcgtcaattattacctccacgggg agagcctgagcaaactggcctcaggcatttgagaagcacacggtcacactgcttccggtagtcaataaaccggtaaaccagcaatagacat aagcggctatttaacgaccctgccctgaaccgacgaccgggtcgaatttgctttcgaatttctgccattcatccgcttattatcacttattcaggc gtagcaccaggcgtttaagggcaccaataactgccttaaaaaaattacgccccgccctgccactcatcgcAGTACTgttgtaattcatta agcattctgccgacatggaagccatcacagacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttg cccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacga aaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaa atcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagc tcaccgtctttcattgccatacg 263 Plasmid name pAC-crtMF26A,W38A-crtI; 6849 bp Based on vector pACmod Construction Derived from pAC-crtMF26A,W38A but with the crtI gene (C40 carotenoid desaturase) from Erwinia uredovora inserted after the mutant allele of crtM. crtI is flanked by unique XhoI and ApaI restriction sites, which were used to insert it into pAC-crtMF26A,W38A with known orientation (see plasmid map). Each gene is preceded by a Shine-Dalgarno ribosomal binding sequence (AGGAGG) followed by 8 spacer nucleotides. The codon mutations encoding the F26A and W38A amino acid substitutions in crtMF26A,W38A are shown in bold, underlined capital letters in the sequence below. Note that the sequence shows the reverse strand of crtMF26A,W38A and crtI. Plasmid map pAC-crtMF26A,W38A-crtI sequence gaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaa aaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccat tgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgc ccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccaggg cttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcg ggtgatgctgccaacttactgatttagtgtatgatggtgtttttgaggtgctccagtggcttctgtttctatcagctgtccctcctgttca gctactgacggggtggtgcgtaacggcaaaagcaccgccggacatcagcgctagcggagtgtatactggcttactatgttggc actgatgagggtgtcagtgaagtgcttcatgtggcaggagaaaaaaggctgcaccggtgcgtcagcagaatatgtgatacagg 264 atatattccgcttcctcgctcactgactcgctacgctcggtcgttcgactgcggcgagcggaaatggcttacgaacggggcgga gatttcctggaagatgccaggaagatacttaacagggaagtgagagggccgcggcaaagccgtttttccataggctccgcccc cctgacaagcatcacgaaatctgacgctcaaatcagtggtggcgaaacccgacaggactataaagataccaggcgtttccccct ggcggctccctcgtgcgctctcctgttcctgcctttcggtttaccggtgtcattccgctgttatggccgcgtttgtctcattccacgcc tgacactcagttccgggtaggcagttcgctccaagctggactgtatgcacgaaccccccgttcagtccgaccgctgcgccttatc cggtaactatcgtcttgagtccaacccggaaagacatgcaaaagcaccactggcagcagccactggtaattgatttagaggagtt agtcttgaagtcatgcgccggttaaggctaaactgaaaggacaagttttggtgactgcgctcctccaagccagttacctcggttca aagagttggtagctcagagaaccttcgaaaaaccgccctgcaaggcggttttttcgttttcagagcaagagattacgcgcagacc aaaacgatctcaagaagatcatcttattaatcagataaaatatttcaagatttcagtgcaatttatctcttcaaatgtagcacctgaagt cagccccatacgatataagttgtaattctcatgtttgacagcttatcATCGATaagctttaatgcggtagtttatcacagttaaatt gctaacgcagtcaggcaccgtgtatgaaatctaacaatgcgctcatcgtcatcctcggcaccgtcaccctggatgctgtaggcat aggcttggttatgccggtactgccgggcctcttgcgggatatcgtccattccgacagcatcgccagtcactatggcgtgctgcta gcgctatatgcgttgatgcaatttctatgcgcacccgttctcggagcactgtccgaccgctttggccgccgcccagtcctgctcgc ttcgctacttggagccactatcgactacgcgatcatggcgaccacacccgtcctgtggatcctctacgccggacgcatcgtggcc ggcatcaccggcgccacaggtgcggttgctggcgcctatatcgccgacatcaccgatggggaagatcgggctcgccacttcg ggctcatgagcgcttgtttcggcgtgggtatggtggcaggccccgtggccgggggactgttgggcgccatctccttgcatgcac cattccttgcggcggcggtgctcaacggcctcaacctactactgggctgcttcctaatgcaggagtcgcataagggagagcGT CGACgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccGGGCCCtcaaatcagatcctccagc atcaaacctgctgtcgcttttgccgagccgatgacgccaggaatgcctgcgccgggatgcgtgcctgcgccgaccaggtagag attagtaatggttttatcgcggttatgcggccgaaaccaggcgctctgggtaagaacgggctccacagaaaaggctgagccatg ataggcattaagctggtcgcgaaaatcaaacggcgtaaacatccggtgcgtgaccagctgactccgtaagccaggcatgtaatg ctgctcaaggtacgcaaaaatacggtcgcgtagttttggcccctcaaccgtccagtcgaggttcgcggtgcctaaatgtggcacc ggcgccaacacatagtaactgccgcaaccttcaggcgccagtgacgaatccgtgacacagggcgcgtgcagataaagtgaga agtcctctgcgaggccatcatgattaaaaatttcgtcaatcagctcgcggtaacgcgggccgaaacaaaccgtgtgatgcgcga gctgatcatgatggtgattcaaaccaaaatagagcacaaacagagagttactcatgcgcttagtctgcagtttgttggactgcttaa ccgcggcagggtgctggcttaacaggtcgcgataggtatgaaccacatctgcatttgacgcgacggcttgcgtcaggaacctg cgaccgtcctctaaatgcacggcttcaatcttgtttcctgtcgtttccatatggctgactctggcgtttaacacgacttcgccaccca gatcctgaaacagctttatcatcccctgaactaatgcgccggtgccgccacgcggaaaccagacgccccactcacgctccagc gcgtgtatcaacgtataaatggatgaggtggcgaagggattgccgcccaccaacagcgagtggaaagaaaacgcctggcgca gatgttcatcttcgatgtaactggcaaccttactgtaaacgcttctccatgcctgcagtttcgccagttgaggtgcggcgcgaagca tgtctctgaacgataaaaaagggacagtaccgagctttagatagccttctttaaacaccgcgcgtgaatagtccagaaactgacg ataaccttcgacatcgcggggattaaactgctgaatctgcgcttcgagccgggtttgatcgttatcgtaattaaagaccttccctga ctcccaacacaggcggtaaaacggcgtaaccggcagcagttcgacatactcttttaactgttttcctgccagtgcaaacagttcttc aatggcactgggatcggtgataaccgtcgggcctgcatcaaaggtaaacccctgatcctcgtagacataagcccgaccgccgg gtttatcacgttgttcaagcagtaagacggggatccccgcagcttgtagacgaattgccagtgccaggccaccgaagcctgcac caattaccgtagttggtttcattttgtaatcctcctCTCGAGctatattctatgatatttactatttattttcatgaaacaactttgccttt ttcctcttatccacaaaaacacgttcatgtaatgtatagttagcctgtctcacttcgtccagtatttcaatatatatacgtgctgctaattc tatgattggttgtgcttcaatactaaatactttgatttgatccataacatcttgaaaatctttttctgcgatagctgcataatattcccataa gtcaatataatgattattaacaccattttggtacacttcagcaatatcaacttcatattgctttaatcgttgcttactaaaatatatccgttc attgtcaaaatcttcaccgacatctcttaatatattaatcaattgcaacgattcaccaagtcttcttgcgacatcgtatgtctgatgtgttt catgatcacttaaaatcggcgtcaatacttcacctactgtaccagcaacaccataacaatatccgaataattcagcgtccgtttcaa acattgtaaaatgttgatctttatatacagtatcaatgagattataaaaagattgaaaggcgatatttttatgttgtgcaacatgctgaa gcgccatcatgattctacgatcactttgaaagtgatgatgttcatatgggtatttttcaatagattgtatatcttcttttatttgatttaaaaa ttgaatatcgccataaacatctatactgtcatcaattttacgacacacagcataaattgcTGCaaccgcttttctttgatcttctggta acaagtcTGCagcgtaagaaaagctttttgaatgtttcttcatgattttatgacaatatttaaaattcatattcatcattgtcattttgta atcctcctTCTAGAgaattccatatgtgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaag 265 cataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaa acctGTCGACcgatgcccttgagagccttcaacccagtcagctccttccggtgggcgcggggcatgactatcgtcgccgc acttatgactgtcttctttatcatgcaactcgtaggacaggtgccggcagcgctctgggtcattttcggcgaggaccgctttcgctg gagcgcgacgatgatcggcctgtcgcttgcggtattcggaatcttgcacgccctcgctcaagccttcgtcactggtcccgccacc aaacgtttcggcgagaagcaggccattatcgccggcatggcggccgacgcgctgggctacgtcttgctggcgttcgcgacgc gaggctggatggccttccccattatgattcttctcgcttccggcggcatcgggatgcccgcgttgcaggccatgctgtccaggca ggtagatgacgaccatcagggacagcttcaaggatcgctcgcggctcttaccagcctaacttcgatcactggaccgctgatcgt cacggcgatttatgccgcctcggcgagcacatggaacgggttggcatggattgtaggcgccgccctataccttgtctgcctccc cgcgttgcgtcgcggtgcatggagccgggccacctcgacctgaatggaagccggcggcacctcgctaacggattcaccactc caagaattggagccaatcaattcttgcggagaactgtgaatgcgcaaaccaacccttggcagaacatatccatcgcgtccgccat ctccagcagccgcacgcggcgcatctcgggcagcgttgggtcctggccacgggtgcgcatgatcgtgctcctgtcgttgagga cccggctaggctggcggggttgccttactggttagcagaatgaatcaccgatacgcgagcgaacgtgaagcgactgctgctgc aaaacgtctgcgacctgagcaacaacatgaatggtcttcggtttccgtgtttcgtaaagtctggaaacgcggaagtcccctacgtg ctgctgaagttgcccgcaacagagagtggaaccaaccggtgataccacgatactatgactgagagtcaacgccatgagcggc ctcatttcttattctgagttacaacagtccgcaccgctgtccggtagctccttccggtgggcgcggggcatgactatcgtcgccgc acttatgactgtcttctttatcatgcaactcgtaggacaggtgccggcagcgcccaacagtcccccggccacggggcctgccac catacccacgccgaaacaagcgccctgcaccattatgttccggatctgcatcgcaggatgctgctggctaccctgtggaacacc tacatctgtattaacgaagcgctaaccgtttttatcaggctctgggaggcagaataaatgatcatatcgtcaattattacctccacgg ggagagcctgagcaaactggcctcaggcatttgagaagcacacggtcacactgcttccggtagtcaataaaccggtaaaccag caatagacataagcggctatttaacgaccctgccctgaaccgacgaccgggtcgaatttgctttcgaatttctgccattcatccgct tattatcacttattcaggcgtagcaccaggcgtttaagggcaccaataactgccttaaaaaaattacgccccgccctgccactcatc gcAGTACTgttgtaattcattaagcattctgccgacatggaagccatcacagacggcatgatgaacctgaatcgccagcgg catcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatc aaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttca ccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttc agtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacg 266 Plasmid name pUCmodII-crtMF26L-bstFPSY81A; 4240 bp Based on vector pUCmodII Construction The gene encoding the F26L mutant of the C30 carotenoid synthase CrtM from Staphylococcus aureus (crtMF26L) is cloned between XbaI and XhoI sites. The gene encoding the Y81A mutant of the farnesyl diphosphate synthase from Bacillus stearothermophilus (bstFPSY81A) is cloned between EcoRI and NcoI sites. The genes are part of a single operon under the control of a single lac promoter (no operator). Each gene is preceded by a Shine-Dalgarno ribosomal binding sequence (AGGAGG) followed by 8 spacer nucleotides. The codon mutation encoding the F26L amino acid substitution in crtMF26L is shown in bold, underlined capital letters in the sequence below. Plasmid map pUCmodII-crtMF26L-bstFPSY81A sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcggg cagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgga attgtgagcgTCTAGAaggaggattacaaaatgacaatgatgaatatgaattttaaatattgtcataaaatcatgaagaaacattcaa aaagcttttcttacgctCTCgacttgttaccagaagatcaaagaaaagcggtttgggcaatttatgctgtgtgtcgtaaaattgatgaca 267 gtatagatgtttatggcgatattcaatttttaaAtcaaataaaagaagatatacaatctattgaaaaatacccatatgaacatcatcactttca aagtgatcgtagaatcatgatggcgcttcagcatgttgcacaacataaaaatatcgcctttcaatctttttataatctcattgatactgtatata aagatcaacattttacaatgtttgaaacggacgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattgacgccg attttaagtgatcatgaaacacatcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgtcgg tgaagattttgacaatgaacggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgtta ataatcattatattgacttatgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattga agcacaaccaatcatagaattagcagcacgtatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgt ttttgtggataagaggaaaaaggcaaagttgtttcatgaaaAtaaatagtaaatatcatagaatatagCTCGAGGAATTCag gaggagtaagcgatggcgcagctttcagttgaacagtttctcaacgagcaaaaacaggcggtggaaacagcgctctcccgttatatag agcgcttagaagggccggcgaagctgaaaaaggcgatggcgtactcattggaggccggcggcaaacgaatccgtccgttgctgctt ctgtccaccgttcgggcgctcggcaaagacccggcggtcggattgcccgtcgcctgcgcgattgaaatgatccatacggcatctttga tccatgatgatttgccgagcatggacaacgatgatttgcggcgcggcaagccgacgaaccataaagtgttcggcgaggcgatggcc atcttggcgggggacgggttgttgacgtacgcgtttcaattgatcaccgaaatcgacgatgagcgcatccctccttccgtccggcttcg gctcatcgaacggctggcgaaagcggccggtccggaagggatggtcgccggtcaggcagccgatatggaaggagaggggaaaa cgctgacgctttcggagctcgaatacattcatcggcataaaaccgggaaaatgctgcaatacagcgtgcacgccggcgccttgatcg gcggcgctgatgcccggcaaacgcgggagcttgacgagtttgccgcccatctaggccttgcctttcaaattcgcgatgatattctcgat attgaaggggcagaagaaaaaatcggcaagccggtcggcagcgaccaaagcaacaacaaagcgacgtatccagcgttgctgtcgc ttgccggcgcgaaggaaaagttggcgttccatatcgaggcggcgcagcgccatttacggaacgctgacgttgacggcgccgcgctc gcctatatttgcgaactggtcgccgcccgcgaccattaaCCATGGGCGGCCGCtgcggtattttctccttacgcatctgtgc ggtatttcacaccgcatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgc tgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggtttt caccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagac gtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaata accctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgc cttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggat ctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtatt atcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaa agcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgaca acgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctga atgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactac ttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggc tggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtat cgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcat tggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgata atctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttt tttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttc cgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgta gcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaaga cgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccg aactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcag ggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgactt gagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttg ctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccg cagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 268 Plasmid name pUCmodII-crtMF26A,W38A-bstFPSY81A; 4240 bp Based on vector pUCmodII Construction The gene encoding the F26A, W38A double mutant of the C30 carotenoid synthase CrtM from Staphylococcus aureus (crtMF26A,W38A) is cloned between XbaI and XhoI sites. The gene encoding the Y81A mutant of the farnesyl diphosphate synthase from Bacillus stearothermophilus (bstFPSY81A) is cloned between EcoRI and NcoI sites. The genes are part of a single operon under the control of a single lac promoter (no operator). Each gene is preceded by a Shine-Dalgarno ribosomal binding sequence (AGGAGG) followed by 8 spacer nucleotides. The codon mutations encoding the F26A and W38A amino acid substitutions in crtMF26A,W38A are shown in bold, underlined capital letters in the sequence below. Plasmid map pUCmodII-crtMF26A,W38A-bstFPSY81A sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcggg cagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgga 269 attgtgagcgTCTAGAaggaggattacaaaatgacaatgatgaatatgaattttaaatattgtcataaaatcatgaagaaacattcaa aaagcttttcttacgctGCAgacttgttaccagaagatcaaagaaaagcggttGCAgcaatttatgctgtgtgtcgtaaaattgatg acagtatagatgtttatggcgatattcaatttttaaAtcaaataaaagaagatatacaatctattgaaaaatacccatatgaacatcatcact ttcaaagtgatcgtagaatcatgatggcgcttcagcatgttgcacaacataaaaatatcgcctttcaatctttttataatctcattgatactgta tataaagatcaacattttacaatgtttgaaacggacgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattgacg ccgattttaagtgatcatgaaacacatcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgt cggtgaagattttgacaatgaacggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggt gttaataatcattatattgacttatgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtat tgaagcacaaccaatcatagaattagcagcacgtatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaac gtgtttttgtggataagaggaaaaaggcaaagttgtttcatgaaaAtaaatagtaaatatcatagaatatagCTCGAGGAATT Caggaggagtaagcgatggcgcagctttcagttgaacagtttctcaacgagcaaaaacaggcggtggaaacagcgctctcccgttat atagagcgcttagaagggccggcgaagctgaaaaaggcgatggcgtactcattggaggccggcggcaaacgaatccgtccgttgc tgcttctgtccaccgttcgggcgctcggcaaagacccggcggtcggattgcccgtcgcctgcgcgattgaaatgatccatacggcatc tttgatccatgatgatttgccgagcatggacaacgatgatttgcggcgcggcaagccgacgaaccataaagtgttcggcgaggcgatg gccatcttggcgggggacgggttgttgacgtacgcgtttcaattgatcaccgaaatcgacgatgagcgcatccctccttccgtccggct tcggctcatcgaacggctggcgaaagcggccggtccggaagggatggtcgccggtcaggcagccgatatggaaggagagggga aaacgctgacgctttcggagctcgaatacattcatcggcataaaaccgggaaaatgctgcaatacagcgtgcacgccggcgccttgat cggcggcgctgatgcccggcaaacgcgggagcttgacgagtttgccgcccatctaggccttgcctttcaaattcgcgatgatattctcg atattgaaggggcagaagaaaaaatcggcaagccggtcggcagcgaccaaagcaacaacaaagcgacgtatccagcgttgctgtc gcttgccggcgcgaaggaaaagttggcgttccatatcgaggcggcgcagcgccatttacggaacgctgacgttgacggcgccgcg ctcgcctatatttgcgaactggtcgccgcccgcgaccattaaCCATGGGCGGCCGCtgcggtattttctccttacgcatctgt gcggtatttcacaccgcatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacaccc gctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggt tttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttag acgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaa taaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttg ccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactgg atctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggt attatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacag aaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctg acaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggag ctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaa ctacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggc tggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctccc gtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaa gcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatccttttt gataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatc ctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctt tttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactct gtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactca agacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctaca ccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcgg cagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctg acttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggcct tttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgc cgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 270 Plasmid name pUCmodII-crtMF26L-crtI-bstFPSY81A; 5733 bp Based on vector pUCmodII Construction The gene encoding the F26L mutant of the C30 carotenoid synthase CrtM from Staphylococcus aureus (crtMF26L) is cloned between XbaI and XhoI sites. The gene encoding the C40 carotenoid desaturase CrtI from Erwinia uredovora (crtI) is cloned between XhoI and EcoRI sites. The gene encoding the Y81A mutant of the farnesyl diphosphate synthase from Bacillus stearothermophilus (bstFPSY81A) is cloned between EcoRI and NcoI sites. The genes are part of a single operon under the control of a single lac promoter (no operator). Each gene is preceded by a Shine-Dalgarno ribosomal binding sequence (AGGAGG) followed by 8 spacer nucleotides. The codon mutation encoding the F26L amino acid substitution in crtMF26L is shown in bold, underlined capital letters in the sequence below. Plasmid map pUCmodII-crtMF26L-crtI-bstFPSY81A sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaa cgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcgTCTAGAaggagg attacaaaatgacaatgatgaatatgaattttaaatattgtcataaaatcatgaagaaacattcaaaaagcttttcttacgctCTCgacttgttaccagaagatc aaagaaaagcggtttgggcaatttatgctgtgtgtcgtaaaattgatgacagtatagatgtttatggcgatattcaatttttaaatcaaataaaagaagatatacaa tctattgaaaaatacccatatgaacatcatcactttcaaagtgatcgtagaatcatgatggcgcttcagcatgttgcacaacataaaaatatcgcctttcaatctttt tataatctcattgatactgtatataaagatcaacattttacaatgtttgaaacggacgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtat 271 tgacgccgattttaagtgatcatgaaacacatcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgtcggtgaa gattttgacaatgaacggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaataatcattatattgactta tgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattgaagcacaaccaatcatagaattagcagcacgt atatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtttttgtggataagaggaaaaaggcaaagttgtttcatgaaaataaa tagtaaatatcatagaatatagCTCGAGaggaggattacaaaatgaaaccaactacggtaattggtgcaggcttcggtggcctggcactggcaattcgt ctacaagctgcggggatccccgtcttactgcttgaacaacgtgataaacccggcggtcgggcttatgtctacgaggatcaggggtttacctttgatgcaggc ccgacggttatcaccgatcccagtgccattgaagaactgtttgcactggcaggaaaacagttaaaagagtatgtcgaactgctgccggttacgccgttttacc gcctgtgttgggagtcagggaaggtctttaattacgataacgatcaaacccggctcgaagcgcagattcagcagtttaatccccgcgatgtcgaaggttatc gtcagtttctggactattcacgcgcggtgtttaaagaaggctatctaaagctcggtactgtcccttttttatcgttcagagacatgcttcgcgccgcacctcaact ggcgaaactgcaggcatggagaagcgtttacagtaaggttgccagttacatcgaagatgaacatctgcgccaggcgttttctttccactcgctgttggtgggc ggcaatcccttcgccacctcatccatttatacgttgatacacgcgctggagcgtgagtggggcgtctggtttccgcgtggcggcaccggcgcattagttcag gggatgataaagctgtttcaggatctgggtggcgaagtcgtgttaaacgccagagtcagccatatggaaacgacaggaaacaagattgaagccgtgcattt agaggacggtcgcaggttcctgacgcaagccgtcgcgtcaaatgcagatgtggttcatacctatcgcgacctgttaagccagcaccctgccgcggttaagc agtccaacaaactgcagactaagcgcatgagtaactctctgtttgtgctctattttggtttgaatcaccatcatgatcagctcgcgcatcacacggtttgtttcgg cccgcgttaccgcgagctgattgacgaaatttttaatcatgatggcctcgcagaggacttctcactttatctgcacgcgccctgtgtcacggattcgtcactgg cgcctgaaggttgcggcagttactatgtgttggcgccggtgccgcatttaggcaccgcgaacctcgactggacggttgaggggccaaaactacgcgaccg tatttttgcgtaccttgagcagcattacatgcctggcttacggagtcagctggtcacgcaccggatgtttacgccgtttgattttcgcgaccagcttaatgcctat catggctcagccttttctgtggagcccgttcttacccagagcgcctggtttcggccgcataaccgcgataaaaccattactaatctctacctggtcggcgcag gcacgcatcccggcgcaggcattcctggcgtcatcggctcggcaaaagcgacagcaggtttgatgctggaggatctgatttgaGAATTCaggagga gtaagcgatggcgcagctttcagttgaacagtttctcaacgagcaaaaacaggcggtggaaacagcgctctcccgttatatagagcgcttagaagggccg gcgaagctgaaaaaggcgatggcgtactcattggaggccggcggcaaacgaatccgtccgttgctgcttctgtccaccgttcgggcgctcggcaaagac ccggcggtcggattgcccgtcgcctgcgcgattgaaatgatccatacggcatctttgatccatgatgatttgccgagcatggacaacgatgatttgcggcgc ggcaagccgacgaaccataaagtgttcggcgaggcgatggccatcttggcgggggacgggttgttgacgtacgcgtttcaattgatcaccgaaatcgacg atgagcgcatccctccttccgtccggcttcggctcatcgaacggctggcgaaagcggccggtccggaagggatggtcgccggtcaggcagccgatatgg aaggagaggggaaaacgctgacgctttcggagctcgaatacattcatcggcataaaaccgggaaaatgctgcaatacagcgtgcacgccggcgccttga tcggcggcgctgatgcccggcaaacgcgggagcttgacgagtttgccgcccatctaggccttgcctttcaaattcgcgatgatattctcgatattgaagggg cagaagaaaaaatcggcaagccggtcggcagcgaccaaagcaacaacaaagcgacgtatccagcgttgctgtcgcttgccggcgcgaaggaaaagttg gcgttccatatcgaggcggcgcagcgccatttacggaacgctgacgttgacggcgccgcgctcgcctatatttgcgaactggtcgccgcccgcgaccatt aaCCATGGGCGGCCGCtgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatggtgcactctcagtacaatctgctctgatgccg catagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctc cgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataata atggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataa ccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctca cccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttt tcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgc atacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccat gagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttga tcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggc gaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggttta ttgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacgg ggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactt tagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtc agaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgttt gccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccac ttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaag acgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacc tacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacga gggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggag cctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataacc gtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 272 Plasmid name pUCmodII-crtMF26A,W38A-crtI-bstFPSY81A; 5733 bp Based on vector pUCmodII Construction The gene encoding the F26A, W38A double mutant of the C30 carotenoid synthase CrtM from Staphylococcus aureus (crtMF26A,W38A) is cloned between XbaI and XhoI sites. The gene encoding the C40 carotenoid desaturase CrtI from Erwinia uredovora (crtI) is cloned between XhoI and EcoRI sites. The gene encoding the Y81A mutant of the farnesyl diphosphate synthase from Bacillus stearothermophilus (bstFPSY81A) is cloned between EcoRI and NcoI sites. The genes are part of a single operon under the control of a single lac promoter (no operator). Each gene is preceded by a Shine-Dalgarno ribosomal binding sequence (AGGAGG) followed by 8 spacer nucleotides. The codon mutations encoding the F26A and W38A amino acid substitutions in crtMF26A,W38A are shown in bold, underlined capital letters in the sequence below. Plasmid map pUCmodII-crtMF26A,W38A-crtI-bstFPSY81A sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaa cgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcgTCTAGAaggagg attacaaaatgacaatgatgaatatgaattttaaatattgtcataaaatcatgaagaaacattcaaaaagcttttcttacgctGCAgacttgttaccagaagatc aaagaaaagcggttGCAgcaatttatgctgtgtgtcgtaaaattgatgacagtatagatgtttatggcgatattcaatttttaaatcaaataaaagaagatatac aatctattgaaaaatacccatatgaacatcatcactttcaaagtgatcgtagaatcatgatggcgcttcagcatgttgcacaacataaaaatatcgcctttcaatct 273 ttttataatctcattgatactgtatataaagatcaacattttacaatgtttgaaacggacgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagt attgacgccgattttaagtgatcatgaaacacatcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgtcggtga agattttgacaatgaacggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaataatcattatattgactt atgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattgaagcacaaccaatcatagaattagcagcacg tatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtttttgtggataagaggaaaaaggcaaagttgtttcatgaaaataa atagtaaatatcatagaatatagCTCGAGaggaggattacaaaatgaaaccaactacggtaattggtgcaggcttcggtggcctggcactggcaattcg tctacaagctgcggggatccccgtcttactgcttgaacaacgtgataaacccggcggtcgggcttatgtctacgaggatcaggggtttacctttgatgcaggc ccgacggttatcaccgatcccagtgccattgaagaactgtttgcactggcaggaaaacagttaaaagagtatgtcgaactgctgccggttacgccgttttacc gcctgtgttgggagtcagggaaggtctttaattacgataacgatcaaacccggctcgaagcgcagattcagcagtttaatccccgcgatgtcgaaggttatc gtcagtttctggactattcacgcgcggtgtttaaagaaggctatctaaagctcggtactgtcccttttttatcgttcagagacatgcttcgcgccgcacctcaact ggcgaaactgcaggcatggagaagcgtttacagtaaggttgccagttacatcgaagatgaacatctgcgccaggcgttttctttccactcgctgttggtgggc ggcaatcccttcgccacctcatccatttatacgttgatacacgcgctggagcgtgagtggggcgtctggtttccgcgtggcggcaccggcgcattagttcag gggatgataaagctgtttcaggatctgggtggcgaagtcgtgttaaacgccagagtcagccatatggaaacgacaggaaacaagattgaagccgtgcattt agaggacggtcgcaggttcctgacgcaagccgtcgcgtcaaatgcagatgtggttcatacctatcgcgacctgttaagccagcaccctgccgcggttaagc agtccaacaaactgcagactaagcgcatgagtaactctctgtttgtgctctattttggtttgaatcaccatcatgatcagctcgcgcatcacacggtttgtttcgg cccgcgttaccgcgagctgattgacgaaatttttaatcatgatggcctcgcagaggacttctcactttatctgcacgcgccctgtgtcacggattcgtcactgg cgcctgaaggttgcggcagttactatgtgttggcgccggtgccgcatttaggcaccgcgaacctcgactggacggttgaggggccaaaactacgcgaccg tatttttgcgtaccttgagcagcattacatgcctggcttacggagtcagctggtcacgcaccggatgtttacgccgtttgattttcgcgaccagcttaatgcctat catggctcagccttttctgtggagcccgttcttacccagagcgcctggtttcggccgcataaccgcgataaaaccattactaatctctacctggtcggcgcag gcacgcatcccggcgcaggcattcctggcgtcatcggctcggcaaaagcgacagcaggtttgatgctggaggatctgatttgaGAATTCaggagga gtaagcgatggcgcagctttcagttgaacagtttctcaacgagcaaaaacaggcggtggaaacagcgctctcccgttatatagagcgcttagaagggccg gcgaagctgaaaaaggcgatggcgtactcattggaggccggcggcaaacgaatccgtccgttgctgcttctgtccaccgttcgggcgctcggcaaagac ccggcggtcggattgcccgtcgcctgcgcgattgaaatgatccatacggcatctttgatccatgatgatttgccgagcatggacaacgatgatttgcggcgc ggcaagccgacgaaccataaagtgttcggcgaggcgatggccatcttggcgggggacgggttgttgacgtacgcgtttcaattgatcaccgaaatcgacg atgagcgcatccctccttccgtccggcttcggctcatcgaacggctggcgaaagcggccggtccggaagggatggtcgccggtcaggcagccgatatgg aaggagaggggaaaacgctgacgctttcggagctcgaatacattcatcggcataaaaccgggaaaatgctgcaatacagcgtgcacgccggcgccttga tcggcggcgctgatgcccggcaaacgcgggagcttgacgagtttgccgcccatctaggccttgcctttcaaattcgcgatgatattctcgatattgaagggg cagaagaaaaaatcggcaagccggtcggcagcgaccaaagcaacaacaaagcgacgtatccagcgttgctgtcgcttgccggcgcgaaggaaaagttg gcgttccatatcgaggcggcgcagcgccatttacggaacgctgacgttgacggcgccgcgctcgcctatatttgcgaactggtcgccgcccgcgaccatt aaCCATGGGCGGCCGCtgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatggtgcactctcagtacaatctgctctgatgccg catagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctc cgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataata atggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataa ccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctca cccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttt tcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgc atacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccat gagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttga tcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggc gaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggttta ttgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacgg ggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactt tagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtc agaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgttt gccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccac ttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaag acgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacc tacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacga gggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggag cctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataacc gtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 274 Plasmid name pUCmodII-crtI; 3949 bp Based on vector pUCmodII Construction The gene encoding the C40 carotenoid desaturase CrtI from Erwinia uredovora (crtI) is cloned between the EcoRI and NcoI restriction sites of pUCmodII. The gene is preceded by a Shine-Dalgarno ribosomal binding sequence (AGGAGG) followed by 8 spacer nucleotides. Plasmid map pUCmodII-crtI sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcgTCTAGAgcgCCCGGGGAATTCaggaggattacaaaatgaaaccaactacggtaatt ggtgcaggcttcggtggcctggcactggcaattcgtctacaagctgcggggatccccgtcttactgcttgaacaacgtgataaac ccggcggtcgggcttatgtctacgaggatcaggggtttacctttgatgcaggcccgacggttatcaccgatcccagtgccattga agaactgtttgcactggcaggaaaacagttaaaagagtatgtcgaactgctgccggttacgccgttttaccgcctgtgttgggagt cagggaaggtctttaattacgataacgatcaaacccggctcgaagcgcagattcagcagtttaatccccgcgatgtcgaaggtta tcgtcagtttctggactattcacgcgcggtgtttaaagaaggctatctaaagctcggtactgtcccttttttatcgttcagagacatgct tcgcgccgcacctcaactggcgaaactgcaggcatggagaagcgtttacagtaaggttgccagttacatcgaagatgaacatct gcgccaggcgttttctttccactcgctgttggtgggcggcaatcccttcgccacctcatccatttatacgttgatacacgcgctgga 275 gcgtgagtggggcgtctggtttccgcgtggcggcaccggcgcattagttcaggggatgataaagctgtttcaggatctgggtgg cgaagtcgtgttaaacgccagagtcagccatatggaaacgacaggaaacaagattgaagccgtgcatttagaggacggtcgca ggttcctgacgcaagccgtcgcgtcaaatgcagatgtggttcatacctatcgcgacctgttaagccagcaccctgccgcggttaa gcagtccaacaaactgcagactaagcgcatgagtaactctctgtttgtgctctattttggtttgaatcaccatcatgatcagctcgcg catcacacggtttgtttcggcccgcgttaccgcgagctgattgacgaaatttttaatcatgatggcctcgcagaggacttctcacttt atctgcacgcgccctgtgtcacggattcgtcactggcgcctgaaggttgcggcagttactatgtgttggcgccggtgccgcattta ggcaccgcgaacctcgactggacggttgaggggccaaaactacgcgaccgtatttttgcgtaccttgagcagcattacatgcct ggcttacggagtcagctggtcacgcaccggatgtttacgccgtttgattttcgcgaccagcttaatgcctatcatggctcagcctttt ctgtggagcccgttcttacccagagcgcctggtttcggccgcataaccgcgataaaaccattactaatctctacctggtcggcgc aggcacgcatcccggcgcaggcattcctggcgtcatcggctcggcaaaagcgacagcaggtttgatgctggaggatctgattt gaCCATGGGCGGCCGCtgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatggtgcactctcagta caatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcc cggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcga gacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgggg aaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttca ataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctc acccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagc ggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatccc gtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaa gcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctga caacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccgg agctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaact ggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcgg cccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccaga tggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagat aggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaa ggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtaga aaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtt tgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtg tagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgcc agtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggg gttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccac gcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttcca gggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcagggggg cggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgtt atcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcga gtcagtgagcgaggaagcggaaga  Directed Evolution of Biosynthetic Pathways to Carotenoids with Unnatural Carbon Backbones Thesis by Alexander Vincent Tobias In partial fulfillment of the requirements for the degree of Doctor of Philosophy California Institute of Technology Pasadena, California 2006 (Defended August 19, 2005) ii © 2006 Alexander Vincent Tobias All Rights Reserved iii ACKNOWLEDGMENTS The opportunity to attend graduate school at Caltech has been a precious gift that I will treasure for the rest of my life. Working at this world-class institute with such talented, intelligent, motivated, and conscientious colleagues has contributed to my professional and personal development in ways I could never have imagined at the outset. To my advisor, Frances Arnold, thank you for giving me the guidance and opportunities to develop and mature as a scientist. I have never encountered anyone who can cut directly through to the essence of an idea or concept the way you can, and I hope that some of your keen scientific vision and insight has rubbed off on me. Thank you also for always being truthful. It wasn’t easy knowing that something I said, did, or wrote didn’t satisfy you or come across the right way, but on the other hand, when you told me that my work was “excellent” or “just right,” I knew you meant it and that really made me feel like I had succeeded. To my other committee members, Anand Asthagiri, Linda Hsieh-Wilson, and Dianne Newman, thank you all for serving on my candidacy and thesis committees and for your insightful questions and comments. I would like to thank the Natural Sciences and Engineering Research Council of Canada for the two postgraduate scholarships I was awarded, and the United States National Science Foundation for a grant supporting this research. I am appreciative not only of the financial contributions from these organizations, but also for the associated expressions of belief in the value of this research. I would not have gotten very far in characterizing the carotenoids my cultures have synthesized without the dedicated assistance of Mona Shahgholi and Nathan iv Dalleska. Thank you both for the hours of time you spent helping me with mass spectrometry, for answering my questions and critiquing my hypotheses, and most of all, for helping me to collect key data for this thesis. Manish Raizada and Hyman Hartman contributed valuable comments that helped us to make the review paper reproduced in Chapter 1 significantly more focused and lucid. Gerhard Sandmann deserves many thanks for supplying me with valuable experimental guidance and eminently appropriate literature at just the right moments. I am also grateful to George Britton for his expert advice on the extraction and analysis of carotenoids from biological material. Shinichi Takaichi provided helpful assistance with the naming of the new carotenoids reported in Chapter 3. Most of my fondest memories of Caltech involve the many wonderful students, postdocs, and visitors who have spent time in the Arnold group during my tenure here. I want to thank every one of these group members for contributing to the Arnold lab’s wonderful atmosphere of interdisciplinary collaboration, for advice and ideas, and for good times at parties and other social functions. In particular, I am indebted to Daisuke Umeno, who was my mentor and collaborator on the carotenoids project and who taught me how to clone genes, build plasmids, and “do” directed evolution. Daisuke, I am ever so grateful for your friendship, instruction, camaraderie, supportiveness, and truly unique sense of humor. I wish to specially acknowledge several other members of the Arnold group: to Adam Hartwick, thank you for your friendship and for your ability to discuss carotenoids and their biosynthesis with me as only someone with your experience could. To Michelle Giron and Brenda Parker, thank you both for your contributions to the carotenoids v subgroup and for being such great students to mentor. To Joff Silberg, thank you for your friendship, advice, and the numerous conversations we had about everything from science and politics to family and food. To Michelle Meyer, thank you for being a wonderful officemate, for your friendship, and for all our conversations over the years. To Matt Peters, thank you for being so willing to answer (or attempt to answer) my almost incessant barrage of chemistry-related questions. To Jorge Rodriguez, thank you for your friendship and our many discussions of scientific and personal import. To Allan Drummond, thank you for your contagious passion for science and our fruitful and enlightening discussions. And to Geethani Bandara, thank you for keeping the lab running smoothly, for all your friendly and helpful advice, and for hosting such great parties at your home. In contrast to my final year, my first four years at Caltech were not spent entirely in the lab. I am grateful to the members of the Caltech Beavers hockey team for their camaraderie and constant supply of memorable moments on and off the ice. In particular, I thank Adam Olsen and David Jenkins for their friendship and hundreds of hours of stimulating banter on the way to and from Sylmar. I would also like to thank my colleagues who served with me on the Caltech Graduate Student Council. My “GSC education” was highly complementary to my research education at Caltech, and I am appreciative of my fellow board members for helping me to improve my “soft” and leadership skills. When I think about the path of my professional life, two of my teachers stand out as having profoundly influenced my choice to pursue a career in engineering. Charles Ledger and Fraser Simpson, my junior high school mathematics teachers, were truly in a vi class of their own. They ignited my passion for math and problem-solving with their contagious enthusiasm and love for the subject as well as their innovative teaching methods (dissatisfied with the textbooks of the day, they designed their own curriculum and somehow convinced the school board to let them teach it). I might have pursued the same career path had I not been taught by Mr. Simpson and Mr. Ledger, but I doubt I would have done so with quite the same vigor. To J.R., I am much obliged to you for your sage guidance and for improving my self-awareness. Your attentive ear and knowledgeable advice have assisted me through many of life’s trials and have helped me to tame my worries. I am no doubt a better person to myself and others because of you. My parents, Lili and David Tobias, deserve special recognition for their love and guidance and for encouraging me to explore my curiosity about the world in myriad ways. Mom and Dad, the lessons you worked so hard to teach me have served me well: finish your homework before you play, do it right the first time, respect other people and their property, help others in need, and wait for things to go on sale. Thank you for giving me just the right amount of freedom and responsibility when I was growing up so that I could learn to be independent but not get into too much trouble. To Mikael, thank you for being the best brother anyone could ask for. I think part of our special bond is rooted in our choice of careers, which are quite different but also appealing to both of us. This allows us to live vicariously through each other, so that I get a taste of the life of a musician and you can experience a bit of life as a scientist. Although we haven’t lived in the same city for some time now, I can’t imagine life without you and I am grateful for our e-mails, telephone calls, and visits. vii To my dearest Jill, thank you for your boundless love, compassion, understanding, and support. I feel the bond of our marriage grow stronger every day, and to be your husband is the ultimate privilege. Thank you for cheering me up when my experiments weren’t working, for bringing me dinner at the lab when I could take only a short break, and for waiting for me all those times when I needed “just another 15 minutes” before I could come home. Thank you also for celebrating my successes and milestones with me, but more importantly, for insisting that these moments be celebrated when I didn’t feel up to it at first. For all you have contributed, I feel like we have completed this thesis together. As we embark on the next chapter of our lives, I look forward to all the new experiences, moments, and memories that I will have the honor of sharing with you. viii ABSTRACT Over the course of evolution, nature continually discovers new small molecules through the alteration of biosynthetic enzymes and pathways by mutation and gene transfer. Hundreds of these natural products have proven indispensable to medicine, culture, and technology, greatly contributing to increases in the length and quality of human lives. Chemists have found that the “chemical space” surrounding natural products is especially rich in functional molecules, and synthesis of natural product analogs has uncovered many with new or improved properties. Inspired by nature’s search algorithm, we and others have conducted our own evolution of carotenoid biosynthetic pathways in the laboratory. Chapter 1 comprehensively reviews the motivations, accomplishments, and challenges of this research area as of early 2005, and describes in detail how biosynthetic routes to dozens of new carotenoids have been established. To expand the number of carotenoid backbones beyond the C30 and C40 carbon scaffolds that give rise to the ~700 known natural carotenoids, we subjected a carotenoid synthase, the enzyme responsible for carotenoid backbone synthesis, to directed evolution. Chapter 2 describes the evolution of the C30 carotenoid synthase CrtM from Staphylococcus aureus for the ability to synthesize C40 carotenoids. This work also resulted in novel carotenoids with C35 backbones. We later found that some of the CrtM mutants generated in this laboratory evolution experiment, as well as several secondgeneration variants, are also capable of synthesizing unnatural C45 and C50 carotenoid backbones when supplied with appropriate prenyl diphosphate precursors. ix Chapter 3 describes the creation of full-fledged pathways to carotenoid pigments based on the C45 and C50 scaffolds. Coexpression of the carotenoid desaturase CrtI from Erwinia uredovora resulted in the biosynthesis of at least 10 new C45 and C50 carotenoids with different systems of conjugated double bonds. We also present evidence of an unnatural asymmetric C40 carotenoid pathway beginning with the condensation of farnesyl diphosphate (FPP, C15PP) and farnesylgeranyl diphosphate (FGPP, C25PP). In addition to clarifying how CrtM and CrtI achieve their product specificities, this work also sheds light on the molecular mechanisms used by evolution to access new chemical diversity and the selective pressures that have shaped natural product biosynthesis. x TABLE OF CONTENTS ACKNOWLEDGMENTS ........................................................................................... iii ABSTRACT............................................................................................................... viii TABLE OF CONTENTS...............................................................................................x LIST OF TABLES AND FIGURES ......................................................................... xiii CHAPTER 1—Diversifying Carotenoid Biosynthetic Pathways in the Laboratory Summary........................................................................................................................2 Introduction....................................................................................................................3 Overview of carotenoid biosynthetic pathways.......................................................5 Carotenoids as a model system for laboratory pathway evolution ..........................8 Evolvable pathways and enzymes .........................................................................11 Approaches to engineering novel biosynthetic pathways............................................14 Engineering pathways by gene assembly ..............................................................14 Engineering pathways by directed enzyme evolution ...........................................17 Probing the evolvability of carotenoid biosynthetic enzymes and pathways ..............19 Directed evolution of key carotenoid biosynthetic enzymes .................................19 Creation of pathways to carotenoids with new carbon scaffolds...........................37 Discussion and future directions..................................................................................43 Revised view of carotenoid biosynthetic pathways...............................................43 Future challenge: specific pathways ......................................................................44 Prospects and challenges for diversifying other pathways by laboratory evolution ............................................................................................................47 Conclusions..................................................................................................................53 References....................................................................................................................75 xi CHAPTER 2—Evolution of the C30 Carotenoid Synthase CrtM for Function in a C40 Pathway Summary......................................................................................................................92 Introduction..................................................................................................................93 Results and Discussion ................................................................................................95 Constructing pathways for C30 and C40 carotenoids ..............................................95 Functional analysis of CrtM and CrtB swapped into their respective foreign pathways ............................................................................................................97 Screening for synthase function in a foreign pathway...........................................99 Evolution of 4,4'-diapophytoene synthase (CrtM) for function in a C40 pathway............................................................................................................100 Carotenoid production of evolved CrtM variants ................................................101 Direct product distribution of CrtM variants in the presence of GGPP (C20PP) .............................................................................................................102 Comparison of the C40 and C30 performance of CrtM variants ...........................103 Analysis of mutations ..........................................................................................104 Structural considerations: mapping mutations onto human squalene synthase............................................................................................................104 Evolution of phytoene synthase (CrtB) in a C30 pathway....................................106 Conclusions................................................................................................................108 Materials and Methods...............................................................................................109 Materials ..............................................................................................................109 Plasmid construction............................................................................................110 Error-prone PCR mutagenesis and screening ......................................................110 Pigment analysis ..................................................................................................112 References..................................................................................................................127 xii CHAPTER 3—Taking Natural Products to New Lengths: Biosynthesis of Novel Carotenoid Families Based on Unnatural Carbon Scaffolds Summary....................................................................................................................132 Introduction................................................................................................................133 Results........................................................................................................................136 CrtI desaturates unnatural C45, C50, and asymmetric C40 carotenoid backbones, resulting in the biosynthesis of numerous novel carotenoids .......136 E. coli expressing only BstFPSY81A and a variant of CrtM accumulate hydroxylated carotenoid backbones.................................................................140 In vitro desaturation experiments with CrtI.........................................................142 Carotenoid biosynthesis in cultures expressing the C25PP synthase from Aeropyrum pernix ............................................................................................146 The distribution of carotenoids synthesized by cells expressing BstFPSY81A is strongly influenced by Idi overexpression and physiological state .............148 Attempted creation of a C60 carotenoid biosynthetic pathway ............................149 Discussion..................................................................................................................151 Determination of desaturation step number by Erwinia CrtI ..............................151 Evidence of an asymmetric C40 carotenoid biosynthetic pathway ......................154 Potential utility of novel desaturated C45 and C50 carotenoids ............................156 Origins of in vivo-hydroxylated carotenoids .......................................................158 Properties of nascent biosynthetic pathways—lessons for biology and metabolic pathway engineering .......................................................................161 Challenges for achieving new pathway specificity..............................................166 Conclusions................................................................................................................172 Materials and Methods...............................................................................................173 Genes and plasmids .............................................................................................173 Bacterial cultures and carotenoid extraction........................................................175 Separation and analysis of carotenoids................................................................177 Acetylation of hydroxylated carotenoid backbones.............................................178 In vitro desaturation of carotenoid backbones.....................................................179 Iodine-catalyzed photoisomerization...................................................................180 xiii Thin-layer chromatography and autoradiography analysis of isoprenyl diphosphate synthase reactions........................................................................180 References..................................................................................................................205 APPENDIX A—Plasmid Sequences and Maps ........................................................210 LIST OF TABLES AND FIGURES Figure 1.1. Natural carotenoid biosynthetic pathways can be organized in a tree-like hierarchy ..............................................................................55 Figure 1.2. Selected examples of gene assembly leading to novel carotenoids in E. coli....................................................................................................57 Figure 1.3. “Matrix” pathway resulting from the coexpression of carotenoid biosynthetic enzymes with broad specificity ............................................59 Figure 1.4. Chain elongation reactions catalyzed by natural all-E IDSs .....................60 Figure 1.5. Product length determination by CrtM and mutants thereof.....................62 Figure 1.6. Extension of laboratory-evolved pathways to 3,4,3',4'tetradehydrolycopene and torulene by coexpression of downstream carotenoid modifying enzymes..................................................................64 Figure 1.7. The step number of the C30 desaturase CrtN is readily modified by mutation …………………………... ........................................................66 Figure 1.8. Cyclization of carotenoids………………………….................................68 Figure 1.9. Alteration of product specificity of the β,β-carotene hydroxylase from Arabidopsis thaliana ........................................................................70 Figure 1.10. Several carotenoid cleavage enzymes display localized specificity .................................................................................71 Figure 1.11. Generation of a C35 carotenoid pathway by gene assembly and directed enzyme evolution ...............................................................73 Figure 1.12. Biosynthesis of C45 and C50 carotenoid backbones .................................74 xiv Table 2.1. Mutations found in sequenced CrtM variants...........................................115 Figure 2.1. Natural carotenoid biosynthetic pathways...............................................116 Figure 2.2. C30 and C40 production systems used in this work ..................................118 Figure 2.3. Typical plate with E. coli XL1-Blue colonies expressing a mutagenic library of CrtM together with CrtI and CrtE ..........................120 Figure 2.4. HPLC-photodiode array analysis of carotenoid extracts of E. coli transformants carrying plasmids pUC-crtE-crtB-crtI, pUC-crtE-crtM-crtI, and pUC-crtE-M8-10-crtI ........................................122 Figure 2.5. Direct product distribution of CrtM and its mutants in the presence of CrtE (GGPP supply) .............................................................124 Figure 2.6. Pigmentation produced by CrtM variants in C40 and C30 pathways ........125 Figure 2.7. Reaction schemes for SqS and CrtM.………………………………......126 Table 3.1. Properties of novel desaturated carotenoids synthesized by XL1-Blue(pUCmodII-crtMF26A,W38A-crtI-bstFPSY81A) .............................183 Table 3.2. Names of numbered carotenoid structures depicted in Figures 3.2-3.4.………………………………... .................................184 Table 3.3. Results of in vitro desaturation experiments with XL1-Blue(pUCmodII-crtI) lysate on various carotenoid backbones ......185 Figure 3.1. Six carotenoid biosynthetic pathways from three prenyl diphosphate precursors ............................................................................186 Figure 3.2. Desaturation in the C45 pathway..............................................................187 Figure 3.3. Desaturation in the C50 pathway ..............................................................188 Figure 3.4. An asymmetric C40 pathway ....................................................................190 Figure 3.5. Hydroxylation and subsequent in vitro desaturation of carotenoid backbones.................................................................................................192 Figure 3.6. UV-visible absorption spectra of novel carotenoids biosynthesized by recombinant E. coli ....................................................194 Figure 3.7. HPLC trace of carotenoid backbones extracted from a culture of XL1-Blue(pUCmodII-crtMF26L-bstFPSY81A)…………………………....196 xv Figure 3.8. Relative molar quantities of the carotenoid backbones produced by recombinant XL1-Blue cultures expressing BstFPSY81A and a CrtM variant..........................................................................................197 Figure 3.9. APCI mass spectra of unmodified, hydroxylated, and acetylated carotenoid backbones.............................................................................198 Figure 3.10. Relative molar quantities of the carotenoid backbones produced by recombinant XL1-Blue cultures expressing ApFGS and CrtMF26A,W38A .........................................................................................200 Figure 3.11. Idi overexpression and physiological state strongly influence the distribution of carotenoid backbones in recombinant XL1-Blue cells expressing BstFPSY81A and CrtMF26A,W38A ...................201 Figure 3.12. Product specificity of M. luteus hexaprenyl diphosphate synthase (HexPS)...................................................................................203  1 CHAPTER 1 Diversifying Carotenoid Biosynthetic Pathways in the Laboratory Material from this chapter appears in Diversifying Carotenoid Biosynthetic Pathways by Directed Evolution, Daisuke Umeno‡, Alexander V. Tobias‡, and Frances H. Arnold, Microbiology and Molecular Biology Reviews, 69(1): 51-78 (2005) and is reprinted with permission from the American Society for Microbiology. ‡ Co-first authors 2 SUMMARY Microorganisms and plants synthesize a diverse array of natural products, many of which have proven indispensable to human health and well-being. Although many thousands of these have been characterized, the space of possible natural products—those that could be made biosynthetically—remains largely unexplored. For decades, this space has largely been the domain of chemists, who have synthesized scores of natural product analogs and have found many with improved or novel functions. New natural products have also been made in recombinant organisms via engineered biosynthetic pathways. Recently, methods inspired by natural evolution have begun to be applied to the search for new natural products. These methods force pathways to evolve in convenient laboratory organisms, where the products of new pathways can be identified and characterized in highthroughput screening programs. Carotenoid biosynthetic pathways have served as a convenient experimental system with which to demonstrate these ideas. Researchers have mixed, matched, and mutated carotenoid biosynthetic enzymes and screened libraries of these “evolved” pathways for the emergence of new carotenoid products. This has led to dozens of new pathway products not previously known to be made by the assembled enzymes. These new products include whole families of carotenoids built from backbones not found in nature. This chapter details the strategies and specific methods that have been employed to generate new carotenoid biosynthetic pathways in the laboratory. The potential application of laboratory evolution to other biosynthetic pathways is also discussed. 3 INTRODUCTION Nature is a masterful and prolific chemist. The ever-expanding catalog of natural products from plants and microbes currently stands at more than 170,000 different compounds (35). This collection has profoundly influenced human well-being. Natural products have been used to treat pain, infections, and disease for thousands of years; their equally ancient and diverse uses as colorants, spices, fragrances, aphrodisiacs, cosmetics, and toxins have been fundamental to human culture and development. This trend shows no signs of subsiding. Of the 877 new small-molecule pharmacological entities introduced worldwide between 1981 and 2002, 61% can be traced to natural products (142). A similar proportion (59%) of the 137 small molecules in phase II or III clinical trials for cancer treatment (as of June 2003) are natural products or closely related compounds (172). Natural products and their derivatives therefore remain an essential component of the pharmaceutical industry (172). Given the wealth of functional small molecules in nature, it is perhaps not surprising that so much effort today goes into prospecting for new ones or modifying existing ones. Academic and industrial laboratories, often in massive screening programs, continue to isolate and characterize promising new compounds from biological extracts. In addition, molecular scaffolds inspired by natural products are increasingly being used as the basis for synthesizing combinatorial chemical libraries that can be screened for protein-binding or other biochemical activities (30). Although impressive in number, the known products of natural biosynthetic pathways account for but a tiny fraction of the structures that could be produced. This essentially infinite space of possible functional molecules represents an irresistible 4 frontier for those seeking new, bioactive compounds. For example, only 1/10 of the 877 new small-molecule pharmacological entities mentioned above are bona fide natural products—most are derivatives of natural products, synthetic compounds with natural product-derived moieties, or natural-product mimics (142). The chemical space surrounding natural products is particularly rich in biologically functional molecules, and structurally related compounds can serve human purposes even better than natural products themselves. Researchers are now beginning to explore some of these “nearly natural” products by mixing, matching, and mutating biosynthetic genes from diverse sources in organisms such as Escherichia coli and screening for production of novel metabolites. In this chapter we illustrate how pathways can be “evolved” rapidly in the laboratory to generate new natural products. Used in this way, directed laboratory evolution is a powerful tool for discovering new pathways and for in vivo combinatorial chemistry of natural products, i.e., “combinatorial biosynthesis.” In addition to providing access to novel metabolites, laboratory evolution studies can offer insights into the natural evolution of metabolic pathways and their constituent enzymes. Comparative studies of homologous enzymes can readily identify similarities such as conserved residues and folds. However, identifying the exact genetic changes responsible for differences in the specificity, stability, or other properties of related enzymes is much more difficult. When comparing sequences that have diverged over millions of years, it is almost impossible to distinguish the handful of adaptive mutations from the plethora of differences that reflect evolutionary drift. In contrast, evolution in the laboratory allows us to capture new metabolic pathways in the act of emerging and permits the identification and analysis of the molecular events that gave rise to the new 5 product distributions. With carotenoid biosynthesis as our model, we describe how pathway engineers have used laboratory evolution experiments to diversify biosynthetic pathways and what they have learned from those efforts. This work has demonstrated the remarkable ability of carotenoid biosynthetic enzymes to evolve and acquire new specificities and has illuminated pathway features that facilitate the creation of new natural products based on “unnatural” molecular scaffolds. Although evolutionary pathway engineering is in its infancy, we show that it is capable of generating whole new families of natural product analogs. Some of these compounds may await discovery in nature, while others will probably never be found by natural evolution. Overview of carotenoid biosynthetic pathways The carotenoids are a subfamily of the isoprenoids and are among the most widespread of all natural products. Carotenoids are responsible for many of the colors of animals, plants, and microorganisms and play important biological roles as accessory light-harvesting components of photosynthetic systems, photo-protecting antioxidants, and regulators of membrane fluidity. As a whole, the natural C30 and C40 carotenoid biosynthetic pathways can be organized in a tree-like hierarchy (Figure 1.1), with the trunk representing the initial, universal step of backbone synthesis catalyzed by a carotenoid synthase and the outward-emanating branches and sub-branches collectively denoting the various downstream modification steps seen in different species (8). The hundreds of known carotenoid biosynthetic enzymes fall into relatively few classes, based on the types of transformation they catalyze (isoprenyl diphosphate synthases, carotenoid synthases, desaturases, cyclases, etc.). The enzymes responsible for various 6 versions of a basic transformation are related by evolution (111, 163, 176): the pathways diverged upon accumulation of mutations that altered enzyme specificity. Thus, a small number of basic transformations, subtly modified in different species, collectively lead to a large number of different products, although only a handful of carotenoids (usually a few and almost always fewer than ~10) are made by any one organism. C40 carotenoids are made in thousands of plant and microbial species, starting with the synthase-catalyzed condensation of two molecules of geranylgeranyl diphosphate (C20PP) to form phytoene (Figure 1.1). (Most phytoene synthases produce the 15Z isomer of phytoene (87).) Different types and levels of modification of this C40 backbone account for the majority of known carotenoids. C30 carotenoid pathways starting with the condensation of two molecules of farnesyl diphosphate (C15PP) to form (15Z)-4,4'-diapophytoene (also called dehydrosqualene) are much less widespread, having been found only in a small number of bacteria such as Staphylococcus, Streptococcus, Heliobacterium, and Methylobacterium species (56, 100, 101, 129, 130, 198, 205, 206). These initial C30 and C40 condensation products are dehydrogenated in a stepwise manner by desaturase enzymes, which represent the next important branch points for pathway diversification (70). In bacteria and fungi, a single desaturase catalyzes the entire sequence of carotenoid desaturation steps (32). Carotenoid desaturation in plants, algae, and cyanobacteria (not covered in this chapter) is accomplished by two distinct desaturases and a carotenoid isomerase (7, 31, 72, 86, 131). Desaturases from bacteria such as Pantoea spp. (referred to in this chapter by their former Erwinia species names, which are more commonly used than the current approved names in the carotenoid field) also catalyze isomerization of the carotenoid’s central 7 double bond, giving all-E (trans) desaturated products (65). With a few notable exceptions (157, 200), the desaturation level of the carotenoid backbone is well defined for each organism. In many organisms, desaturation is followed by cyclization, catalyzed by a β- or ε-cyclase and leading to carotenoids with one or two cyclized ends. A variety of further enzyme-catalyzed transformations that can include ketolation, hydroxylation, glycosylation, and oxidative cleavage act on substrates derived from the C30 or C40 backbones to produce the catalog of more than 700 known carotenoids (82). Some organisms synthesize modified C40 carotenoids with additional or fewer isoprenyl units. For example, Corynebacterium glutamicum synthesizes “homocarotenoids” such as flavuxanthin (C45) and decaprenoxanthin (C50) via enzymatic prenylation of lycopene (Figure 1.1) (109, 112). In contrast, several fungi produce C35 “apocarotenoids” such as neurosporaxanthin via oxidative cleavage of monocyclic C40 carotenoids (Figure 1.1) (12, 14, 164, 215). Despite their non-C40 structures, these natural homo- and apocarotenoids are, from a biosynthetic perspective, part of the C40 family, since their biosynthesis proceeds via the C40 carotenoid backbone phytoene. Isoprenoids and isoprenyl diphosphate building blocks are found in all organisms. E. coli has three isoprenyl diphosphate synthases: a farnesyl diphosphate (C15PP) synthase (67, 68), an octaprenyl diphosphate (C40PP) synthase (154), and a Z-type (see below) undecaprenyl diphosphate (C55PP) synthase (94). A C30 carotenoid pathway can be built in E. coli branching directly from the organism’s endogenous C15PP supply (226). However, since E. coli lacks a C20PP synthase function, a geranylgeranyl diphosphate (C20PP) synthase gene must be heterologously expressed along with the other carotenoid biosynthetic genes in order to make C40 carotenoids in this organism. 8 Most of the enzymes involved in carotenoid biosynthesis are membrane associated, and the hydrophobic intermediates and products of carotenoid pathways partition to cytoplasmic or organelle membranes, depending on the type of organism (29). It is not known whether the carotenoid biosynthetic enzymes associate into complexes. Over the years, evidence for the existence of multienzyme complexes that function as “assembly lines” for carotenoid synthesis has been presented (summarized in reference (32)). Some of the most convincing evidence has come from experiments performed in the laboratory of Cerdá-Olmedo with the fungus Phycomyces blakesleeanus (6, 40, 58, 138). On the other hand, the fact that carotenoid enzymes from different organisms are readily combined to generate functional pathways in heterologous hosts is evidence that the formation of a specific enzyme complex is not a prerequisite for carotenoid biosynthesis. Throughout this chapter, we refer to carotenoid-synthesizing enzyme complexes when they provide a possible alternative explanation for particular observations from our laboratory and others’. Carotenoids as a model system for laboratory pathway evolution Carotenoid biosynthesis is particularly well suited as an experimental system for studying pathway evolution in the laboratory. Claudia Schmidt-Dannert recognized that the following features would facilitate such experiments when she first proposed to evolve these pathways as a visiting researcher in this laboratory in 1998. Carotenoids are diverse, and their biosynthetic pathways are representative of other secondary metabolic pathways. Hundreds of carotenoids are known in nature. They are made using a few basic transformations, the earliest of which are highly conserved. The reactions involved in these early steps, such as backbone formation by carotenoid 9 synthases and cyclization by carotenoid cyclases, are mechanistically similar to other reactions in isoprenoid biosynthesis. Modification steps later in the carotenoid pathways cover a wide range of biotransformations, many of which appear in other natural products. Thus, experience with carotenoid pathway evolution can be applied to diversifying other biosynthetic pathways. Carotenoid biosynthetic enzymes are highly portable. The carotenoid pathway emerges directly from the central isoprenoid pathway that exists in all organisms. Thus, in principle, any organism can supply the precursors required for an engineered carotenoid pathway. Carotenoid biosynthetic genes can be expressed in a wide range of organisms to extend or redirect an existing pathway (69, 70, 105). For instance, a bacterial phytoene desaturase (CrtI) introduced into cyanobacteria (227) and tobacco plants (136) elevated their resistance to the herbicide norflurazon (known to block plant-type phytoene desaturases). Plastid-targeted introduction of an algal β,β-carotene ketolase resulted in transgenic tobacco plants that accumulated astaxanthin and changed the color of the plant’s nectory tissue from yellow to red (128). The highly publicized introduction of the β,β-carotene pathway into rice resulted in substantial β,β-carotene levels in the normally carotenoid-free endosperm and therefore greater nutritional value for this food staple (234). Phytoene-producing human cells (HeLa, NIH 3T3, etc.) were created by the addition of a bacterial phytoene synthase and showed increased tolerance to oxidative shock as well as a slower rate of H-ras-induced carcinogenesis (143, 144, 179). Almost all carotenoid biosynthetic genes cloned to date, including those from plants, can be functionally expressed in E. coli (119, 175, 177, 180), as can animal oxidative cleavage enzymes (98, 123, 158, 220, 231). The “portability” of these enzymes greatly facilitates 10 the assembly and evolution of novel biosynthetic pathways. Evolution of carotenoid pathways can be tracked visually. Carotenoids are natural pigments, and their characteristic colors are ideal for product-based high-throughput screening. Scientists have made good use of this feature throughout the history of carotenoid research. Experiments involving the generation and analysis of mutant strains exhibiting altered colors have elucidated biosynthetic routes in various organisms (12, 15, 18, 41, 66, 73, 113, 120, 130, 155, 162, 173, 178, 196, 201, 216). Many carotenoid biosynthetic genes were cloned based on their ability to confer or alter color development in E. coli (53, 55, 133, 134, 160, 197). Carotenoid titers are an indicator of precursor levels and can be used to evaluate and tune upstream (isoprenoid) pathways (189, 223, 224). The colors generated in E. coli colonies provide a facile screen for new pathway products in a laboratory evolution experiment. Carotenoids are valuable in their own right. The polyene chromophores of carotenoids, which absorb light in the 400-550 nm range, provide the basis for their characteristic yellow-to-red colors and their ability to quench singlet oxygen (5, 74, 79, 95, 103, 137, 218, 230). Carotenoids act as antioxidants in vivo (170, 183, 210), and many beneficial effects of carotenoids on human health have been reported, ranging from cancer prevention and tumor suppression to upregulation of immune function, reduction of the risk of coronary heart disease or age-related degeneration, and cataract prevention (19, 21, 43, 48, 83, 108). As natural pigments, carotenoids are used as colorants in foods, cosmetics, and flowers (117, 128, 209). Given these diverse and important properties of known carotenoids, we can assume that novel compounds of this family will also possess interesting biological or chemical functions. 11 Evolvable pathways and enzymes The diversity of carotenoids and biosynthetic enzymes that exists in nature demonstrates the success of evolution in discovering and optimizing new pathways. Carotenoid pathways are evolvable and understanding the features that lead to this evolvability will allow us to design directed evolution experiments to accomplish the same goals. We define an evolvable pathway as one that can produce many new metabolites after limited genetic change. New metabolites are made following recruitment of new enzymes or functional alteration of existing ones. Such events are rare, and evolvable pathways must be particularly effective at exploiting these rare events. In general, evolvable pathways appear to contain enzymes that are “locally specific” (32). These enzymes are not unspecific; rather, they recognize a particular structural motif common to a variety of possible substrates. Thus, if a change upstream of a locally specific enzyme generates a novel compound, there is a good chance that the enzyme will metabolize this compound further (as long as it retains the required motif) and generate a new derivative. More such enzymes further downstream will accept the new derivative(s) and produce yet more new metabolites. A carotenoid desaturase, for example, might need at most a few mutations in order to catalyze double-bond formation on a new carotenoid-like backbone. Locally specific modifying enzymes further downstream would, with high probability, accept these desaturated substrates, generating still more new compounds. Pathway structure also contributes to evolvability: highly branched pathways can propagate discoveries along many routes. Pathway branches occur where one substrate is potentially converted to multiple products by the action of one or more enzymes. The 12 existence of nested branches geometrically increases the number of new products that can be synthesized from a new metabolite produced upstream, provided that the downstream enzymes accept the new substrates. Evolvable and consequently diverse, carotenoid pathways are “bushy,” with multiple products possible from each basic transformation. Product possibilities are dictated by the nature of the chemical reaction and substrate, and ultimately by the specificity of the enzyme that controls that branch point. For example, desaturation of a carotenoid backbone can produce a number of different products—the one(s) produced by any given organism reflect the specificity of its particular desaturase in its environment. That specificity can change upon mutation and can open new pathway branches. Pathways constructed entirely of locally specific enzymes would not serve a host organism well in terms of regulation and production of tried-and-true metabolites. Thus, we expect evolvable pathways to contain more specific enzymes as well. To maximize the ease of exploring new pathways while preserving key metabolic processes, we would expect these specific enzymes to be located at the earliest steps of a pathway. Here, they can serve as molecular gatekeepers, allowing only certain primary metabolites to enter but not impeding the discovery of new structures within the pathway. Manipulating these gatekeeper enzymes to admit different substrates should be an effective way to generate whole new families of natural products. Thus, features contributing to the evolvability of a biosynthetic pathway include the use of locally specific enzymes and biotransformations that contribute to pathway branching. More-specific gatekeeper enzymes limit what flows through the pathway, providing necessary insurance against chemical chaos. In the end, however, pathways are 13 evolvable because their component enzymes are themselves evolvable, changing properties such as substrate and product specificity readily upon mutation. Evolvable enzymes should also exhibit multiple mutational routes to a given altered phenotype and may be comparatively robust to mutation. The former property increases the chances that new phenotypes will emerge, while the latter property allows “scanning” of similar sequences without loss of function. Perhaps surprisingly, it is still an open question whether promiscuous or locally specific enzymes are more evolvable than enzymes that are highly specific. As we detail in this chapter, as little as a single amino acid substitution can change the specificity of highly specific carotenoid biosynthetic enzymes. An evolvable pathway, then, would consist of an evolvable gatekeeper enzyme (or set of enzymes) coupled with locally specific downstream enzymes. Such an arrangement maximally exploits mutations in the gatekeeper enzyme, converting a single newly discovered molecule into a potentially large number of new metabolites. Several lines of evidence support the view that the enzymes involved in carotenoid biosynthesis are highly evolvable and are embedded in pathways with such evolvable structures. This chapter represents the first attempt at gathering together this evidence, which collectively paints a picture of carotenoid biosynthetic pathways as dynamic systems capable of exploring a diversity of product structures much greater than is seen in nature. We now examine the various ways in which this evolvability has been exploited in the laboratory to explore and extend the product diversity of these pathways. 14 APPROACHES TO ENGINEERING NOVEL BIOSYNTHETIC PATHWAYS New biosynthetic pathways can be created by recruiting foreign catalytic machinery that adds a new branch; such enzyme recruitment happened frequently during the evolution of natural-product pathways (20, 27, 116). A pathway can also diversify when the function of an existing enzyme is altered by mutation or other genetic change. The wide functional diversity that exists within the evolutionarily related carotenoid pathways is evidence that enzyme evolution has played a central role in creating chemical diversity, primarily through modification of substrate and product specificity. In the laboratory, researchers can now employ the same strategies of enzyme recruitment and modification to create new biosynthetic pathways. In this chapter, we refer to coexpressing genes from different sources in a recombinant organism as gene assembly. This approach can be distinguished from directed evolution of the component enzymes (or their regulation), where libraries of mutant alleles are expressed along with other pathway genes in host cells, which are then screened or selected for desired properties. These two approaches generate novel compounds by mimicking the major modes of natural pathway evolution: gene transfer and divergence. Thus, the two approaches complement one another, and we consider both to fall under the umbrella of laboratory pathway evolution. In this section, we discuss efforts to create new carotenoid biosynthetic pathways by using gene assembly, directed enzyme evolution, and combined approaches. Engineering pathways by gene assembly Assembling carotenoid biosynthetic genes from different organisms and expressing these “hybrid” pathways in a recombinant host has generated functional routes 15 to rare or novel carotenoids (Figure 1.2) (4, 5, 13, 69, 105, 118, 192, 199, 211). Where gene assembly alone successfully yielded a new pathway branch or extension, the recruited enzyme(s) usually catalyzed transformations later in the pathway. These downstream enzymes are locally specific and can accept a range of substrates. Various unusual acyclic carotenoids were obtained by assembling carotenogenic genes from Pantoea ananatis (Erwinia uredovora) and Rhodobacter capsulatus (4, 5). Coexpression of the C20PP synthase CrtE and the phytoene synthase CrtB from E. uredovora along with various combinations of three different carotenoid desaturases, a carotenoid hydratase, a β-cyclase, and a hydroxylase resulted in the production of four previously unidentified carotenoids, including 1-OH-3',4'-didehydrolycopene with potent antioxidant activity (5). In another example, addition of CrtW, a β-end ketolase from Paracoccus sp. strain MBIC1143 (“Agrobacterium aurantiacum”), extended the zeaxanthin β-D-diglucoside pathway from Erwinia, leading to synthesis of novel compounds, astaxanthin β-Ddiglucoside and adonixanthin 3'-β-D-glucoside (Figure 1.2) (235). As we show in later sections, other downstream carotenoid-modifying enzymes are also locally specific and should be similarly useful for “combinatorial biosynthesis” of novel carotenoids by gene assembly. We predict that systematic combinatorial assembly of these genes will result in the biosynthesis of many hundreds of new carotenoids. Assembling locally specific enzymes in a recombinant organism can sometimes result in an interconnected “matrix” pathway that leads to numerous carotenoid structures, as illustrated in Figure 1.3 (135). However, many of the intermediates or end products may not be accessible due to imbalances in enzyme expression, activity, or specificity. Thus, a few dominant compounds may be produced, while other (possible) ones remain 16 hidden (but poised to appear under different conditions). Furthermore, it can be difficult to predict the relative abundances of the different metabolites. For example, various attempts to construct a pathway for astaxanthin synthesis in a heterologous host resulted in quite different proportions of astaxanthin and intermediates (76, 135). In another example, introduction of the carotenoid biosynthetic enzymes CrtB, CrtI, CrtY, and CrtZ from Pantoea agglomerans (Erwinia herbicola) into a desaturase-deleted mutant of Rhodobacter sphaeroides merely restored desaturation activity and failed to alter the range of carotenoids produced (85). This occurred despite the introduction of a β-cyclase (CrtY) and a β-end hydroxylase (CrtZ) into a host lacking these catalytic functions. Only when the endogenous neurosporene hydroxylase gene (crtC) was deleted was a functional pathway to cyclized and hydroxylated carotenoids realized (69, 70). In this case, the endogenous CrtC in R. sphaeroides may have been so active that the desaturase CrtI, cyclase CrtY, and β-end hydroxylase CrtZ introduced from E. herbicola could not compete with it for neurosporene. Another possible explanation is that incorporation of CrtC into a carotenoid biosynthetic enzyme complex blocked the additional inclusion of CrtY, CrtZ, and more than three desaturase subunits. These examples illustrate the importance of properly coordinating pathway enzymes in order to create a specific pathway to a desired product. This problem of miscoordination makes it exceedingly difficult to systematically explore all the possible metabolites of a given set of enzymes solely by gene assembly. A major task of pathway engineers will be to coordinate assembled components in order to unmask hidden metabolites. This can be accomplished by directed evolution. 17 Engineering pathways by directed enzyme evolution Nature has generated a vast number of biosynthetic genes by mutation, recombination, and natural selection. Variations in properties such as desaturation step number or synthase specificity contribute enormously to the diversity of carotenoid structures seen in nature. In the previous section, we presented examples of how gene assembly alone can lead to novel or unusual carotenoids. However, we can also consider creating enzyme variants with desired specificities (or other properties such as expression level or stability) by evolving them in the laboratory. This approach circumvents the need to find a specific function in nature and reproduce that function in a heterologous host. Instead, enzymes with the desired properties are found by screening libraries of mutants of an enzyme that performs the same type of chemical transformation. Some enzyme specificities not available in nature become readily available by evolution in the laboratory, opening pathways to new metabolites. Decoupled from the biological constraints imposed by the need to fulfill a particular function throughout the course of evolution, a pathway can in principle explore all chemically accessible products, not just those that are biologically relevant (10). Thus, directed evolution gives us the ability to explore the space of possible chemical products much more rapidly and also more thoroughly than does natural evolution. By evolving biosynthetic enzymes, we can anticipate the discovery of large numbers of new natural products, on the benchtop in convenient laboratory hosts. Although each directed evolution project is unique, all involve two main steps: making a library of mutants and searching that library for desired properties. The mutant library is typically generated in an error-prone PCR amplification reaction (39, 124) 18 tuned to generate a certain average point mutation rate or by DNA shuffling, a method that makes new point mutations and recombines existing mutations (193) (many methods are available for making libraries of mutant genes for directed evolution; useful protocols are given in reference (9)). The library of mutated DNA molecules is then subcloned into an appropriate vector for expression with other pathway genes in a convenient host organism such as E. coli. Hundreds or thousands of clones are screened in search of (typically) rare ones expressing favorably altered enzymes. A powerful aspect of this process is that it can be iterated—improved variants can be subjected to further rounds of mutagenesis and screening, often leading to further improvements. A sensitive, reliable screen is key to a successful directed evolution experiment: the screen allows the researcher to identify the typically rare mutants with new and interesting properties. Different strategies exist for evolving metabolic pathways in the laboratory. In an early study, multiple genes in an arsenate degradation pathway were subjected to mutagenesis and recombination all at once (50). This “fully blind” approach makes the most sense when little is known about which genes or non-coding regions (such as ribosomal binding sites) should be mutated to obtain a desired phenotype. However, a significant disadvantage of this approach is that the combinatorial complexity (the size of the library) increases concomitantly with the length of DNA targeted for mutation. Consequently, more clones must be screened to find the rare ones with improved properties. Therefore, when possible, it is attractive to target individual genes for mutation and then screen those mutants in the context of the whole pathway; this can be thought of as a “partially blind” approach. Carotenoid biosynthetic pathways are sufficiently well characterized that investigators generally know which enzyme to target 19 for mutagenesis in order to achieve a new product distribution; however, the specific mutation(s) needed is unknown. Accordingly, researchers have thus far chosen to extend carotenoid pathway branches in a stepwise manner by evolving one gene at a time and expressing the library of variant alleles together with other wild-type or previously laboratory-evolved pathway genes. Schmidt-Dannert et al. demonstrated the effectiveness of this approach for diversifying the range of carotenoid structures accessible from a given set of enzymes (181). PROBING THE EVOLVABILITY OF CAROTENOID BIOSYNTHETIC ENZYMES AND PATHWAYS In the Introduction, we reasoned that highly evolvable pathways would be assembled from locally specific downstream enzymes and (a small number of) more specific “gatekeeper” enzymes. Furthermore, the enzymes themselves should readily alter specificity upon mutation. Modifying a gatekeeper enzyme, accompanied by fine-tuning of downstream enzymes where needed, could allow whole new families of natural products to emerge. In this section, we assess the evolvability of carotenoid biosynthetic pathways and enzymes in view of the (laboratory) data now available. Directed evolution of key carotenoid biosynthetic enzymes Isoprenyl diphosphate synthases. Isoprenyl diphosphate synthases (IDSs) catalyze the consecutive condensation of five-carbon isopentenyl diphosphate with allylic diphosphates to generate the precursors to all isoprenoid compounds. A variety of IDSs supply the building blocks for the >33,000 known isoprenoids (89) ranging in size from C5 to C~2,500 (49, 146). IDSs catalyze the 1'–4 condensation of an allylic diphosphate 20 (C5nPP) with isopentenyl diphosphate, producing the next incremental isoprenyl diphosphate (C5(n+1)PP) (Figure 1.4). This process continues until the growing isoprenoid chain reaches a certain length, at which point the reaction terminates and the product is released from the enzyme. There exist E-type IDSs that synthesize products with precise all-E (trans) double-bond stereochemistry as well as Z-type IDSs that catalyze the formation of cis-double bonds in the growing isoprenyl chain. IDS enzymes are quite specific in their product size and are often classified on this basis. Elucidating the molecular mechanisms of chain length control has been a major scientific interest in the study of this class of enzymes; for reviews, see references (97, 122, 145, 225). Although IDSs make specific products, minor modifications can change this specificity. Ohnuma et al. randomly mutated the farnesyl diphosphate (C15PP) synthase gene from Bacillus stearothermophilus (bstFPS), coexpressed this mutant library along with phytoene synthase (crtB) and phytoene desaturase (crtI) genes in E. coli, and looked for colonies that produced the red C40 carotenoid, lycopene (152). Most of the colonies were colorless because they lacked the C20PP precursor needed by CrtB to make carotenoids. However, a small fraction of the colonies were pink due to lycopene production; these harbored mutant C15PP synthases capable of synthesizing C20PP. In further work, the same group generated additional variants of BstFPS that made even longer products (150). Some of the double and triple mutants of this enzyme yielded products as large as C>100PP. In another study, Ohnuma et al. converted an archaebacterial C20PP synthase into C25PP and C30PP synthases by mutagenesis coupled with complementation screening in a yeast strain deficient in C30PP synthesis (148). In all the above cases, analysis of mutants making larger products revealed substitutions for 21 smaller amino acids at a position 5 residues upstream of the first aspartate-rich motif (FARM) of the enzyme (151). Aided by the crystal structure of Gallus gallus (chicken) C15PP synthase (204), Tarshis et al. independently found a similar result with this enzyme (203). Site-directed mutagenesis at the fifth (F112) and fourth (F113) residues upstream of the FARM showed that smaller amino acids at these positions yielded enzymes that produce longer products. Subsequent work also demonstrated the converse: replacement of chain-length determining residues just upstream of the FARM with larger amino acids leads to shorter products. For example, Sulfolobus acidocaldarius C20PP synthase was rationally converted into a C15PP synthase using this approach (149). The C15PP synthases from B. stearothermophilus and G. gallus were converted to geranyl diphosphate (C10PP) synthases by the same strategy (61, 141). This strategy of substituting residues just upstream of the FARM with smaller or larger amino acids has also been applied to a plant short-chain (C20PP) IDS (104), heterodimeric medium-chain (C30PP and C35PP) IDSs (78, 81, 238), as well as long-chain (C40PP-C50PP) synthases (75, 153) to alter the product chain length. In several cases, substitution of residues lining the substrate binding pocket but distant from the FARM (or even located on the opposite subunit in heterodimeric enzymes) has also modified the product chain length (75, 77, 80, 92, 96, 148, 152, 238, 239). Many of these substitutions enhance the effects of mutations upstream of the FARM, leading to even greater changes in the product chain length. Several C15PP synthases have some degree of substrate tolerance (57, 107) and can be used for stereospecific synthesis of various insect hormones and related analogs (102, 106, 126). BstFPS was found to accept a number of nonnatural substrates (140), 22 and its substrate range was further broadened by substitutions at Y81, previously described as a chain length-determining residue (151) (see above). The Y81A variant of BstFPS, for example, accepts various isoprenyl diphosphate analogs with ω-oxygen atoms in their prenyl chains as substrates, leading to the enzymatic synthesis of butterfly hair pencil pheromone and analogs (125). In theory, all of these isoprenoid diphosphate analogs could serve as building blocks for the enzymatic synthesis of carotenoid analogs. IDSs from diverse species have exhibited evolvability in the laboratory. Although the wild-type IDSs are quite specific with respect to product size, minor genetic changes were found to profoundly alter the number of elongation steps and therefore the size of the products formed by these enzymes. The residues that were found to change the specificity of these IDSs upon mutation form a key part of the reaction pocket that accommodates the elongating isoprenoid chain, and it appears that product specificity is largely dependent on the size of this pocket (61, 203). Inspection of the data from the reports describing the modification of product specificity reveals that, in general, the mutant IDSs have a broadened rather than a shifted product range. In most cases, mutants synthesize multiple new products as well as the old one. In contrast, wild-type IDSs, although related by evolution, are very specific with respect to the length of their products. We now know that a single amino acid substitution can broaden the product range of an IDS. However, we do not know the degree of genetic change required to completely shift IDS product specificity such that it synthesizes only isoprenyl diphosphates of a new length. Carotenoid synthases. Carotenoid synthases catalyze the synthesis of a carotenoid backbone from isoprenyl diphosphate precursors. Various phytoene (C40) 23 synthases have been isolated from organisms ranging from bacteria to higher plants. Only one C30 carotenoid synthase has been cloned and sequenced to date: crtM from Staphylococcus aureus (226). It has long been recognized that the enzyme-catalyzed reaction leading to formation of the carotenoid backbone is very similar to the reaction catalyzed by squalene synthase (SqS), the first committed enzyme in cholesterol biosynthesis (32). Carotenoid synthases and SqS employ the same mechanism, and SqS produces the C30 carotenoid backbone if deprived of NADPH (88, 202, 237). Carotenoid synthases and SqS also share several highly conserved domains, and it is likely that the two have a common evolutionary origin (176). The biosynthesis of carotenoid backbones (and squalene) has proven to be a complex process (22, 88, 89) (Figure 1.5a). The reaction proceeds in two distinct steps. The first consists of abstraction of a diphosphate group from a prenyl donor followed by 1-1' condensation of the donor and acceptor and loss of a proton to form a stable cyclopropyl intermediate. In the second step, the cyclopropyl intermediate is rearranged, the second diphosphate group is lost, and the resultant carbocation is quenched after the loss of another proton (Figure 1.5a). Biochemical (156) and structural (159) studies have shown that these two subreactions occur in physically distinct sites in the enzyme (Figure 1.5b). Carotenoid synthases are quite specific with respect to product size, which reflects a strong preference for prenyl diphosphate substrates of a particular length. The C40 carotenoid synthase CrtB does not detectably accept C15PP as a substrate, while the C30 synthase CrtM accepts two molecules of C20PP to form C40 carotenoids much less 24 efficiently than it accepts two molecules of C15PP to form C30 carotenoids (163, 214). Even though various longer and shorter isoprenyl diphosphates are made by different organisms (146), no known carotenoids are derived from them. Terpene synthases also utilize specific precursors (42), although product specificity can be quite modest (190). Carotenoid synthases, positioned early in the biosynthetic pathway and possessing the ability to discriminate between isoprenyl diphosphate substrates with different numbers of isoprene units, appear to play the role of pathway gatekeeper, particularly in organisms in which multiple potential substrates are available. Indeed, as we illustrate, downstream carotenoid biosynthetic enzymes are less specific than the synthases and appear to recognize only a particular motif of the substrate. In the Introduction, we reasoned that gatekeeper enzymes should be attractive targets for pathway diversification. If carotenoid synthases could be engineered to accept different prenyl substrates and synthesize carotenoid backbones from them, the locally specific downstream enzymes might accept these new backbones and generate the corresponding metabolites. This would give rise to whole new pathway families. Compared to the IDSs, however, little is known about the molecular basis for the substrate and product specificity of carotenoid synthases. Following the lead of those who studied the IDSs (96, 122, 125, 141, 147, 148, 150-152, 203, 238, 239), we probed the evolvability of size specificity in the carotenoid synthases by looking for mutants that complement a non-native pathway. Using errorprone PCR to perform random mutagenesis, expressing the mutant genes with the remaining genes necessary to produce lycopene in E. coli, and screening to find red colonies, we identified single amino acid substitutions in the S. aureus C30 carotenoid 25 synthase CrtM (F26L or F26S) that confer the ability to make the C40 backbone just as efficiently as CrtB (Chapter 2, (214)). Repeating this experiment using a PCR method designed to guarantee that the libraries would be free from mutation at F26 allowed us to uncover two additional amino acid substitutions, W38C and E180G, that also confer C40 function on CrtM (213). Mapped onto the crystal structure of human squalene synthase (SqS, see Figure 1.5b), F26 and W38 appear in helices B and C, respectively, and the side chains of both residues point into the pocket that accommodates the second halfreaction (rearrangement of the cyclopropyl intermediate). Replacement of these amino acids with smaller ones significantly increased the C40 synthase activity of CrtM (Figure 1.5c). Conversely, the C30 synthase performance was the highest for wild-type CrtM and decreased with decreasing size of the amino acid residues at these positions. This analysis led to our proposal that wild-type CrtM is able to perform the rate-limiting first halfreaction of phytoene synthesis—condensation of two molecules of C20PP to form the cyclopropyl intermediate, prephytoene diphosphate—but the second half-reaction is prevented from going to completion by steric inhibition of the normally fast rearrangement step. Unable to convert into phytoene in wild-type CrtM, prephytoene diphosphate either remains stuck in the enzyme, departs, or undergoes other types of rearrangement to yield noncarotenoid products. (A similar phenomenon is well known for SqS; in the absence of NADPH, which is required to convert presqualene diphosphate to squalene, SqS produces a complex mixture of non-squalene compounds including rillingol, 10-hydroxybotryococcene, and 12-hydroxysqualene (22, 89).) However, in CrtM mutants where F26 or W38 is replaced with a smaller or more flexible amino acid, the prephytoene diphosphate formed from two molecules of C20PP is efficiently 26 rearranged to form phytoene. Thus, the F26 and W38 mutations apparently modify the product specificity, not the substrate specificity of CrtM: they do not act by allowing the enzyme to bind and accept GGPP as a substrate but, rather, allow the intermediate prephytoene diphosphate to be converted to phytoene. Gain of C40 function by mutagenesis of CrtM usually came at a cost to the original C30 synthase activity. For example, some enzymes doubly mutated at F26 and W38 showed only negligible C30 synthase activity. However, other modes of obtaining C40 synthase activity were possible. The E180G substitution increased performance in both the C30 and C40 contexts (212). Mapped onto the SqS structure, E180G is positioned outside the reaction pocket but close to the site of the first half-reaction. We think this mutation accelerates the rate-limiting first half-reaction. Several such activating mutations were found by random mutagenesis of CrtMF26S in a successful search for improved or restored C30 function (D. Umeno, unpublished results). All of these activating mutations were rather far from the reaction center (Figure 1.5b, indicated in yellow) and enhanced both C30 and C40 synthase activity. These mutations could be increasing expression level, stability (half-life in vivo), or specific activity. Like IDSs, carotenoid synthases appear to be specific, but at least in the case of CrtM, that specificity is readily altered by mutation. Furthermore, there are multiple mutational routes to the same altered phenotype. In contrast, in similar experiments with CrtB, we were unable to find any mutations that conferred C30 carotenoid synthase function. We are tempted to speculate that CrtM, by virtue of the fact that it does not need to select C15PP from C20PP in its natural host (C20PP is not made in C30 carotenoidproducing organisms), is inherently more evolvable toward accepting C20PP than is CrtB 27 toward accepting C15PP because CrtB has always had to select C20PP over C15PP (the latter is present in all organisms). CrtM can in fact accept C20PP in a hybrid reaction: when supplied with both C15PP and C20PP, wild-type CrtM can condense one molecule of each to synthesize a C35 carotenoid backbone (see below). CrtM has thus proven to be an evolvable enzyme, while CrtB has not, at least with respect to the specific tasks of accepting a larger (CrtM) or smaller (CrtB) substrate. As was the case with the IDSs, a single amino acid substitution was sufficient to increase the size of the products synthesized by CrtM. Furthermore, as we describe below, the mutants of CrtM that function in a C40 carotenoid biosynthetic pathway are also capable of synthesizing even larger carotenoid backbones when supplied with the appropriate precursors. Carotenoid desaturases. Phytoene and 4,4'-diapophytoene, the (colorless) products of the natural carotenoid synthases, have three conjugated double bonds in the center of their backbones. Formation of carotenoid pigments requires extension of this conjugated double-bond system. The photochemical properties of a carotenoid (including its color) depend strongly on the size of the chromophore and therefore on the number of desaturation steps catalyzed by the desaturase enzyme(s). A C40 backbone can accommodate up to 15 conjugated double bonds, corresponding to six sequential desaturation steps. C30 carotenoids can undergo at most four desaturation steps (11 conjugated double bonds). In general, bacterial C40 desaturases are functional on C30 carotenoids and vice versa. It is proposed that carotenoid desaturases recognize only a portion of the substrate molecule common to both C30 and C40 carotenoid backbones (163, 174). Subsequent carotenoid-modifying enzymes are also often locally specific (see below). Because each 28 of the desaturation intermediates represents a branch point for further diversification by downstream enzymes, altering and controlling the desaturation step number is key for creating extensive molecular diversity (70). Nature has done this: many different carotenoid desaturases are known in C40 pathways, each with its specific step number. Carotenoid desaturases that primarily catalyze two, three, four, and five desaturation steps are known; one-step and six-step desaturated carotenoids have been reported only as minor products in natural carotenogenic organisms. The ability of carotenoid desaturases to accept different substrates was demonstrated when C30 and C40 desaturases were tested in each other’s pathway (163, 214). C40 desaturases from Erwinia (four-step enzymes), Rhodobacter (three-step), and Anabaena (two-step) are all active on C30 substrates. Similarly, the C30 desaturase CrtN showed measurable activity in a C40 pathway. The localized specificity of these desaturases has been exploited in engineered pathways (211) (see below). The desaturase step number can be inferred from the color (or color change) of the carotenoids produced in vivo. This provides an excellent basis for screening mutant desaturases in the laboratory for the ability to accept new substrates or for changes in product specificity. Using this principle, Schmidt-Dannert et al., working in this laboratory, readily isolated desaturase variants with altered step number in a C40 pathway (181). Starting from a library made by DNA shuffling of two closely related four-step phytoene desaturases (crtI from Pantoea agglomerans [E. herbicola] and crtI from Pantoea ananatis [E. uredovora]), they isolated one four- to six-step variant, CrtI14 (Figure 1.6), as well as 20 variants that catalyze fewer than four desaturation steps on phytoene. Wang and Liao conducted similar experiments with the three-step desaturase 29 from Rhodobacter sphaeroides (222). Two rounds of random mutagenesis by error-prone PCR and color screening resulted in variants that accumulated the four-step product, lycopene. At least five different mutations increased the step number of this desaturase. Furthermore, some combinations of mutations resulted in yet higher production of lycopene (222). We recently investigated the ability of the C30 desaturase CrtN from S. aureus to alter its product specificity upon mutation. CrtN is a three-step desaturase in S. aureus (226). E. coli colonies expressing this enzyme together with the C30 synthase CrtM develop a yellow-orange color due to the production of 4,4'-diaponeurosporene (three steps) and 4,4 '-diapolycopene (four steps). When E. coli were transformed with a library of crtN mutants made by error-prone PCR, the variation in the colors of the colonies (Figure 1.7), from pale to weakly fluorescent, lemon, yellow, orange, and red, was striking. To our surprise, approximately 30% of the colonies were lemon or yellow in color, different from the wild type. A random subset of these clones was shown to produce the rare C30 carotenoids 4,4'-diapophytofluene (one-step desaturation) and 4,4'diapo-ζ-carotene (two steps). We also isolated a large number of red mutants, which were found by high-performance liquid chromatography (HPLC) analysis to produce mainly 4,4'-diapolycopene (four desaturation steps) (Figure 1.7). Multiple experiments have thus shown that bacterial carotenoid desaturases are evolvable. The high frequency of color variants in the mutant libraries suggests that there are multiple mechanisms by which the step number can change upon mutation. It is possible that most (if not all) mutants with altered desaturation step number have acquired this change in product specificity by up- or down-regulating total desaturase 30 activity rather than by altering intrinsic enzyme specificity, which we would expect to occur only rarely. The higher frequency of mutants with a lower desaturation number compared to mutants with an elevated desaturation number supports this idea because there are many more paths downward with respect to a property such as activity or expression level. Many mutant desaturases with elevated step numbers turned out to have mutations near a putative flavin adenine dinucleotide (FAD)-binding domain (181, 222), indicating that FAD access might be a source of step number control. Carotenoid desaturases tend to exhibit more well-defined product specificity in their natural hosts than when (over)expressed in a heterologous host. For instance, CrtN appears to be a three-step enzyme and produces almost exclusively 4,4'diaponeurosporene in S. aureus (226). In a heterologous host, however, its desaturation step number is less distinct. Several groups have reported that CrtN produces the fourstep 4,4'-diapolycopene as a major product in an E. coli system (118, 163, 211, 214). Desaturase step number can also be altered by manipulation of enzymes further downstream in the carotenoid pathway (69). It is not surprising that altering the environment of a desaturase can alter its product specificity. If downstream enzymes that normally remove certain desaturation products are not present, the desaturase may have an opportunity to catalyze further desaturation steps. In addition, if these enzymes associate in complexes, expression of a desaturase with other carotenoid biosynthetic genes from different organisms could yield complexes with altered or suboptimal substrate transfer properties, which could affect the desaturation step number. Further research should shed light on the source of desaturase specificity and on the ways in which specificity can be altered. 31 Carotenoid cyclases. Cyclization is another important branch point for carotenoid diversification. Cyclic carotenoids are produced in plants, algae, and photosynthetic bacteria, and enzymes catalyzing the formation of different cyclic products have been characterized (11, 53, 55, 84, 109-111, 194). A given cyclase usually produces only one kind of ring structure (32). However, an exception was recently reported by Stickforth et al., who showed that the enzyme CrtL-e from the cyanobacterium Prochlorococcus marinus is both a β- and an ε-cyclase (194). The cyclases share nearly identical mechanisms, differing only in the final rearrangement step (Figure 1.8a). Although lycopene, with its two ψ-ends, is the natural substrate for most known cyclases, studies have shown that some cyclases can act on a wider range of substrates (Figure 1.8b). An ability to convert different substrates was reported for Arabidopsis εend lycopene cyclase, which can cyclize the ψ-end of neurosporene to form αzeacarotene (54, 55). Britton noted that the only apparent requirement for recognition and catalysis by carotenoid cyclases is that the substrate have a ψ-end (Figure 1.8b) (32). However, Takaichi et al. showed that bacterial and plant lycopene cyclases can cyclize the 7,8-dihydro-ψ-end of ζ-carotene and neurosporene (199). Recently, we showed that E. uredovora β-cyclase and a plant ε-cyclase can efficiently cyclize nonnatural carotenoids with a C35 backbone (211). Similarly, Lee et al. reported that the C30 carotenoid 4,4'diaponeurosporene can be cyclized by Erwinia β-cyclases, leading to the novel cyclic C30 carotenoid diapotorulene (118). Another interesting enzyme is capsanthin-capsorubin synthase (CCS) from Capsicum annuum. The primary natural function of CCS is to rearrange the epoxidized cyclic carotenoids antheraxanthin and violaxanthin into the cyclopentyl κ-end products capsanthin and capsorubin. When expressed in E. coli, 32 however, CCS was shown to also possess lycopene β-cyclase activity, cyclizing both ends of lycopene to yield β,β-carotene (84). All known β-cyclases, except one recently discovered in a marine bacterium (207), create rings at both ends of lycopene. In contrast, known ε-cyclases except those from Lactuca sativa (lettuce) and the flower Adonis aestivalis generate monocyclic carotenoids (53). In an attempt to manipulate the ring number and understand how it is determined, Cunningham and Gantt constructed a series of single-crossover chimeras of one-step (Arabidopsis thaliana) and two-step (Lactuca sativa) ε-cyclases (53). Analysis revealed a region of six amino acids involved in ring number determination. Further mutagenesis experiments identified single-amino-acid substitutions that alter ring number specificity: in the lettuce two-step cyclase Dy4, substitution of H457 with leucine converted the enzyme into a monocyclase; the corresponding L448H mutation in Y2, the Arabidopsis monocyclase, resulted in an enzyme that forms two rings. Thus, ring number specificity can be modulated with a single amino acid substitution. The authors of this study suggested that the residues they identified may play a role in dimer formation (53). Lycopene may be oriented in the plasma membrane such that one of its ends is more accessible to the cyclase than the other. Only when cyclase dimers are formed does binding of the more accessible end bring the less accessible end close enough to the other subunit for it to be cyclized as well. An alternative but similar explanation for the above observations is that the mutations alter the cyclase oligomerization state within a carotenoid-synthesizing complex. For example, when one cyclase subunit is present in each complex, carotenoid products are cyclized on only one end whereas complexes with two cyclase subunits would cyclize carotenoids at both ends. Association of cyclase 33 monomers in a complex would depend on their interactions with each other and the other constituents of the complex, and a single amino acid substitution could be sufficient to disrupt (or promote) this association. It is also possible that the single amino acid substitutions described above alter the enzyme’s intrinsic preference for the carotenoid substrate that has already been cyclized on one end. The H457L mutation may reduce the preference of Dy4 for the monocyclic substrate, while the L448H mutation increases the ability of Y2 to cyclize it. CrtI14 is a four- to six-step desaturase, and E. coli cells expressing this variant along with CrtE (a C20PP synthase) and CrtB (a C40 carotenoid synthase) can synthesize 3,4,3',4'-tetradehydrolycopene (Figure 1.6) (181). When CrtY, the β-cyclase from Erwinia, was coexpressed with these enzymes, the cells synthesized exclusively β,βcarotene—the same product made by cells expressing wild-type CrtE, CrtB, CrtI, and CrtY. Directed evolution, however, could create a pathway leading to a new cyclized product: after performing DNA shuffling to make a library of CrtY variants and coexpressing these with CrtI14 and CrtE, Schmidt-Dannert et al. identified clones that accumulated the monocyclic carotenoid torulene (Figure 1.6) (181). Pigment analysis from cells harboring the CrtY mutants including CrtY2 (Figure 1.6) revealed torulene together with lycopene, 3,4,3',4'-tetradehydrolycopene, β,ψ-carotene, and β,β-carotene. Torulene-producing variants were also discovered when the CrtY library was created by error-prone PCR (D. Umeno, unpublished results). These mutants made up 2 to 5% of the library. This high frequency of torulene-producing mutants suggests that the torulene pathway emerged by down-regulation of cyclase activity. Mutants of CrtY with decreased catalytic activity would compete less efficiently with CrtI14 for the ends of the carotenoid 34 substrate, with the result that only one end is cyclized while the other is desaturated, leading to torulene. Alternatively, the CrtY mutants found in the torulene-producing clones may be compromised in their ability to form dimers, either as part of larger carotenoid enzyme complexes or not. Although the underlying mechanisms for the changes in cyclase step number remain obscure, it is clear that carotenoid cyclases are evolvable: their phenotype can change dramatically with a small number of mutations, and there appear to be multiple pathways to a particular phenotype. As we show in the next section, combining evolved carotenoid desaturases and cyclases with locally specific enzymes further downstream allows an even larger natural product space to be sampled. To date, carotenoid cyclases have not been evolved in the laboratory for altered product specificity, for example to convert a β-cyclase to an ε-cyclase or vice-versa. These cyclases have very similar chemical mechanisms (Figure 1.8a), and we predict that cyclase product specificity will be easily modified by mutation. Enzymes catalyzing further modifications. Numerous enzymes catalyzing hydroxylation, epoxidation, glycosylation, O-methylation, acyl transfer, prenyl transfer, oxidative cleavage, and other reactions on cyclic and acyclic carotenoids have been cloned and expressed in E. coli (for reviews, see references (175) and (180)). Misawa et al. made an early demonstration of the localized specificity of these modifying enzymes (135). Introduction of the β-end 3-hydroxylase CrtZ and the β-end 4-ketolase CrtW into E. coli harboring a β,β-carotene pathway led to the accumulation of as many as nine carotenoids (Figure 1.3). Recent work has revealed that many carotenoid-modifying enzymes act on a range of substrates (5, 16, 118, 191, 197). Lee et al. exploited the catalytic promiscuity of a number of 35 carotenoid- modifying enzymes in an E. coli system to extend laboratory-evolved pathways to 3,4,3',4'-tetradehydrolycopene and torulene, generating biosynthetic routes to several carotenoids not identified in nature (118) (Figure 1.6). CrtA, an oxygenase from Rhodobacter capsulatus that normally acts on the methoxy carotenoid spheroidene, was found to insert one keto group into ζ-carotene, neurosporene, and lycopene, and to insert two keto groups into tetradehydrolycopene. Monocyclic torulene, synthesized via the pathway constructed using the laboratory-evolved desaturase and cyclase (181), served as a substrate for CrtO, a β,β-carotene ketolase from Synechocystis sp. strain PCC 6803; CrtU, a β,β-carotene ring desaturase from Brevibacterium linens; and CrtZ, a β,βcarotene hydroxylase from E. herbicola. In addition, 3-hydroxytorulene, the product of the action of CrtZ on torulene, was further metabolized by CrtX, a zeaxanthin glycosylase from E. herbicola, leading to the synthesis of torulene-3-β-D-glucoside (Figure 1.6). In this work, the pathway to torulene generated by directed evolution of two upstream carotenoid biosynthetic enzymes was extended in several different directions by adding genes for further transformations. Owing to their intrinsic localized specificity, coexpression of these downstream modifying enzymes with the foreign torulene pathway resulted in a series of novel torulene derivatives. There are no reports yet of directed evolution of carotenoid oxygenases or postcyclase carotenoid-modifying enzymes. Work by Sun et al. (197), however, provides an interesting example of how modifying the sequence of a carotenoid hydroxylase can alter the enzyme’s product distribution. The β,β-carotene hydroxylase from A. thaliana catalyzes two hydroxylation steps, converting β,β-carotene to zeaxanthin (>90%) in A. 36 thaliana and when expressed in E. coli (Figure 1.9). Noticing that this enzyme had an Nterminal extension of more than 130 amino acids compared with other known β,βcarotene hydroxylases, Sun et al. expressed in E. coli a truncated version of the Arabidopsis hydroxylase lacking the N-terminal 129 amino acids. The truncated enzyme primarily catalyzed only one hydroxylation step, and β-cryptoxanthin (Figure 1.9) accumulated as the main product (>75%) (197). The molecular basis for this altered hydroxylation step number is not known; the authors speculated that truncation yielded an enzyme deficient in the ability to form dimers. Carotenoid cleavage enzymes comprise an important class of carotenoidmodifying enzymes. Enzymatic oxidative cleavage of carotenoids in both carotenogenic and non-carotenogenic organisms creates diverse “apocarotenoid” structures, many of which are highly biologically significant (71). Well-known products of carotenoid cleavage enzymes include retinol and retinoic acids (mammalian hormones) (220), abscisic acid (a plant growth regulator) (186, 236), and the plant pigment bixin (28). The localized specificity of several carotenoid cleavage enzymes has recently been demonstrated. One important cleavage enzyme is β,β-carotene-15,15'-monooxygenase (βCM, formerly named β,β-carotene-15,15'-dioxygenase before the enzyme was shown to employ a monooxygenase mechanism (121)), which converts β,β-carotene into retinal (Figure 1.10a) (158, 165, 219, 231, 232). βCM cleaves substrates other than β,βcarotene, such as α-carotene (228) and β-cryptoxanthin (Figure 1.10a) (123, 228). The enzyme has a strong preference for substrates with at least one unsubstituted β-end (123, 228) and appears to always cleave a substrate’s central 15-15' double bond (115). Recently discovered homologs of βCM catalyze the asymmetric cleavage of carotenoids 37 (28, 98, 186). One murine oxygenase cleaves β,β-carotene at the 9'-10' double bond (Figure 1.10b), yielding β-apo-10'-carotenal (C27) and β-ionone (C13) (98). This enzyme also catalyzes the cleavage of lycopene, resulting in the formation of apolycopenals (Figure 1.10b) (98). Another carotenoid cleavage enzyme from A. thaliana was shown to cleave an impressive array of different substrates in vitro (Figure 1.10c) (185). Thus, carotenoid cleavage enzymes are quite versatile and their localized specificity may be exploited to generate diverse new carotenoid derivatives in the laboratory. Creation of pathways to carotenoids with new carbon scaffolds Given the proven evolvability of different enzymes involved in carotenoid biosynthesis, we investigated the possibility of creating routes to whole new families of carotenoids built on scaffolds other than the symmetric C30 and C40 backbones seen in nature. We reasoned that if carotenoid synthases could be engineered to accept different substrates and synthesize unnatural carotenoid backbones, locally specific downstream enzymes might accept and modify these backbones, leading to whole new families of carotenoids. The downstream enzymes could also be evolved to produce still more novel products or to function more efficiently on their new substrates. Compared to increasing the diversity of known C30 or C40 carotenoids by altering the specificity of downstream pathway enzymes, generating entire new pathway families by focusing on upstream enzymes has a much greater capability to explore new carotenoid structures. The entire space of carotenoids built on non-C30 or non-C40 backbones, for example, is uncharted. Generating novel chain length carotenoids can also be viewed as a rigorous test of carotenoid pathway evolvability. A particularly exciting goal is to generate carotenoids with chromophores or 38 physico-chemical properties not possible in carotenoids based on natural backbones. Millions of years of evolution gave rise to the ~700 carotenoids known in nature. Laboratory evolution of new carotenoid pathways based on unnatural backbones has the potential to at least double or triple this diversity. If significant numbers of new products can be generated, laboratory pathway evolution would be validated as an important tool for preparing large natural product libraries from which compounds with valuable properties and biological activities can be discovered. A C35 carotenoid pathway. We recently discovered that the C30 synthase CrtM could assemble a 35-carbon backbone when supplied with C15PP and C20PP precursors (211). When transformed with crtE from E. uredovora (encoding a C20PP synthase) and crtM from S. aureus, E. coli cells accumulate 4-apophytoene, an asymmetrical C35 carotenoid formed via heterocondensation of C15PP and C20PP (Figure 1.11). This novel backbone comprised 40 to 60% of total carotenoids, with C30 4,4'-diapophytoene and C40 phytoene as minor components. We found that the C35 backbone was further metabolized by various C40- and C30carotenoid biosynthetic enzymes, creating a family of new C35 carotenoids (Figure 1.11). Carotenoid desaturases from C40 (Erwinia CrtI) or C30 (Staphylococcus CrtN) pathways efficiently converted the C35 backbone to yield acyclic carotenoids with different levels of desaturation (211). It is interesting to note that the C30 desaturase CrtN showed a higher step number (four or five steps) in the C35 pathway than in its native C30 pathway (three or four steps) or in a C40 pathway (two or three steps). Thus, E. coli cells expressing CrtN develop an intense red color only when they produce the C35 substrate. The larger number of desaturation steps catalyzed on a C35 substrate may reflect a 39 tradeoff between the enzyme’s substrate preference and the number of desaturation steps the substrate can possibly undergo. CrtN most probably prefers its native C30 substrate, but the C40 substrate can undergo more desaturations. With a C35 substrate, a balance of these two factors can yield the high observed step number if, for example, the enzyme (or enzyme complex) binds the “C30-like” end of the C35 substrate strongly and catalyzes one or more additional desaturation steps on the “C40-like” end compared with a C30 substrate. Other scenarios can also plausibly lead to the same result. Assembling the enzymes for the new backbone (CrtE and CrtM) with wild-type desaturases provided some of the possible C35 desaturation products. The remaining desaturation products were obtained by directed evolution. Random mutagenesis of carotenoid desaturases expressed in E. coli synthesizing the C35 carotenoid backbone generated colonies having a spectrum of colors, which reflected desaturase mutants with altered step numbers (211). In fact, individual clones that produced each of the possible acyclic C35 carotenoids as the main product were identified (Figure 1.11). Addition of the β-cyclase CrtY from E. uredovora or the ε-cyclase Dy4 (L. sativa) further diversified the C35 pathway, yielding at least four new monocyclic C35 carotenoids (Figure 1.11). As discussed in the Introduction, some fungi naturally accumulate carotenoids with 35 carbon atoms (12, 14, 164, 215). All of these are monocyclic oxygenated carotenoids (xanthophylls) and are believed to result from the action of an unidentified oxidative cleavage enzyme on C40 carotenoids such as torulene. Disruption of cyclase activity in Neurospora crassa resulted in the biosynthesis of an acyclic C35 xanthophyll (12). These C35 xanthophylls and the biosynthetic routes leading to their formation are qualitatively different from laboratory-generated C35 carotenoids biosynthesized via 40 heterocondensation of C15PP and C20PP. Notably, the direct route to the C35 carotenoid backbone 4-apophytoene opens many possibilities for further pathway diversification by downstream enzymes (desaturases, cyclases, etc.) whereas many fewer options exist for diversifying the already desaturated, cyclized, and oxygenated C35 carotenoids found in fungi. Because C35 carotenoids have asymmetric backbones, each desaturation step can potentially yield more than one product, depending on the direction of the desaturation step (and the previous steps). Thus, acyclic C35 carotenoids with 3, 5, 7, 9, 11, and 13 conjugated double bonds can assume 1, 2, 3, 3, 2, and 1 (a total of 12) possible structures, respectively. In this sense, the C35 pathway is inherently more complex and explores a much larger “structure space” than do pathways based on the symmetric C30 and C40 carotenoid backbones. Cyclization and other modifications of the backbone can further increase the number of possible C35 carotenoids. Considering their broad substrate tolerances, we expect that other carotenoid-modifying enzymes will also be functional in this C35 pathway and that one could make many hundreds of new carotenoids. The generation of a new, full-fledged C35 carotenoid biosynthetic pathway in the laboratory is a convincing demonstration of the evolvable nature of carotenoid biosynthetic enzymes and pathways and serves as an excellent illustration of how gene assembly coupled with directed evolution can rapidly access diverse chemical structures. Carotenoids with longer backbones. The C25PP isoprenoid precursor farnesylgeranyl diphosphate and the C30PP hexaprenyl diphosphate serve as components of archaebacterial membrane lipids and quinone side chains, respectively. They have never been found to be incorporated into carotenoids. However, these longer analogs of 41 the C40 carotenoid precursor C20PP could in principle be used in the biosynthesis of carotenoid backbones having 45, 50, 55, or 60 carbon atoms. Similarly, the monoterpene precursor geranyl diphosphate (C10PP) could, in theory, be used to construct C20, C25, or asymmetric C30 carotenoids. All these backbone structures would be possible, provided that there were synthases capable of condensing these substrates. Although carotenoid synthases with these activities are not known in nature, we reasoned that an existing synthase could be engineered to make at least some of these new backbones. As discussed above, we had probed carotenoid synthase evolvability by screening for mutants of CrtM that function as a C40 synthase and mutants of CrtB that function as a C30 synthase. CrtM and CrtB diverged long ago and have only 30% amino acid sequence identity. Nonetheless, CrtM was readily converted to a C40 synthase (Chapter 2, (214)). Sequencing confirmed that multiple single-substitution pathways leading to this phenotype were possible (213). We then tested whether one or more of these CrtM mutants might be able to synthesize even larger backbones. To supply a C25PP substrate in E. coli, we constructed and expressed the Y81A variant of the C15PP synthase from B. stearothermophilus (BstFPSY81A). This variant was shown by Ohnuma’s group to produce C25PP as the main product in vitro (150, 151). When coexpressed with BstFPSY81A, the single mutants CrtMF26L and CrtMF26S discovered in our original C40 pathway screening experiment (Chapter 2, (214)) synthesized 16-isopentenylphytoene (the C45 carotenoid backbone, C20+C25) and 16,16'diisopentenylphytoene (the C50 backbone, C25+C25) (Figure 1.12). Site saturation mutagenesis at residues 26, 38, and 180 (also discovered to play a role in conferring C40 function on CrtM (213)) resulted in several double and triple mutants with improved 42 ability to synthesize C45 and C50 carotenoid backbones (212). These carotenoid backbones have never been reported in nature. Interestingly, some of the new CrtM-based C45 and C50 synthases showed almost no activity in the original C30 pathway (212). Thus, carotenoid synthases, although highly substrate-specific in their natural pathways, can both broaden and shift specificity with minimal genetic change. It would be interesting to see whether these variants can be engineered further to become producers of C50 carotenoids exclusively (i.e., no smaller side products) or to generate even larger carotenoids, with 60- or even 70-carbon chains. Although such long structures may not be biologically relevant (and may even be toxic), it might be possible to make them in an engineered pathway in E. coli. When co-transformed with crtI (phytoene desaturase), E. coli harboring the C45 and C50 pathways accumulated several novel desaturated C45 and C50 carotenoids (see Chapter 3). Given the proven evolvability of carotene desaturases and cyclases and the localized specificity of the carotenoid-modifying enzymes further downstream, we envision that it will be possible to generate many new carotenoids based on these backbones. Whereas the fully desaturated, red C40 carotenoid 3,4,3',4'-tetradehydrolycopene has a chromophore consisting of 15 conjugated double bonds, C45 and C50 carotenoid backbones can accommodate 17 and 19 conjugated double bonds, respectively. Extension of a conjugated system increases the wavelength(s) of light absorbed by a molecule and predictably changes the molecule’s color as observed under white light (33). Dodecapreno-β-carotene, a chemically synthesized analog of β,β-carotene with 19 conjugated double bonds, was reported to absorb light at wavelengths longer than 600 nm 43 and to possess bordeaux red to blue-violet pigmentation, depending on the solvent (93). Two of this molecule’s conjugated double bonds are contributed by the two stericallyhindered β-ionone groups. Therefore, just as lycopene with 11 all-trans-conjugated double bonds absorbs longer-wavelength light than β,β-carotene with 9 trans plus 2 beta double bonds, a linear, all-trans carotenoid with 19 conjugated double bonds would absorb even longer-wavelength light and would possess even further blue-shifted pigmentation than dodecapreno-β-carotene. Carotenoids with 19 all-trans double bonds would have possible uses as colorants and might possess interesting or unique antioxidant properties. DISCUSSION AND FUTURE DIRECTIONS Revised view of carotenoid biosynthetic pathways Carotenoid biosynthetic pathways have been described as having a tree-like organization, as depicted in Figure 1.1 (8). The conserved upstream reactions leading to backbone synthesis form the trunk, which supports many branches (and subbranches) representing increasingly diverse and species-specific downstream steps. However, many examples outlined in this chapter have shown that enzymes from one branch can often convert substrates from a different branch. Thus, in light of the ease with which it is now possible to combine carotenoid biosynthetic genes from diverse sources in recombinant organisms, pathway engineers might be better served by replacing the carotenoid “tree” with a more web-like model that emphasizes the interconnectivity of enzymes and metabolites and de-emphasizes the natural circumstances in which they are found. In addition, the tree model, with its conserved trunk and variable branches, implies that the 44 major mode of diversity generation is through the addition of new branches and subbranches. However, we now know that an important source of new carotenoid diversity is the generation of new trunks (new backbones), which can quickly be filled with many branches of their own by using enzymes taken from nature’s extant pathway branches and evolving them in their new pathway context. Future challenge: specific pathways To date, most laboratory-evolved and many engineered pathways accumulate novel carotenoids as components of a complex mixture. This may be fine and sufficient for the discovery of new compounds, but to be practically useful as a synthetic route to a specific compound, for example, the pathway must undergo further engineering to become more specific. Natural carotenoid pathways, which tend to produce only a small number of end products, probably followed a similar course of “pruning” many products down to a chosen few. As laboratory evolution experiments demonstrate, invention is an overnight event, but shaping newly discovered pathways into mature, specific ones can require much subsequent engineering effort. In the laboratory thus far, we have succeeded only in the first step, and real work remains. We list several possible approaches to converting a newborn, nonspecific pathway into one that makes a single novel metabolite. Evolving enzyme specificity. The most straightforward (but maybe the most labor-intensive) way to control pathway specificity is to engineer more specific biosynthetic enzymes. Most laboratory-evolved enzymes, however, show broadened rather than shifted specificity, and therefore the pathways containing them accumulate a combination of old and new products. In contrast, nature often does a perfect job, such 45 that two related enzymes (with a common ancestor but now sitting in different pathways) show no overlap in their substrate or product ranges. We think that pathways specific for newly discovered metabolites can be engineered, possibly after accumulating neutral mutations (in the context of the desired pathway) and certainly by directly screening for mutants that produce less of the old compounds while maintaining (or even improving) their ability to synthesize the new ones. The laboratory-discovered C35, C45, and C50 carotenoid pathways provide sophisticated experimental systems for testing this approach to dealing with what is a central, and challenging, problem in metabolic-pathway engineering. In addition, such experiments may contribute to our understanding of the early evolution of metabolism. The increasingly favored “patchwork” model of pathway evolution states that the specific metabolic pathways we observe today evolved from leaky assemblages of nonspecific enzymes (90, 171, 233) but provides no molecular explanation for how this happened. Experiments aimed at evolving pathway specificity in the laboratory would permit researchers to track the impact of each genetic change as the pathways acquire greater specificity, and they should therefore provide molecular insight into this poorly understood process. Designed channeling. Channeling of intermediates between successive enzymes in a pathway can eliminate undesirable fluxes and byproducts. As mentioned above, there is evidence supporting the existence of carotenoid biosynthetic enzyme complexes, although we do not know what role such complexes might play in pathways assembled in a recombinant organism. Designing enzyme complexes that can channel or shuttle intermediates from one enzyme or catalytic site to the next in a particular sequence may 46 find a use in directing the pathway toward efficient production of desired metabolites. Nature discovered this strategy for other metabolites, giving rise to the marvelous enzymatic assembly lines that synthesize polyketides and non-ribosomal peptides (reviewed in reference (169)). In an effort to engineer substrate channeling between successive enzymes in a biosynthetic pathway, Brodelius et al. fused a C15PP synthase with a sesquiterpene cyclase (34). The resultant fusion enzyme was more efficient at converting isopentenyl diphosphate into the cyclized C15 product than was the corresponding quantity of mixed unfused enzymes (34). Efforts in this direction might better regulate recombinant carotenoid pathways in E. coli, although significant structural information, which is currently unavailable for carotenoid enzymes, may be required. Specificity by flux balance. Even pathways harboring individually promiscuous enzymes can achieve reasonable specificity as a whole if all steps are properly balanced. If the activity or expression level of each enzyme is properly tuned, production of the desired product can be enhanced and the proportion of unwanted side products can be diminished. In addition to modifying the sequences of promoter or ribosomal binding sites, Smolke et al. have shown that the individual expression levels of multiple enzymes can be tuned to some degree by altering the transcriptional order of the genes in an operon and varying the stability of mRNA toward nuclease degradation by using engineered hairpin structures or RNase recognition sites (189). Although adjusting the expression levels of enzymes with broad substrate or product specificity is unlikely to eliminate undesired metabolites outright, it should permit some degree of modulation of the ratio of desired to undesired pathway products. 47 Specificity by diversion of unwanted intermediates. Balancing enzyme activities or expression levels cannot eliminate side products if an enzyme converts a single substrate into multiple products, only one of which is desired. If such enzymes cannot be engineered to narrow their product range, one strategy for achieving pathway specificity is to selectively divert unwanted intermediates away from downstream enzymes in the pathway. Instead, these intermediates could be catabolized or incorporated into products that are easily separated from the desired one(s) by introducing appropriately selective enzymes. In terms of the conversion yield of precursors into products, this approach is more wasteful than is engineering enzymes to be more specific. However, because product recovery costs can vastly exceed fermentation expenses in industrial processes, product purity can be more important than product titer (23). Thus, if a tradeoff is unavoidable, the better choice may be to accept lower product yield in favor of increased purity. Prospects and challenges for diversifying other pathways by laboratory evolution Although the best examples of diversifying metabolic pathways by directed evolution come from work on the carotenoids, this approach can be applied to other natural product pathways as well. There are very good indications that other pathways and biosynthetic enzymes will be as readily evolvable in the laboratory as the carotenoid pathways. Jones and Firn hypothesize that many natural product pathways are in fact already conducting their own combinatorial biosynthesis and high-throughput screening programs, at least on evolutionary timescales (62-64, 91). Because the probability that any particular small molecule will have potent biological activity is inherently low, Jones and Firn argue that organisms increase the odds of discovering new metabolites that 48 provide a selective advantage by exploring a large number of different structures. Thus, the argument continues, natural product pathways have evolved traits that maximize the production and retention of product diversity while minimizing the costs of synthesizing different metabolites, most of which are not beneficial to the producer. Among these traits are branched pathway structures, which enable the discovery of new metabolites as well as the retention of existing ones; matrix pathways or metabolic grids, where a small number of enzymes convert structurally similar precursors to a large number of products by multiple routes; and promiscuous enzymes, which can accept a variety of substrates and convert newly discovered metabolites into additional new products. As we have shown, carotenoid pathways possess these traits as well as others (e.g., individual enzymes are evolvable) that can be exploited for forward evolution. On the other hand, because carotenoids already fulfill important biological roles and no organism is known to synthesize a large number of different carotenoids, it is not apparent that nature is conducting massive searches for new and improved carotenoids. Other natural product pathways, however, do appear to be in “search” mode (for example, the bracken fern makes at least 27 different sesquiterpene indan-1-ones (91)), and these pathways may be even more evolvable than carotenoid pathways. Isoprenoid pathways are an obvious target for laboratory evolution. Many isoprenoid biosynthetic enzymes accept a variety of natural and unnatural substrates (139, 140, 147). (91). The gibberellins, a class of diterpenoid hormones with more than 120 known members, are synthesized by a metabolic grid composed of enzymes with broad substrate tolerance (59, 64). We have shown how the localized specificity of downstream carotenoid biosynthetic enzymes allowed pathway branches leading to whole sets of 49 novel compounds to be opened when the substrate or product preferences of key upstream enzymes were altered. In a similar example demonstrating the localized specificity of other isoprenoid biosynthetic enzymes, a mutated hydroxylase located early in the monoterpene pathway of spearmint resulted in a plant with a completely shifted monoterpene profile resembling that of peppermint (52). Other isoprenoid biosynthetic enzymes have very broad product specificity and synthesize multiple compounds (in one case, more than 50) from a single substrate (25, 47, 51, 60, 190, 229). Pathways harboring such enzymes are therefore highly branched and provide many possible avenues for further product diversification by directed evolution of downstream enzymes. Enzymes with broad specificity, a key feature of evolvable pathways, are found in the biosynthetic pathways of many other natural products, including alkaloids, polyketides, shikimate derivatives, nonribosomal peptides, and volatile esters (3, 26, 36, 169, 184, 188). It is likely that all these pathways will be readily diversified by laboratory evolution. Laboratory evolution will also be useful in constructing hybrid pathways for new natural products. Nature parsimoniously achieves great increases in small-molecule product diversity through the biosynthesis of hybrid natural products. Mycophenolic acid, tocotrienols and tocopherols (vitamin E), cannabinoids, isoprenoid quinones, furanocoumarins, furanoquinolines, alizarin anthraquinones, and certain flavonoids and alkaloids are examples of natural products formed by the fusion of products from two or more distinct biosynthetic pathways (36, 127). Chemical synthesis of unnatural hybrids of natural products has given rise to molecules with potent biological activity, many of which possess combined properties of their individual natural product constituents (reviewed in references (208) and (132)). The number of possible natural product hybrids 50 is astronomical, and, like nonhybrid natural products, most have yet to be made. Accordingly, altering the specificity of enzymes catalyzing the fusion reactions that lead to hybrid products in nature may be a promising way to explore natural product diversity. While laboratory evolution is likely in principle to be effective at exploring natural product diversity in a number of pathways, in practice, some experiments will be far easier than others. Thus, the above discussion is not complete without consideration of the technical issues involved in making and interrogating large libraries of mutant pathways. The first challenge is to create and express libraries of mutant enzymes in the context of a functional pathway. By virtue of their high transformation efficiency, fast growth, and the large number of available tools for genetic manipulation, E. coli cells are attractive for laboratory evolution experiments (and many other metabolic engineering experiments). Also, because E. coli does not synthesize carotenoids on its own, there is no background pool of carotenoids to contend with for laboratory evolution or combinatorial biosynthesis experiments with carotenoid biosynthetic pathways. E. coli, however, is not a universal protein expression machine, nor is it an ideal production host for all compounds. For example, it lacks the ability to glycosylate proteins. In addition, the precursors required for the biosynthesis of certain natural products, including many polyketides and isoprenoids, are present at low levels or not at all in E. coli. The use of engineered strains of E. coli with increased capacity for isoprenoid production (reviewed in reference (17)) and the ability to synthesize complex polyketides (reviewed in reference (161)) will overcome this limitation. Alternatively, libraries can be expressed and even constructed in other organisms such as Saccharomyces cerevisiae, for which a host of laboratory evolution tools exist (1, 2, 37, 38, 45, 46). Recently, an approach to the 51 laboratory evolution of polyketide biosynthesis was demonstrated in which E. coli was used as a host for generating a plasmid library by in vivo recombination. This library was subsequently transformed into a special strain of Streptomyces venezuelae for expression and screening (99). This approach combines the ease of genetic manipulation of E. coli with the ability of Streptomyces to generate bioactive glycosylated polyketides. Many directed enzyme evolution experiments have used an analogous approach in which the mutant library was generated in E. coli, but expressed in another, more suitable host such as Bacillus subtilis (44, 187, 240). This approach is then limited by the efficiency of transformation (often poor, especially for eukaryotic cells) and the ability to make cell lines that stably and reproducibly express the mutant sequences (and their pathway products). Once the library of mutant pathways is constructed and expressed, it must be screened to identify those that produce a new or desired metabolite(s). As is the case for directed protein evolution, this part of the experiment is usually the most challenging and labor-intensive. In the examples discussed in this chapter, it was relatively easy to monitor the characteristic pigmentation of carotenoids (e.g., using simple, color-based visual screening of bacterial colonies on plates). It is possible that color-based screens will similarly prove useful for evolving flavonoid (195) or porphyrin (114) biosynthetic pathways, since these products are also pigmented. Nonetheless, most natural products do not generate fluorescent or UV-visible spectra that are characteristic and distinguishable in the presence of cell debris, and other strategies must be employed for screening. Screening becomes much more challenging when there are no characteristic spectral changes that can be measured in situ, or when the desired products must be isolated and 52 analyzed before they can be identified. (Even among visibly colored families of compounds, new structures are not identifiable by colony color screening unless their pigmentation differs markedly from that of the products of the native pathway. Additionally, cell color reflects the total product mixture, and evolved pathways must therefore generate a significantly different product spectrum from the native pathway in order to be apparent in a simple color-based screen.) Thus, more general methods for rapidly screening microbial clones for the production of a wide range of natural products are desirable. Ideally, the screens would require minimal purification or work-up of cells or lysates, would be highly sensitive and reproducible, and would be amenable to automation. Mass spectrometry (MS) can be used when a target product has a different mass or fragmentation pattern from the product(s) of the wild-type enzyme(s). Using MS, it is possible to screen up to 10,000 samples per day (182), and MS screening has been used to for the directed evolution of enzymes with altered product profiles or enantioselectivity (166, 168). However, due to the large capital investment required (>$1 million), automated, high-throughput MS-based screening equipment is found primarily in well-funded industrial research laboratories. Screening by HPLC or thin-layer chromatography is also feasible but similarly requires sample pretreatment and is only high-throughput with parallel, automated instrumentation. Screening using nuclear magnetic resonance spectroscopy (NMR) has also been demonstrated (167). Up to 1400 samples per day could be analyzed by an NMR spectrometer equipped with a commercially available flow-through NMR probe head. Product concentrations, however, must be quite high for detection by NMR, and pretreatment is required. In some cases, pooling of samples increases the number of clones that can be screened, provided that 53 there is sufficient sensitivity to detect the novel compounds (which are often present at a lower concentration). Screens based on biological properties (e.g., antimicrobial activity or protein binding), widely used in drug discovery (24, 217, 221), could also be adapted to laboratory evolution studies. CONCLUSIONS In its short history, laboratory pathway evolution has produced more than 30 carotenoids that have never been seen in nature. With the ability to make new backbones in E. coli comes the potential to generate whole families of novel carotenoids through the action of wild-type or laboratory-evolved carotenoid-modifying enzymes on the new carbon scaffolds. Applied to other biosynthetic pathways, laboratory pathway evolution could allow researchers to access thousands of molecules that are difficult to produce in practical quantities by synthetic chemistry, are expensive to isolate from natural sources, or have not been found in nature. Seeing is believing. Evolving carotenoid biosynthetic pathways in the laboratory has allowed us to witness first-hand their remarkable evolutionary potential. In the process, we have learned that carotenoid enzymes can acquire new specificities that allow them to accept different substrates, function in a foreign pathway, make a different product from the same substrate, and even give rise to new pathways. Furthermore, all of these changes can be effected in just one round of evolution and are usually brought about by a single amino acid substitution. As evolution proceeds, we will gain further, detailed information on how pathways diverge and, we hope, some elementary understanding of how the stringent specificity of enzymes and pathways we see in nature 54 is achieved at the molecular level. We wonder how far laboratory pathway evolution can be taken. For example, starting with the genes that make up an arbitrary biosynthetic pathway in nature, can we evolve any chemically possible pathway made up of the same basic transformations? We have seen that the carotenoid synthase CrtM can rapidly acquire new specificities, lose much of its original function, and yet quickly recover its original function via different mutational routes. This is an encouraging lesson: evolving an enzyme with narrowed specificity does not “paint it into a corner,” evolutionarily speaking. It seems that one can abolish a particular specificity with ease but cannot abolish an enzyme’s inherent ability to evolve. Thus, the enzymes that exist in 2005 may be perfectly good starting points for creating widely diverse pathways. The dramatic functional changes we see in laboratory pathway evolution experiments remind us that natural product biosynthetic pathways are not merely a snapshot of history to be observed and documented. Rather, these pathways are continually changing entities whose evolutionary dynamics we are just beginning to probe. Laboratory evolution experiments with carotenoid pathways have given us an exciting glance at these dynamics. Future experiments promise both a greater understanding of how metabolic systems evolve and the discovery and optimization of biosynthetic routes to a host of molecules with diverse beneficial impacts on human health and well-being. 55 Figure 1.1 56 Figure 1.1. Natural carotenoid biosynthetic pathways can be organized in a tree-like hierarchy. The biosynthesis of all natural carotenoids begins with the enzymatic assembly of a C30 or C40 backbone. These backbones are desaturated, cyclized, oxidized, and otherwise modified by downstream enzymes in various species-specific combinations. Shown are several common types of enzymatic transformations that occur in natural carotenoid pathways. Common carotenoids formed early in a pathway, such as lycopene, are modified in different organisms depending on the enzymes present. The multiple enzymatic routes originating from intermediates common to many end products result in extensive pathway branching (and sub-branching). 57 Figure 1.2 58 Figure 1.2. Selected examples of gene assembly leading to novel carotenoids in E. coli. Combining enzymes from different source organisms can lead to rare or novel carotenoids. In some cases, such as with CrtC and CrtD (4, 5), new pathway branches can be uncovered by replacing an enzyme with its counterpart from a different organism (192). Carotenoids in boxes had not been previously identified in biological material, or chemically synthesized. Enzyme abbreviations: Al-1, phytoene desaturase from Neurospora crassa (five-step); CrtC, neurosporene 1,2-hydratase; CrtD, 1-OHneurosporene 3,4-desaturase; CrtIEu, phytoene desaturase from Erwinia uredovora (fourstep); CrtIRc, phytoene desaturase from Rhodobacter capsulatus (three-step); CrtW, β,βcarotene 4,(4')-ketolase; CrtX, zeaxanthin glycosylase; CrtY, lycopene β-cyclase; CrtZ, β,β-carotene 3,(3')-hydroxylase. Other enzyme subscripts: Aa, “Agrobacterium aurantiacum” (current designation, Paracoccus sp. strain MBIC1143); Eu, Erwinia uredovora (current approved name, Pantoea ananatis); Rg, Rubrivivax gelatinosus; Rs, Rhodobacter sphaeroides. Natural pathways leading to the synthesis of demethylspheroidene and β,β-carotene are shaded. The dotted arrow represents trace enzymatic conversion, and the crossed-out arrow denotes undetectable enzymatic conversion. References to original publications describing the biosynthesis of various compounds are given in brackets beside compound names. 59 Figure 1.3. “Matrix” pathway resulting from the coexpression of carotenoid biosynthetic enzymes with broad specificity. Coexpression in E. coli of CrtW [β,βcarotene 4,(4')-ketolase] and CrtZ [β,β-carotene 3,(3')-hydroxylase] from “Agrobacterium aurantiacum” (current designation, Paracoccus sp. strain MBIC1143) along with the genes for β,β-carotene synthesis from E. uredovora (current approved name, Pantoea ananatis) resulted in the biosynthesis of at least nine different β,β-carotene derivatives (135). This figure was made using data from reference (135). 60 Figure 1.4 61 Figure 1.4. Chain elongation reactions catalyzed by natural all-E IDSs. Each IDS adds a defined number of IPP molecules to an allylic diphosphate substrate before the final product is released. Wild-type IDSs have quite stringent product specificity; catalytic ranges of known all-E IDSs are shown with arrows on the right. Natural products derived from the various isoprenyl diphosphates are shown on the left. This figure was made using data from reference (225). 62 Figure 1.5 63 Figure 1.5. Product length determination by CrtM and mutants thereof. (a) Reaction mechanism of squalene synthase (left pathway) and CrtM (right pathway). Both enzymes catalyze the head-to-head condensation of two molecules of C15PP to yield linear C30 hydrocarbons. The enzymes employ similar mechanisms involving a common stable intermediate, presqualene diphosphate (PSPP). The mechanisms differ only in the final rearrangement step, which is followed in the case of squalene synthase by reduction of the central double bond. (b) Crystal structure of human squalene synthase (PDB ID: 1EZF). Green residues are involved in the first half-reaction (formation of PSPP), while blue residues form the pocket of the second half-reaction in which PSPP is rearranged. Red residues correspond by sequence alignment to F26 and W38 of CrtM, which were found to control the product size of that enzyme (213, 214). Shown in yellow are the residues that align with mutations in CrtM that improve both its C30 and C40 carotenoid synthase activities. (c) Mutation analysis of F26 and W38 of CrtM. Various site-directed variants of CrtM (indicated by their one-letter amino acid code) were constructed and tested for their synthase activity in both C30 and C40 carotenoid pathways. Variants are arranged from left to right in increasing order with respect to the van der Waals’ volume of the substituted amino acid. The C30 carotenoid synthase activity of each variant was estimated from the level of yellow pigmentation when coexpressed with CrtN. Similarly, the C40 carotenoid synthase function of each variant was evaluated in terms of the level of red pigmentation when coexpressed with CrtE and CrtI. Panels a and b were made using data from reference (212). 64 Figure 1.6 65 Figure 1.6. Extension of laboratory-evolved pathways to 3,4,3',4'- tetradehydrolycopene and torulene by coexpression of downstream carotenoid modifying enzymes (118). Boxed structures had not been previously identified in biological material. Native enzyme reactions are shown with black arrows. Gray arrows depict reactions not seen in natural organisms, and laboratory-evolved enzymes are written in gray lettering. Double arrows indicate enzymatic modification of both ends of a carotenoid substrate. Enzyme abbreviations: CrtA, spheroidene monooxygenase; CrtI, phytoene desaturase from E. uredovora (current approved name, Pantoea ananatis) (four-step), CrtI14, laboratory-evolved mutant of CrtI (four- to six-step) (180); CrtO, β,βcarotene 4,(4')-ketolase; CrtU, β,β-carotene desaturase; CrtX, zeaxanthin glycosylase; CrtY, lycopene β-cyclase; CrtY2, laboratory-evolved mutant of CrtY (180); CrtZ, β,βcarotene 3,(3')-hydroxylase. Biosynthesis of oxygenated derivatives of ζ-carotene and neurosporene was attributed to early termination by CrtA of the desaturation sequence of CrtI, which is normally a four-step desaturase (118). Although CrtA is primarily a ketolase, it is thought to catalyze the introduction of both hydroxy groups of phillipsiaxanthin (C. Schmidt-Dannert, personal communication). This figure was made using data from reference (118). 66 Figure 1.7 67 Figure 1.7. The step number of the C30 desaturase CrtN is readily modified by mutation. A library of mutant crtN alleles was coexpressed with the C30 carotenoid synthase crtM in E. coli. Wild-type CrtN is a three- to four-step desaturase when expressed in E. coli, causing colonies to appear orange (inset). Colonies harboring CrtN mutants with increased step number were deep orange and red (highlighted by arrows), reflecting the longer carotenoid chromophores formed by these mutant desaturases. Colonies harboring mutants with decreased step number appear yellow/lemon, while colonies with non-functional or single-step desaturases are pale since these products are colorless. Shown below are the possible C30 desaturation products and the desaturases that synthesize them. CrtN1-3 are discovered mutants of CrtN with altered desaturation step number. Each colored box depicts the approximate color of the carotenoid in white light. Molecules without colored boxes are colorless. Abbreviations: lacP, lac promoter; wt, wild-type. 68 Figure 1.8 69 Figure 1.8. Cyclization of carotenoids. (a) Mechanism of carotenoid cyclization. Lycopene with its two ψ-end groups is the preferred substrate for all known carotenoid cyclases. All cyclases produce the same carbocationic intermediate on protonation of C-2 of the substrate. Product ring type (β, ε, or γ) is determined by which proton (a, b, or c in the figure) is eliminated in the subsequent rearrangement step. This panel was made using data from reference (32). (b) Substrates accepted by lycopene cyclases. The shaded portion(s) of each structure is cyclized. The first three compounds, with their ψ-end groups, have long been known as natural substrates for lycopene cyclases. The remaining seven structures, including neurosporene with its 7,8-dihydro-ψ-end (left side of molecule) and ζ-carotene with two 7,8-dihydro-ψ-ends, have more recently been shown to be cyclized. 70 Figure 1.9. Alteration of product specificity of the β,β-carotene hydroxylase from Arabidopsis thaliana. The wild-type enzyme catalyzes two hydroxylation steps, converting β,β-carotene to zeaxanthin when expressed in either A. thaliana or E. coli. When the N-terminal 129 amino acids (aa) were removed, the truncated enzyme expressed in E. coli catalyzed only one hydroxylation step, leading primarily to synthesis of β-cryptoxanthin (197). 71 Figure 1.10 72 Figure 1.10. Several carotenoid cleavage enzymes display localized specificity. Gray arrowheads show bonds cleaved. (a) β,β-carotene-15,15'-monooxygenase (βCM) can cleave substrates with an unsubstituted β-end (123, 228). (b) Murine β,β-carotene-9',10'oxygenase (βCO9-10) can also cleave lycopene, leading to uncharacterized apolycopenals (98). (c) One carotenoid cleavage dioxygenase from A. thaliana (AtCCD1) cleaves at least six different carotenoid substrates, leading to a variety of products (185). The downward arrow from C14 dialdehyde indicates that this product was detected from all six substrates shown. 73 Figure 1.11. Generation of a C35 carotenoid pathway by gene assembly and directed enzyme evolution. (211) When supplied with C15PP and C20PP, the C30 carotenoid synthase CrtM produces the C35 carotenoid backbone, 4-apophytoene. By coexpressing C30 or C40 desaturases and mutants thereof (gray), different clones could be found that produce each possible acyclic C35 carotenoid as the main product. E. uredovora (P. ananatis) β-cyclase (CrtY) and L. sativa ε-cyclase (Dy4) were shown to cyclize two of the C35 substrates, leading to four different cyclic C35 carotenoids. All ten C35 carotenoids in this figure had never been previously reported. 74 Figure 1.12. Biosynthesis of C45 and C50 carotenoid backbones. (212) Expression of the Y81A variant of the C15PP synthase from B. stearothermophilus (BstFPSY81A) led to the production of C20PP and C25PP in E. coli. Additional coexpression of variants of the C30 carotenoid synthase CrtM mutated at F26 and/or W38 (CrtMmut) resulted in biosynthesis of the C45 carotenoid backbone 16-isopentenylphytoene (C20+C25) and the C50 backbone 16,16'-diisopentenylphytoene (C25+C25). Both of these larger carotenoid backbones had never been previously reported. These backbones can be further metabolized by the desaturase CrtI, leading to new families of unnatural carotenoid pigments (see Chapter 3). 75 REFERENCES 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. Abecassis, V., D. Pompon, and G. Truan. 2000. High efficiency family shuffling based on multi-step PCR and in vivo DNA recombination in yeast: statistical and functional analysis of a combinatorial library between human cytochrome P450 1A1 and 1A2. Nucleic Acids Res. 28:E88. Abecassis, V., D. Pompon, and G. Truan. 2003. Producing chimeric genes by CLERY: in vitro and in vivo recombination, p. 165-173. In F. H. Arnold and G. Georgiou (ed.), Methods Mol. Biol., vol. 231. Directed Evolution Library Creation Methods and Protocols. Humana Press, Totowa, N.J. Aharoni, A., L. C. Keizer, H. J. Bouwmeester, Z. Sun, M. Alvarez-Huerta, H. A. Verhoeven, J. Blaas, A. M. van Houwelingen, R. C. De Vos, H. van der Voet, R. C. Jansen, M. Guis, J. Mol, R. W. Davis, M. Schena, A. J. van Tunen, and A. P. O'Connell. 2000. Identification of the SAAT gene involved in strawberry flavor biogenesis by use of DNA microarrays. Plant Cell 12:647-62. Albrecht, M., S. Takaichi, N. Misawa, G. Schnurr, P. Böger, and G. Sandmann. 1997. Synthesis of atypical cyclic and acyclic hydroxy carotenoids in Escherichia coli transformants. J. Biotechnol. 58:177-185. Albrecht, M., S. Takaichi, S. Steiger, Z. Y. Wang, and G. Sandmann. 2000. Novel hydroxycarotenoids with improved antioxidative properties produced by gene combination in Escherichia coli. Nat. Biotechnol. 18:843-846. Aragón, C. M., F. J. Murillo, M. D. de la Guardia, and E. Cerdá-Olmedo. 1976. An enzyme complex for the dehydrogenation of phytoene in Phycomyces. Eur. J. Biochem. 63:71-5. Armstrong, G. A. 1999. Carotenoid genetics and biochemistry, p. 321-352. In D. E. Cane (ed.). Isoprenoids including carotenoids and steroids, vol. 2., Elsevier, Amsterdam. Armstrong, G. A., and J. E. Hearst. 1996. Carotenoids 2: Genetics and molecular biology of carotenoid pigment biosynthesis. Faseb J. 10:228-237. Arnold, F. H., and G. Georgiou (ed.). 2003. Methods Mol. Biol., vol. 231. Directed Evolution Library Creation Methods and Protocols. Humana Press, Totowa, N.J. Arnold, F. H., P. C. Wintrode, K. Miyazaki, and A. Gershenson. 2001. How enzymes adapt: Lessons from directed evolution. Trends Biochem. Sci. 26:100106. Arrach, N., R. Fernández-Martin, E. Cerdá-Olmedo, and J. Ávalos. 2001. A single gene for lycopene cyclase, phytoene synthase, and regulation of carotene biosynthesis in Phycomyces. Proc. Natl. Acad. Sci. U.S.A. 98:1687-1692. Arrach, N., T. J. Schmidhauser, and J. Ávalos. 2002. Mutants of the carotene cyclase domain of al-2 from Neurospora crassa. Mol. Genet. Genomics 266:91421. Ausich, R. L. 1994. Production of carotenoids by recombinant-DNA technology. Pure Appl. Chem. 66:1057-1062. Ávalos, J., J. Casadesús, and E. Cerdá-Olmedo. 1985. Gibberella fujikuroi mutants obtained with UV radiation and N-methyl-N'-nitro-N-nitrosoguanidine. Appl. Environ. Microbiol. 49:187-91. 76 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. Ávalos, J., and E. Cerdá-Olmedo. 1987. Carotenoid mutants of Gibberella fujikuroi. Curr. Genet. 11:505-511. Badenhop, F., S. Steiger, M. Sandmann, and G. Sandmann. 2003. Expression and biochemical characterization of the 1-HO-carotenoid methylase CrtF from Rhodobacter capsulatus. FEMS Microbiol. Lett. 222:237-42. Barkovich, R., and J. C. Liao. 2001. Metabolic engineering of isoprenoids. Metab. Eng. 3:27-39. Bejarano, E. R., N. S. Govind, and E. Cerdá-Olmedo. 1987. Zeta-carotene and other carotenes in a Phycomyces mutant. Phytochemistry 26:2251-2254. Bendich, A. 1994. Recent advances in clinical research involving carotenoids. Pure Appl. Chem. 66:1017-1024. Bergquist, P. L., M. D. Gibbs, D. D. Morris, V. S. Te'o, D. J. Saul, and H. W. Moran. 1999. Molecular diversity of thermophilic cellulolytic and hemicellulolytic bacteria. FEMS Microbiol. Ecol. 28:99-110. Bertram, J. S. 1999. Carotenoids and gene regulation. Nutr. Rev. 57:182-191. Blagg, B. S. J., M. B. Jarstfer, D. H. Rogers, and C. D. Poulter. 2002. Recombinant squalene synthase. A mechanism for the rearrangement of presqualene diphosphate to squalene. J. Am. Chem. Soc. 124:8846-8853. Blanch, H. W., and D. S. Clark. 1997. Product Recovery, p. 453-577. Biochemical Engineering. Marcel Dekker, Inc., New York. Bleicher, K. H., H. J. Bohm, K. Muller, and A. I. Alanine. 2003. Hit and lead generation: beyond high-throughput screening. Nat. Rev. Drug Discov. 2:369-78. Bohlmann, J., M. Phillips, V. Ramachandiran, S. Katoh, and R. Croteau. 1999. cDNA cloning, characterization, and functional expression of four new monoterpene synthase members of the Tpsd gene family from grand fir (Abies grandis). Arch. Biochem. Biophys. 368:232-43. Boswell, H. D., B. Drager, W. R. McLauchlan, A. Portsteffen, D. J. Robins, R. J. Robins, and N. J. Walton. 1999. Specificities of the enzymes of Nalkyltropane biosynthesis in Brugmansia and Datura. Phytochemistry 52:871-8. Boucher, Y., and W. F. Doolittle. 2000. The role of lateral gene transfer in the evolution of isoprenoid biosynthesis pathways. Mol. Microbiol. 37:703-716. Bouvier, F., O. Dogbo, and B. Camara. 2003. Biosynthesis of the food and cosmetic plant pigment bixin (annatto). Science 300:2089-2091. Bramley, P. M. 1985. The in vitro biosynthesis of carotenoids. Adv. Lipid Res. 21:243-279. Breinbauer, R., I. R. Vetter, and H. Waldmann. 2002. From protein domains to drug candidates—natural products as guiding principles in the design and synthesis of compound libraries. Angew. Chem. Int. Ed. Engl. 41:2879-90. Breitenbach, J., and G. Sandmann. 2005. Zeta-carotene cis isomers as products and substrates in the plant poly-cis carotenoid biosynthetic pathway to lycopene. Planta 220:785-793. Britton, G. 1998. Overview of carotenoid biosynthesis, p. 13-147. In G. Britton, S. Liaaen-Jensen, and H. Pfander (ed.). Carotenoids, vol. 3: Biosynthesis and Metabolism. Birkhäuser Verlag, Basel. Britton, G. 1995. UV/Visible Spectroscopy, p. 13-62. In G. Britton, S. LiaaenJensen, and H. Pfander (ed.). Carotenoids, vol. 1B: Spectroscopy. Birkhäuser 77 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. Verlag, Basel. Brodelius, M., A. Lundgren, P. Mercke, and P. E. Brodelius. 2002. Fusion of farnesyldiphosphate synthase and epi-aristolochene synthase, a sesquiterpene cyclase involved in capsidiol biosynthesis in Nicotiana tabacum. Eur. J. Biochem. 269:3570-3577. Buckingham, J. 2004. Dictionary of Natural Products. Chapman & Hall/CRC Press. http://www.chemnetbase.com/scripts/dnpweb.exe. Bu'Lock, J. D. 1965. The Biosynthesis of Natural Products. McGraw Hill, London. Bulter, T., and M. Alcalde. 2003. Preparing libraries in Saccharomyces cerevisiae, p. 17-22. In F. H. Arnold and G. Georgiou (ed.), Methods Mol. Biol., vol. 231. Directed Evolution Library Creation Methods and Protocols. Humana Press, Totowa, N.J. Bulter, T., M. Alcalde, V. Sieber, P. Meinhold, C. Schlachtbauer, and F. H. Arnold. 2003. Functional expression of a fungal laccase in Saccharomyces cerevisiae by directed evolution. Appl. Environ. Microbiol. 69:987-95. Cadwell, R. C., and G. F. Joyce. 1994. Mutagenic PCR. PCR Methods Appl. 3:S136-S140. Candau, R., E. R. Bejarano, and E. Cerdá-Olmedo. 1991. In vivo channeling of substrates in an enzyme aggregate for beta-carotene biosynthesis. Proc. Natl. Acad. Sci. U.S.A. 88:4936-40. Cerdá-Olmedo, E. 1985. Carotene mutants of Phycomyces. Methods Enzymol. 110:220-243. Chappell, J. 1995. Biochemistry and molecular biology of the isoprenoid biosynthetic pathway in plants. Annu. Rev. Plant Physiol. Plant Molec. Biol. 46:521-547. Chasan-Taber, L., W. C. Willett, J. M. Seddon, M. J. Stampfer, B. Rosner, G. A. Colditz, F. E. Speizer, and S. E. Hankinson. 1999. A prospective study of carotenoid and vitamin A intakes and risk of cataract extraction in US women. Am. J. Clin. Nutr. 70:509-516. Chen, K., and F. H. Arnold. 1993. Tuning the activity of an enzyme for unusual environments: sequential random mutagenesis of subtilisin E for catalysis in dimethylformamide. Proc. Natl. Acad. Sci. U.S.A. 90:5618-22. Chen, Z., B. S. Katzenellenbogen, J. A. Katzenellenbogen, and H. Zhao. 2004. Directed evolution of human estrogen receptor variants with significantly enhanced androgen specificity and affinity. J. Biol. Chem. (advance electronic publication). Cherry, J. R., M. H. Lamsa, P. Schneider, J. Vind, A. Svendsen, A. Jones, and A. H. Pedersen. 1999. Directed evolution of a fungal peroxidase. Nat. Biotechnol. 17:379-84. Colby, S. M., J. Crock, B. Dowdle-Rizzo, P. G. Lemaux, and R. Croteau. 1998. Germacrene C synthase from Lycopersicon esculentum cv. VFNT cherry tomato: cDNA isolation, characterization, and bacterial expression of the multiple product sesquiterpene cyclase. Proc. Natl. Acad. Sci. U.S.A. 95:2216-21. Collins, A. R. 2001. Carotenoids and genomic stability. Mutat. Res.-Fundam. Mol. Mech. Mutagen. 475:21-28. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63. 64. 65. 78 Cornish, K., and D. J. Siler. 1996. Alternative natural rubber. Chemtech 26:3844. Crameri, A., G. Dawes, E. Rodriguez, Jr., S. Silver, and W. P. Stemmer. 1997. Molecular evolution of an arsenate detoxification pathway by DNA shuffling. Nat. Biotechnol. 15:436-8. Crock, J., M. Wildung, and R. Croteau. 1997. Isolation and bacterial expression of a sesquiterpene synthase cDNA clone from peppermint (Mentha x piperita, L.) that produces the aphid alarm pheromone (E)-beta-farnesene. Proc. Natl. Acad. Sci. U.S.A. 94:12833-12838. Croteau, R., F. Karp, K. C. Wagschal, D. M. Satterwhite, D. C. Hyatt, and C. B. Skotland. 1991. Biochemical characterization of a spearmint mutant that resembles peppermint in monoterpene content. Plant Physiol. 96:744-752. Cunningham, F. X., and E. Gantt. 2001. One ring or two? Determination of ring number in carotenoids by lycopene epsilon-cyclases. Proc. Natl. Acad. Sci. U.S.A. 98:2905-2910. Cunningham, F. X., G. C. T. Jiang, and E. Gantt. 1997. Analysis of structure and function of carotenoid cyclase enzymes. Plant Physiol. 114:926-926. Cunningham, F. X., B. Pogson, Z. R. Sun, K. A. McDonald, D. DellaPenna, and E. Gantt. 1996. Functional analysis of the beta and epsilon lycopene cyclase enzymes of Arabidopsis reveals a mechanism for control of cyclic carotenoid formation. Plant Cell 8:1613-1626. Davies, B. H. 1977. C30 Carotenoids, p. 51-100. In T. W. Goodwin (ed.), vol. 14. Biochemistry of Lipids II. University Park Press, Baltimore. Davisson, V. J., and C. D. Poulter. 1993. Farnesyl-diphosphate synthase— Interplay between substrate topology, stereochemistry, and regiochemistry in electrophilic alkylations. J. Am. Chem. Soc. 115:1245-1260. De la Guardia, M. D., C. M. Aragón, F. J. Murillo, and E. Cerdá-Olmedo. 1971. A carotenogenic enzyme aggregate in Phycomyces: evidence from quantitive complementation. Proc. Natl. Acad. Sci. U.S.A. 68:2012-5. Dewick, P. M. 2002. The biosynthesis of C5-C25 terpenoid compounds. Nat. Prod. Rep. 19:181-222. Facchini, P. J., and J. Chappell. 1992. Gene family for an elicitor-induced sesquiterpene cyclase in tobacco. Proc. Natl. Acad. Sci. U.S.A. 89:11088-92. Fernandez, S. M. S., B. A. Kellogg, and C. D. Poulter. 2000. Farnesyl diphosphate synthase. Altering the catalytic site to select for geranyl diphosphate activity. Biochemistry 39:15316-15321. Firn, R. D., and C. G. Jones. 2000. The evolution of secondary metabolism—a unifying model. Mol. Microbiol. 37:989-994. Firn, R. D., and C. G. Jones. 1996. An explanation of secondary product "redundancy," p. 295-312. In J. T. Romeo, J. A. Saunders, and P. Barbosa (ed.), Recent Advances in Phytochemistry, vol. 30. Phytochemical Diversity and Redundancy in Ecological Interactions. Plenum Press, New York. Firn, R. D., and C. G. Jones. 2003. Natural products—a simple model to explain chemical diversity. Nat. Prod. Rep. 20:382-391. Fraser, P. D., N. Misawa, H. Linden, S. Yamano, K. Kobayashi, and G. Sandmann. 1992. Expression in Escherichia coli, purification, and reactivation 79 66. 67. 68. 69. 70. 71. 72. 73. 74. 75. 76. 77. 78. 79. of the recombinant Erwinia uredovora phytoene desaturase. J. Biol. Chem. 267:19891-19895. Fraser, P. D., M. J. Ruiz-Hidalgo, M. A. Lopez-Matas, M. I. Alvarez, A. P. Eslava, and P. M. Bramley. 1996. Carotenoid biosynthesis in wild type and mutant strains of Mucor circinelloides. Biochim. Biophys. Acta 1289:203-8. Fujisaki, S., H. Hara, Y. Nishimura, K. Horiuchi, and T. Nishino. 1990. Cloning and nucleotide-sequence of the ispA gene responsible for farnesyl diphosphate synthase activity in Escherichia coli. J. Biochem. (Tokyo) 108:9951000. Fujisaki, S., T. Nishino, H. Katsuki, H. Hara, Y. Nishimura, and Y. Hirota. 1989. Isolation and characterization of an Escherichia coli mutant having temperature-sensitive farnesyl diphosphate synthase. J. Bacteriol. 171:5654-5658. Garcia-Asua, G., R. J. Cogdell, and C. N. Hunter. 2002. Functional assembly of the foreign carotenoid lycopene into the photosynthetic apparatus of Rhodobacter sphaeroides, achieved by replacement of the native 3-step phytoene desaturase with its 4-step counterpart from Erwinia herbicola. Mol. Microbiol. 44:233-244. Garcia-Asua, G., H. P. Lang, R. J. Cogdell, and C. N. Hunter. 1998. Carotenoid diversity: a modular role for the phytoene desaturase step. Trends Plant Sci. 3:445-449. Giuliano, G., S. Al-Babili, and J. von Lintig. 2003. Carotenoid oxygenases: cleave it or leave it. Trends Plant Sci. 8:145-9. Giuliano, G., L. Giliberto, and C. Rosati. 2002. Carotenoid isomerase: a tale of light and isomers. Trends Plant Sci. 7:427-9. Goodwin, T. W., and L. A. Griffiths. 1952. Studies in carotenogenesis. V. Carotene production by various mutants of Phycomyces blakesleeanus and by Phycomyces nitens. Biochem. J. 52:499-501. Goto, S., K. Kogure, K. Abe, Y. Kimata, K. Kitahama, E. Yamashita, and H. Terada. 2001. Efficient radical trapping at the surface and inside the phospholipid membrane is responsible for highly potent antiperoxidative activity of the carotenoid astaxanthin. Biochim. Biophys. Acta-Biomembr. 1512:251-258. Guo, R. T., C. J. Kuo, C. C. Chou, T. P. Ko, H. L. Shr, P. H. Liang, and A. H. Wang. 2004. Crystal structure of octaprenyl pyrophosphate synthase from hyperthermophilic Thermotoga maritima and mechanism of product chain length determination. J. Biol. Chem. 279:4903-12. Harker, M., and J. Hirschberg. 1997. Biosynthesis of ketocarotenoids in transgenic cyanobacteria expressing the algal gene for beta-C-4-oxygenase, crtO. FEBS Lett. 404:129-134. Hemmi, H., M. Noike, T. Nakayama, and T. Nishino. 2003. An alternative mechanism of product chain-length determination in type III geranylgeranyl diphosphate synthase. Eur. J. Biochem. 270:2186-94. Hemmi, H., M. Noike, T. Nakayama, and T. Nishino. 2002. Change of product specificity of hexaprenyl diphosphate synthase from Sulfolobus solfataricus by introducing mimetic mutations. Biochem. Biophys. Res. Commun. 297:1096-101. Hirayama, O., K. Nakamura, S. Hamada, and Y. Kobayasi. 1994. Singlet oxygen quenching ability of naturally-occurring carotenoids. Lipids 29:149-150. 80. 81. 82. 83. 84. 85. 86. 87. 88. 89. 90. 91. 92. 93. 94. 80 Hirooka, K., T. Kato, J. Matsu-ura, H. Hemmi, and T. Nishino. 2000. The role of histidine-114 of Sulfolobus acidocaldarius geranylgeranyl diphosphate synthase in chain-length determination. FEBS Lett. 481:68-72. Hirooka, K., S. Ohnuma, A. Koike-Takeshita, T. Koyama, and T. Nishino. 2000. Mechanism of product chain length determination for heptaprenyl diphosphate synthase from Bacillus stearothermophilus. Eur. J. Biochem. 267:4520-4528. Hornero-Méndez, D., and G. Britton. 2002. Involvement of NADPH in the cyclization reaction of carotenoid biosynthesis. FEBS Lett. 515:133-136. Hughes, D. A. 1999. Effects of carotenoids on human immune function. Proc. Nutr. Soc. 58:713-718. Hugueney, P., A. Badillo, H. C. Chen, A. Klein, J. Hirschberg, B. Camara, and M. Kuntz. 1995. Metabolism of cyclic carotenoids—a model for the alteration of this biosynthetic pathway in Capsicum annuum chromoplasts. Plant J. 8:417-424. Hunter, C. N., B. S. Hundle, J. E. Hearst, H. P. Lang, A. T. Gardiner, S. Takaichi, and R. J. Cogdell. 1994. Introduction of new carotenoids into the bacterial photosynthetic apparatus by combining the carotenoid biosynthetic pathways of Erwinia herbicola and Rhodobacter sphaeroides. J. Bacteriol. 176:3692-3697. Isaacson, T., I. Ohad, P. Beyer, and J. Hirschberg. 2004. Analysis in vitro of the enzyme CRTISO establishes a poly-cis-carotenoid biosynthesis pathway in plants. Plant Physiol. 136:4246-4255. Iwata-Reuyl, D., S. K. Math, S. B. Desai, and C. D. Poulter. 2003. Bacterial phytoene synthase: molecular cloning, expression, and characterization of Erwinia herbicola phytoene synthase. Biochemistry 42:3359-65. Jarstfer, M. B., B. S. J. Blagg, D. H. Rogers, and C. D. Poulter. 1996. Biosynthesis of squalene. Evidence for a tertiary cyclopropylcarbinyl cationic intermediate in the rearrangement of presqualene diphosphate to squalene. J. Am. Chem. Soc. 118:13089-13090. Jarstfer, M. B., D. L. Zhang, and C. D. Poulter. 2002. Recombinant squalene synthase. Synthesis of non-head-to-tail isoprenoids in the absence of NADPH. J. Am. Chem. Soc. 124:8834-8845. Jensen, R. A. 1976. Enzyme recruitment in evolution of new function. Annu. Rev. Microbiol. 30:409-25. Jones, C. G., and R. D. Firn. 1991. On the evolution of plant secondary chemical diversity. Philos. Trans. R. Soc. Lond. Ser. B-Biol. Sci. 333:273-280. Kainou, T., K. Okada, K. Suzuki, T. Nakagawa, H. Matsuda, and M. Kawamukai. 2001. Dimer formation of octaprenyl-diphosphate synthase (IspB) is essential for chain length determination of ubiquinone. J. Biol. Chem. 276:7876-83. Karrer, P., and C. H. Eugster. 1951. Carotinoidsynthesen 8. Synthese des dodecapreno-beta-carotins. Helv. Chim. Acta 34:1805-1814. Kato, J. I., S. Fujisaki, K. I. Nakajima, Y. Nishimura, M. Sato, and A. Nakano. 1999. The Escherichia coli homologue of yeast Rer2, a key enzyme of dolichol synthesis, is essential for carrier lipid formation in bacterial cell wall 81 95. 96. 97. 98. 99. 100. 101. 102. 103. 104. 105. 106. 107. 108. 109. synthesis. J. Bacteriol. 181:2733-2738. Kaur, C., and H. C. Kapoor. 2001. Antioxidants in fruits and vegetables—the millennium's health. Int. J. Food Sci. Technol. 36:703-725. Kawasaki, T., Y. Hamano, T. Kuzuyama, N. Itoh, H. Seto, and T. Dairi. 2003. Interconversion of the product specificity of type I eubacterial farnesyl diphosphate synthase and geranylgeranyl diphosphate synthase through one amino acid substitution. J. Biochem. (Tokyo) 133:83-91. Kellogg, B. A., and C. D. Poulter. 1997. Chain elongation in the isoprenoid biosynthetic pathway. Curr. Opin. Chem. Biol. 1:570-578. Kiefer, C., S. Hessel, J. M. Lampert, K. Vogt, M. O. Lederer, D. E. Breithaupt, and J. von Lintig. 2001. Identification and characterization of a mammalian enzyme catalyzing the asymmetric oxidative cleavage of provitamin A. J. Biol. Chem. 276:14110-14116. Kim, B. S., D. H. Sherman, and K. A. Reynolds. 2004. An efficient method for creation and functional analysis of libraries of hybrid type I polyketide synthases. Prot. Eng. Des. Sel. 17:277-284. Kleinig, H., and R. Schmitt. 1982. On the biosynthesis of C30 carotenoic acid glucosyl esters in Pseudomonas rhodos—Analysis of car-mutants. Z. Naturforsch. (C) 37:758-760. Kleinig, H., R. Schmitt, W. Meister, G. Englert, and H. Thommen. 1979. New C30 Carotenoic Acid Glucosyl Esters from Pseudomonas rhodos. Z. Naturforsch. (C) 34:181-185. Kobayashi, M., T. Koyama, K. Ogura, S. Seto, F. J. Ritter, and I. E. M. Bruggemannrotgans. 1980. Bioorganic synthesis and absolute-configuration of faranal. J. Am. Chem. Soc. 102:6602-6604. Kobayashi, M., and Y. Sakamoto. 1999. Singlet oxygen quenching ability of astaxanthin esters from the green alga Haematococcus pluvialis. Biotechnol. Lett. 21:265-269. Kojima, N., W. Sitthithaworn, E. Viroonchatapan, D. Y. Suh, N. Iwanami, T. Hayashi, and U. Sankaw. 2000. Geranylgeranyl diphosphate synthases from Scoparia dulcis and Croton sublyratus. cDNA cloning, functional expression, and conversion to a farnesyl diphosphate synthase. Chem. Pharm. Bull. (Tokyo). 48:1101-3. Komori, M., R. Ghosh, S. Takaichi, Y. Hu, T. Mizoguchi, Y. Koyama, and M. Kuki. 1998. A null lesion in the rhodopin 3,4-desaturase of Rhodospirillum rubrum unmasks a cryptic branch of the carotenoid biosynthetic pathway. Biochemistry 37:8987-8994. Koyama, T., K. Ogura, and S. Seto. 1977. Construction of a chiral center by use of stereospecificity of prenyltransferase. J. Am. Chem. Soc. 99:1999-2000. Koyama, T., A. Saito, K. Ogura, and S. Seto. 1980. Substrate-specificity of farnesylpyrophosphate synthetase. Application to asymmetric synthesis. J. Am. Chem. Soc. 102:3614-3618. Krinsky, N. I. 1994. The Biological properties of carotenoids. Pure Appl. Chem. 66:1003-1010. Krubasik, P., M. Kobayashi, and G. Sandmann. 2001. Expression and functional analysis of a gene cluster involved in the synthesis of decaprenoxanthin 110. 111. 112. 113. 114. 115. 116. 117. 118. 119. 120. 121. 122. 123. 124. 125. 82 reveals the mechanisms for C50 carotenoid formation. Eur. J. Biochem. 268:37023708. Krubasik, P., and G. Sandmann. 2000. A carotenogenic gene cluster from Brevibacterium linens with novel lycopene cyclase genes involved in the synthesis of aromatic carotenoids. Mol. Gen. Genet. 263:423-432. Krubasik, P., and G. Sandmann. 2000. Molecular evolution of lycopene cyclases involved in the formation of carotenoids with ionone end groups. Biochem. Soc. Trans. 28:806-810. Krubasik, P., S. Takaichi, T. Maoka, M. Kobayashi, K. Masamoto, and G. Sandmann. 2001. Detailed biosynthetic pathway to decaprenoxanthin diglucoside in Corynebacterium glutamicum and identification of novel intermediates. Arch. Microbiol. 176:217-23. Kushwaha, S. C., M. Kates, and H. J. Weber. 1980. Exclusive formation of alltrans-phytoene by a colorless mutant of Halobacterium halobium. Can. J. Microbiol. 26:1011-4. Kwon, S. J., A. L. de Boer, R. Petri, and C. Schmidt-Dannert. 2003. Highlevel production of porphyrins in metabolically engineered Escherichia coli: Systematic extension of a pathway assembled from overexpressed genes involved in heme biosynthesis. Appl. Environ. Microbiol. 69:4875-83. Lakshman, M. R. 2004. Alpha and omega of carotenoid cleavage. J. Nutr. 134:241S-245S. Lange, B. M., T. Rujan, W. Martin, and R. Croteau. 2000. Isoprenoid biosynthesis: The evolution of two ancient and distinct pathways across genomes. Proc. Natl. Acad. Sci. U.S.A. 97:13172-13177. Lauro, G. J. 1991. A primer on natural colors. Cereal Foods World 36:949-953. Lee, P. C., A. Z. R. Momen, B. N. Mijts, and C. Schmidt-Dannert. 2003. Biosynthesis of structurally novel carotenoids in Escherichia coli. Chem. Biol. 10:453-462. Lee, P. C., and C. Schmidt-Dannert. 2002. Metabolic engineering towards biotechnological production of carotenoids in microorganisms. Appl. Microbiol. Biotechnol. 60:1-11. Lee, T. C., D. B. Rodriguez, I. Karasawa, T. H. Lee, K. L. Simpson, and C. O. Chichester. 1975. Chemical alteration of carotene biosynthesis in Phycomyces blakesleeanus and mutants. Appl. Microbiol. 30:988-93. Leuenberger, M. G., C. Engeloch-Jarret, and W. D. Woggon. 2001. The reaction mechanism of the enzyme-catalyzed central cleavage of beta-carotene to retinal. Angew. Chem. Int. Ed. Engl. 40:2613-2617. Liang, P. H., T. P. Ko, and A. H. J. Wang. 2002. Structure, mechanism and function of prenyltransferases. Eur. J. Biochem. 269:3339-3354. Lindqvist, A., and S. Andersson. 2002. Biochemical properties of purified recombinant human beta-carotene 15,15'-monooxygenase. J. Biol. Chem. 277:23942-23948. LinGoerke, J. L., D. J. Robbins, and J. D. Burczak. 1997. PCR-based random mutagenesis using manganese and reduced dNTP concentration. Biotechniques 23:409-&. Maki, Y., M. Komabayashi, Y. Gotoh, N. Ohya, H. Hemmi, K. Hirooka, T. 126. 127. 128. 129. 130. 131. 132. 133. 134. 135. 136. 137. 138. 139. 83 Nishino, and T. Koyama. 2002. Dramatic changes in the substrate specificities of prenyltransferase by a single amino acid substitution. J. Mol. Catal. B-Enzym. 19:431-436. Maki, Y., A. Masukawa, H. Ono, T. Endo, T. Koyama, and K. Ogura. 1995. Substrate-specificity of farnesyl diphosphate synthase from Bacillus stearothermophilus. Bioorg. Med. Chem. Lett. 5:1605-1608. Mann, J. 1987. Secondary Metabolism. Clarendon Press, Oxford. Mann, V., M. Harker, I. Pecker, and J. Hirschberg. 2000. Metabolic engineering of astaxanthin production in tobacco flowers. Nat. Biotechnol. 18:888-892. Marshall, J. H., and G. J. Wilmoth. 1981. Pigments of Staphylococcus aureus, a series of triterpenoid carotenoids. J. Bacteriol. 147:900-13. Marshall, J. H., and G. J. Wilmoth. 1981. Proposed pathway of triterpenoid carotenoid biosynthesis in Staphylococcus aureus: evidence from a study of mutants. J. Bacteriol. 147:914-9. Masamoto, K., H. Wada, T. Kaneko, and S. Takaichi. 2001. Identification of a gene required for cis-to-trans carotene isomerization in carotenogenesis of the cyanobacterium Synechocystis sp. PCC 6803. Plant Cell Physiol. 42:1398-402. Mehta, G., and V. Singh. 2002. Hybrid systems through natural product leads: an approach towards new molecular entities. Chem. Soc. Rev. 31:324-334. Misawa, N., S. Kajiwara, K. Kondo, A. Yokoyama, Y. Satomi, T. Saito, W. Miki, and T. Ohtani. 1995. Canthaxanthin biosynthesis by the conversion of methylene to keto groups in a hydrocarbon beta-carotene by a single gene. Biochem. Biophys. Res. Commun. 209:867-876. Misawa, N., M. Nakagawa, K. Kobayashi, S. Yamano, Y. Izawa, K. Nakamura, and K. Harashima. 1990. Elucidation of the Erwinia uredovora carotenoid biosynthetic pathway by functional analysis of gene products expressed in Escherichia coli. J. Bacteriol. 172:6704-6712. Misawa, N., Y. Satomi, K. Kondo, A. Yokoyama, S. Kajiwara, T. Saito, T. Ohtani, and W. Miki. 1995. Structure and functional analysis of a marine bacterial carotenoid biosynthesis gene cluster and astaxanthin biosynthetic pathway proposed at the gene level. J. Bacteriol. 177:6575-6584. Misawa, N., S. Yamano, H. Linden, M. R. Defelipe, M. Lucas, H. Ikenaga, and G. Sandmann. 1993. Functional expression of the Erwinia uredovora carotenoid biosynthesis gene crtl in transgenic plants showing an increase of betacarotene biosynthesis activity and resistance to the bleaching herbicide norflurazon. Plant J. 4:833-840. Montenegro, M. A., M. A. Nazareno, E. N. Durantini, and C. D. Borsarelli. 2002. Singlet molecular oxygen quenching ability of carotenoids in a reversemicelle membrane mimetic system. Photochem. Photobiol. 75:353-361. Murillo, F. J., S. Torres-Martinez, C. M. Aragón, and E. Cerdá-Olmedo. 1981. Substrate transfer in carotene biosynthesis in Phycomyces. Eur. J. Biochem. 119:511-6. Nagaki, M., S. Sato, Y. Maki, T. Nishino, and T. Koyama. 2000. Artificial substrates for undecaprenyl diphosphate synthase from Micrococcus luteus B-P 26. J. Mol. Catal. B-Enzym. 9:33-38. 84 140. Nagaki, M., A. Takaya, Y. Maki, J. Ishibashi, Y. Kato, T. Nishino, and T. Koyama. 2000. One-pot syntheses of the sex pheromone homologs of a codling moth, Laspeyresia promonella L. J. Mol. Catal. B-Enzym. 10:517-522. 141. Narita, K., S. Ohnuma, and T. Nishino. 1999. Protein design of geranyl diphosphate synthase. Structural features that define the product specificities of prenyltransferases. J. Biochem. (Tokyo) 126:566-571. 142. Newman, D. J., G. M. Cragg, and K. M. Snader. 2003. Natural products as sources of new drugs over the period 1981-2002. J. Nat. Prod. 66:1022-1037. 143. Nishino, H. 1997. Cancer prevention by natural carotenoids. J. Cell. Biochem.:86-91. 144. Nishino, H., H. Tokuda, Y. Satomi, M. Masuda, P. Bu, M. Onozuka, S. Yamaguchi, Y. Okuda, J. Takayasu, J. Tsuruta, M. Okuda, E. Ichiishi, M. Murakoshi, T. Kato, N. Misawa, T. Narisawa, N. Takasuka, and M. Yano. 1999. Cancer prevention by carotenoids. Pure Appl. Chem. 71:2273-2278. 145. Ogura, K., and T. Koyama. 1998. Enzymatic aspects of isoprenoid chain elongation. Chem. Rev. 98:1263-1276. 146. Ogura, K., T. Koyama, and H. Sagami. 1997. Polyprenyl diphosphate synthases, p. 57-87. In R. Bittman (ed.). Subcellular Biochemistry 28: Cholesterol: Its function and metabolism in biology and medicine., Plenum Press, New York. 147. Ohnuma, S., H. Hemmi, T. Koyama, K. Ogura, and T. Nishino. 1998. Recognition of allylic substrates in Sulfolobus acidocaldarius geranylgeranyl diphosphate synthase: Analysis using mutated enzymes and artificial allylic substrates. J. Biochem. (Tokyo) 123:1036-1040. 148. Ohnuma, S., K. Hirooka, H. Hemmi, C. Ishida, C. Ohto, and T. Nishino. 1996. Conversion of product specificity of archaebacterial geranylgeranyl-diphosphate synthase—Identification of essential amino acid residues for chain length determination of prenyltransferase reaction. J. Biol. Chem. 271:18831-18837. 149. Ohnuma, S., K. Hirooka, C. Ohto, and T. Nishino. 1997. Conversion from archaeal geranylgeranyl diphosphate synthase to farnesyl diphosphate synthase— Two amino acids before the first aspartate-rich motif solely determine eukaryotic farnesyl diphosphate synthase activity. J. Biol. Chem. 272:5192-5198. 150. Ohnuma, S., K. Hirooka, N. Tsuruoka, M. Yano, C. Ohto, H. Nakane, and T. Nishino. 1998. A pathway where polyprenyl diphosphate elongates in prenyltransferase—Insight into a common mechanism of chain length determination of prenyltransferases. J. Biol. Chem. 273:26705-26713. 151. Ohnuma, S., K. Narita, T. Nakazawa, C. Ishida, Y. Takeuchi, C. Ohto, and T. Nishino. 1996. A role of the amino acid residue located on the fifth position before the first aspartate-rich motif of farnesyl diphosphate synthase on determination of the final product. J. Biol. Chem. 271:30748-30754. 152. Ohnuma, S. I., T. Nakazawa, H. Hemmi, A. M. Hallberg, T. Koyama, K. Ogura, and T. Nishino. 1996. Conversion from farnesyl diphosphate synthase to geranylgeranyl diphosphate synthase by random chemical mutagenesis. J. Biol. Chem. 271:10087-10095. 153. Okada, K., T. Kainou, K. Tanaka, T. Nakagawa, H. Matsuda, and M. Kawamukai. 1998. Molecular cloning and mutational analysis of the ddsA gene encoding decaprenyl diphosphate synthase from Gluconobacter suboxydans. Eur. 85 154. 155. 156. 157. 158. 159. 160. 161. 162. 163. 164. 165. 166. 167. 168. J. Biochem. 255:52-9. Okada, K., M. Minehira, X. F. Zhu, K. Suzuki, T. Nakagawa, H. Matsuda, and M. Kawamukai. 1997. The ispB gene encoding octaprenyl diphosphate synthase is essential for growth of Escherichia coli. J. Bacteriol. 179:3058-3060. Ootaki, T., A. C. Lighty, M. Delbrück, and W. J. Hsu. 1973. Complementation between mutants of Phycomyces deficient with respect to carotenogenesis. Mol. Gen. Genet. 121:57-70. Ortiz de Montellano, P. R., J. S. Wei, W. A. Vinson, R. Castillo, and A. S. Boparai. 1977. Substrate selectivity of squalene synthetase. Biochemistry 16:2680-2685. Ouchane, S., M. Picaud, C. Vernotte, F. ReissHusson, and C. Astier. 1997. Pleiotropic effects of puf interposon mutagenesis on carotenoid biosynthesis in Rubrivivax gelatinosus—A new gene organization in purple bacteria. J. Biol. Chem. 272:1670-1676. Paik, J., A. During, E. H. Harrison, C. L. Mendelsohn, K. Lai, and W. S. Blaner. 2001. Expression and characterization of a murine enzyme able to cleave beta-carotene—The formation of retinoids. J. Biol. Chem. 276:32160-32168. Pandit, J., D. E. Danley, G. K. Schulte, S. Mazzalupo, T. A. Pauly, C. M. Hayward, E. S. Hamanaka, J. F. Thompson, and H. J. Harwood. 2000. Crystal structure of human squalene synthase—A key enzyme in cholesterol biosynthesis. J. Biol. Chem. 275:30610-30617. Perry, K. L., T. A. Simonitch, K. J. Harrisonlavoie, and S. T. Liu. 1986. Cloning and regulation of Erwinia herbicola pigment genes. J. Bacteriol. 168:607-612. Pfeifer, B. A., and C. Khosla. 2001. Biosynthesis of polyketides in heterologous hosts. Microbiol. Mol. Biol. Rev. 65:106-18. Powls, R., and G. Britton. 1977. A series of mutant strains of Scenedesmus obliquus with abnormal carotenoid compositions. Arch. Microbiol. 113:275-80. Raisig, A., and G. Sandmann. 2001. Functional properties of diapophytoene and related desaturases of C30 and C40 carotenoid biosynthetic pathways. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 1533:164-170. Rau, W., and U. Mitzka-Schnabel. 1985. Carotenoid synthesis in Neurospora crassa. Methods Enzymol. 110:253-67. Redmond, T. M., S. Gentleman, T. Duncan, S. Yu, B. Wiggert, E. Gantt, and F. X. Cunningham. 2001. Identification, expression, and substrate specificity of a mammalian beta-carotene 15,15'-dioxygenase. J. Biol. Chem. 276:6560-6565. Reetz, M. T., M. H. Becker, H.-W. Klein, and D. Stöckigt. 1999. A method for high-throughput screening of enantioselective catalysts. Angew. Chem. Int. Ed. Engl. 38:1758-1761. Reetz, M. T., A. Eipper, P. Tielmann, and R. Mynott. 2002. A practical NMRbased high-throughput assay for screening enantioselective catalysts and biocatalysts. Adv. Synth. Catal. 344:1008-1016. Reetz, M. T., C. Torre, A. Eipper, R. Lohmer, M. Hermes, B. Brunner, A. Maichele, M. Bocola, M. Arand, A. Cronin, Y. Genzel, A. Archelas, and R. Furstoss. 2004. Enhancing the enantioselectivity of an epoxide hydrolase by directed evolution. Org. Lett. 6:177-80. 86 169. 170. 171. 172. 173. 174. 175. 176. 177. 178. 179. 180. 181. 182. 183. 184. 185. 186. Reeves, C. D. 2003. The enzymology of combinatorial biosynthesis. Crit. Rev. Biotechnol. 23:95-147. Rice-Evans, C. A., J. Sampson, P. M. Bramley, and D. E. Holloway. 1997. Why do we expect carotenoids to be antioxidants in vivo? Free Radic. Res. 26:381-398. Rison, S. C., and J. M. Thornton. 2002. Pathway evolution, structurally speaking. Curr. Opin. Struct. Biol. 12:374-82. Rouhi, A. M. 2003. Rediscovering Natural Products. Chem. Eng. News 81(41):77-91. Sager, R., and M. Zalokar. 1958. Pigments and photosynthesis in a carotenoiddeficient mutant of Chlamydomonas. Nature 182:98-100. Sandmann, G. 1994. Carotenoid biosynthesis in microorganisms and plants. Eur. J. Biochem. 223:7-24. Sandmann, G. 2002. Combinatorial biosynthesis of carotenoids in a heterologous host: A powerful approach for the biosynthesis of novel structures. ChemBioChem 3:629-635. Sandmann, G. 2002. Molecular evolution of carotenoid biosynthesis from bacteria to plants. Physiol. Plantarum 116:431-440. Sandmann, G., M. Albrecht, G. Schnurr, O. Knorzer, and P. Boger. 1999. The biotechnological potential and design of novel carotenoids by gene combination in Escherichia coli. Trends Biotechnol. 17:233-237. Saperstein, S., and M. P. Starr. 1954. The ketonic carotenoid canthaxanthin isolated from a colour mutant of Corynebacterium michiganense. Biochem. J. 57:273-5. Satomi, Y., T. Yoshida, K. Aoki, N. Misawa, M. Masuda, M. Murakoshi, N. Takasuka, T. Sugimura, and H. Nishino. 1995. Production of phytoene, an oxidative stress protective carotenoid, in mammalian cells by introduction of phytoene synthase gene crtB isolated from a bacterium Erwinia uredovora. Proc. Jpn. Acad. Ser. B-Phys. Biol. Sci. 71:236-240. Schmidt-Dannert, C. 2000. Engineering novel carotenoids in microorganisms. Curr. Opin. Biotechnol. 11:255-261. Schmidt-Dannert, C., D. Umeno, and F. H. Arnold. 2000. Molecular breeding of carotenoid biosynthetic pathways. Nat. Biotechnol. 18:750-753. Schrader, W., A. Eipper, D. J. Pugh, and M. T. Reetz. 2002. Second-generation MS-based high-throughput screening system for enantioselective catalysts and biocatalysts. Can. J. Chem. 80:626-632. Schroeder, W. A., and E. A. Johnson. 1995. Carotenoids protect Phaffia rhodozyma against singlet oxygen damage. J. Ind. Microbiol. 14:502-507. Schwab, W. 2003. Metabolome diversity: too few genes, too many metabolites? Phytochemistry 62:837-49. Schwartz, S. H., X. Qin, and J. A. Zeevaart. 2001. Characterization of a novel carotenoid cleavage dioxygenase from plants. Journal of Biological Chemisry 276:25208-11. Schwartz, S. H., B. C. Tan, D. A. Gage, J. A. D. Zeevaart, and D. R. McCarty. 1997. Specific oxidative cleavage of carotenoids by VP14 of maize. Science 276:1872-1874. 87 187. 188. 189. 190. 191. 192. 193. 194. 195. 196. 197. 198. 199. 200. Shafikhani, S., R. A. Siegel, E. Ferrari, and V. Schellenberger. 1997. Generation of large libraries of random mutants in Bacillus subtilis by PCR-based plasmid multimerization. Biotechniques 23:304-10. Shalit, M., I. Guterman, H. Volpin, E. Bar, T. Tamari, N. Menda, Z. Adam, D. Zamir, A. Vainstein, D. Weiss, E. Pichersky, and E. Lewinsohn. 2003. Volatile ester formation in roses. Identification of an acetyl-coenzyme A. Geraniol/Citronellol acetyltransferase in developing rose petals. Plant Physiol. 131:1868-76. Smolke, C. D., V. J. J. Martin, and J. D. Keasling. 2001. Controlling the metabolic flux through the carotenoid pathway using directed mRNA processing and stabilization. Metab. Eng. 3:313-321. Steele, C. L., J. Crock, J. Bohlmann, and R. Croteau. 1998. Sesquiterpene synthases from grand fir (Abies grandis)—Comparison of constitutive and wound-induced activities, and cDNA isolation, characterization and bacterial expression of delta-selinene synthase and gamma-humulene synthase. J. Biol. Chem. 273:2078-2089. Steiger, S., A. Mazet, and G. Sandmann. 2003. Heterologous expression, purification, and enzymatic characterization of the acyclic carotenoid 1,2hydratase from Rubrivivax gelatinosus. Arch. Biochem. Biophys. 414:51-8. Steiger, S., S. Takaichi, and G. Sandmann. 2002. Heterologous production of two unusual acyclic carotenoids, 1,1'-dihydroxy-3,4-didehydrolycopene and 1hydroxy-3,4,3',4'-tetradehydrolycopene by combination of the crtC and crtD genes from Rhodobacter and Rubrivivax. J. Biotechnol. 97:51-8. Stemmer, W. P. 1994. Rapid evolution of a protein in-vitro by DNA shuffling. Nature 370:389-391. Stickforth, P., S. Steiger, W. R. Hess, and G. Sandmann. 2003. A novel type of lycopene epsilon-cyclase in the marine cyanobacterium Prochlorococcus marinus MED4. Arch. Microbiol. 179:409-415. Su, V., and B. D. Hsu. 2003. Cloning and expression of a putative cytochrome P450 gene that influences the colour of Phalaenopsis flowers. Biotechnol. Lett. 25:1933-9. Subden, R. E., and S. F. Threlkeld. 1968. Genetic and complementation studies of a new carotenoid mutant of Neurospora crassa. Can. J. Genet. Cytol. 10:351-6. Sun, Z. R., E. Gantt, and F. X. Cunningham. 1996. Cloning and functional analysis of the beta-carotene hydroxylase of Arabidopsis thaliana. J. Biol. Chem. 271:24349-24352. Takaichi, S., K. Inoue, M. Akaike, M. Kobayashi, H. Ohoka, and M. T. Madigan. 1997. The major carotenoid in all known species of heliobacteria is the C30 carotenoid 4,4'-diaponeurosporene, not neurosporene. Arch. Microbiol. 168:277-281. Takaichi, S., G. Sandmann, G. Schnurr, Y. Satomi, A. Suzuki, and N. Misawa. 1996. The carotenoid 7,8-dihydro-psi end group can be cyclized by the lycopene cyclases from the bacterium Erwinia uredovora and the higher plant Capsicum annuum. Eur. J. Biochem. 241:291-296. Takaichi, S., and K. Shimada. 1999. Pigment composition of two pigmentprotein complexes derived from anaerobically and semi-aerobically grown 88 201. 202. 203. 204. 205. 206. 207. 208. 209. 210. 211. 212. 213. 214. 215. 216. 217. Rubrivivax gelatinosus, and identification of a new keto-carotenoid, 2ketospirilloxanthin. Plant Cell Physiol. 40:613-617. Takaichi, S., Y. Tamura, T. Miyamoto, K. Azegami, Y. Yamamoto, and J. Ishidsu. 1999. Carotenogenesis pathway of novel carotenoid glucoside mycolic acid esters in Rhodococcus rhodochrous using carotenogenesis mutants and inhibitors. Biosci. Biotechnol. Biochem. 63:2014-2016. Takatsuji, H., T. Nishino, K. Izui, and H. Katsuki. 1982. Formation of dehydrosqualene catalyzed by squalene synthetase in Saccharomyces cerevisiae. J. Biochem. (Tokyo) 91:911-921. Tarshis, L. C., P. J. Proteau, B. A. Kellogg, J. C. Sacchettini, and C. D. Poulter. 1996. Regulation of product chain length by isoprenyl diphosphate synthases. Proc. Natl. Acad. Sci. U.S.A. 93:15018-15023. Tarshis, L. C., M. J. Yan, C. D. Poulter, and J. C. Sacchettini. 1994. Crystal structure of recombinant farnesyl diphosphate synthase at 2.6-angstrom resolution. Biochemistry 33:10871-10877. Taylor, R. F. 1984. Bacterial triterpenoids. Microbiol. Rev. 48:181-198. Taylor, R. F., and B. H. Davies. 1976. Triterpenoid carotenoids and related lipids—Triterpenoid carotenoid aldehydes from Streptococcus faecium Unh 564p. Biochem. J. 153:233-239. Teramoto, M., S. Takaichi, Y. Inomata, H. Ikenaga, and N. Misawa. 2003. Structural and functional analysis of a lycopene beta-monocyclase gene isolated from a unique marine bacterium that produces myxol. FEBS Lett. 545:120-126. Tietze, L. F., H. P. Bell, and S. Chandrasekhar. 2003. Natural product hybrids as new leads for drug discovery. Angew. Chem. Int. Ed. Engl. 42:3996-4028. Timberlake, C. F., and B. S. Henry. 1986. Plant pigments as natural food colors. Endeavour 10:31-36. Tuveson, R. W., R. A. Larson, and J. Kagan. 1988. Role of cloned carotenoid genes expressed in Escherichia coli in protecting against inactivation by near-UV light and specific phototoxic molecules. J. Bacteriol. 170:4675-4680. Umeno, D., and F. H. Arnold. 2003. A C35 carotenoid biosynthetic pathway. Appl. Environ. Microbiol. 69:3573-3579. Umeno, D., and F. H. Arnold. 2004. Evolution of a pathway to novel long-chain carotenoids. J. Bacteriol. 186:1531-1536. Umeno, D., K. Hiraga, and F. H. Arnold. 2003. Method to protect a targeted amino acid residue during random mutagenesis. Nucleic Acids Res. 31:e91. Umeno, D., A. V. Tobias, and F. H. Arnold. 2002. Evolution of the C30 carotenoid synthase CrtM for function in a C40 pathway. J. Bacteriol. 184:66906699. Valadon, L. R. G., and R. S. Mummery. 1977. Natural beta-apo-4'-carotenoic acid methyl ester in the fungus Verticillium agaricinum. Phytochemistry 16:613614. Van Dien, S. J., C. J. Marx, B. N. O'Brien, and M. E. Lidstrom. 2003. Genetic characterization of the carotenoid biosynthetic pathway in Methylobacterium extorquens AM1 and isolation of a colorless mutant. Appl. Environ. Microbiol. 69:7563-6. Vesterlund, S., J. Paltta, A. Laukova, M. Karp, and A. C. Ouwehand. 2004. 89 218. 219. 220. 221. 222. 223. 224. 225. 226. 227. 228. 229. 230. 231. 232. Rapid screening method for the detection of antimicrobial substances. J. Microbiol. Methods 57:23-31. Viljanen, K., S. Sundberg, T. Ohshima, and M. Heinonen. 2002. Carotenoids as antioxidants to prevent photooxidation. Eur. J. Lipid Sci. Technol. 104:353-359. von Lintig, J., and K. Vogt. 2000. Filling the gap in vitamin A research— Molecular identification of an enzyme cleaving beta-carotene to retinal. J. Biol. Chem. 275:11915-11920. von Lintig, J., and A. Wyss. 2001. Molecular analysis of vitamin a formation: Cloning and characterization of beta-carotene 15,15'-dioxygenases. Arch. Biochem. Biophys. 385:47-52. Walters, W. P., and M. Namchuk. 2003. Designing screens: how to make your hits a hit. Nat. Rev. Drug Discov. 2:259-266. Wang, C. W., and J. C. Liao. 2001. Alteration of product specificity of Rhodobacter sphaeroides phytoene desaturase by directed evolution. J. Biol. Chem. 276:41161-41164. Wang, C. W., M. K. Oh, and J. C. Liao. 2000. Directed evolution of metabolically engineered Escherichia coli for carotenoid production. Biotechnol. Prog. 16:922-926. Wang, C. W., M. K. Oh, and J. C. Liao. 1999. Engineered isoprenoid pathway enhances astaxanthin production in Escherichia coli. Biotechnol. Bioeng. 62:235241. Wang, K., and S. Ohnuma. 1999. Chain-length determination mechanism of isoprenyl diphosphate synthases and implications for molecular evolution. Trends Biochem. Sci. 24:445-451. Wieland, B., C. Feil, E. Gloriamaercker, G. Thumm, M. Lechner, J. M. Bravo, K. Poralla, and F. Gotz. 1994. Genetic and biochemical analyses of the biosynthesis of the yellow carotenoid 4,4'-diaponeurosporene of Staphylococcus aureus. J. Bacteriol. 176:7719-7726. Windhovel, U., B. Geiges, G. Sandmann, and P. Boger. 1994. Expression of Erwinia uredovora phytoene desaturase in Synechococcus Pcc7942 leading to resistance against a bleaching herbicide. Plant Physiol. 104:119-125. Wirtz, G. M., C. Bornemann, A. Giger, R. K. Muller, H. Schneider, G. Schlotterbeck, G. Schiefer, and W. D. Woggon. 2001. The substrate specificity of beta,beta-carotene 15,15'-monooxygenase. Helv. Chim. Acta 84:2301-2315. Wise, M. L., T. J. Savage, E. Katahira, and R. Croteau. 1998. Monoterpene synthases from common sage (Salvia officinalis). cDNA isolation, characterization, and functional expression of (+)-sabinene synthase, 1,8-cineole synthase, and (+)-bornyl diphosphate synthase. J. Biol. Chem. 273:14891-9. Woodall, A. A., S. W. M. Lee, R. J. Weesie, M. J. Jackson, and G. Britton. 1997. Oxidation of carotenoids by free radicals: relationship between structure and reactivity. Biochim. Biophys. Acta-Gen. Subj. 1336:33-42. Wyss, A., G. Wirtz, W. D. Woggon, R. Brugger, M. Wyss, A. Friedlein, H. Bachmann, and W. Hunziker. 2000. Cloning and expression of beta,betacarotene 15,15'-dioxygenase. Biochem. Biophys. Res. Commun. 271:334-336. Yan, W. M., G. F. Jang, F. Haeseleer, N. Esumi, J. H. Chang, M. Kerrigan, M. Campochiaro, P. Campochiaro, K. Palczewski, and D. J. Zack. 2001. Cloning 90 233. 234. 235. 236. 237. 238. 239. 240. and characterization of a human beta,beta-carotene-15,15'-dioxygenase that is highly expressed in the retinal pigment epithelium. Genomics 72:193-202. Ycas, M. 1974. On earlier states of the biochemical system. J. Theor. Biol. 44:145-60. Ye, X. D., S. Al-Babili, A. Kloti, J. Zhang, P. Lucca, P. Beyer, and I. Potrykus. 2000. Engineering the provitamin A (beta-carotene) biosynthetic pathway into (carotenoid-free) rice endosperm. Science 287:303-305. Yokoyama, A., Y. Shizuri, and N. Misawa. 1998. Production of new carotenoids, astaxanthin glucosides, by Escherichia coli transformants carrying carotenoid biosynthetic genes. Tetrahedron Lett. 39:3709-3712. Zeevaart, J. A. D., and R. A. Creelman. 1988. Metabolism and physiology of abscisic acid. Annu. Rev. Plant Physiol. Plant Molec. Biol. 39:439-473. Zhang, D. L., and C. D. Poulter. 1995. Biosynthesis of non-head-to-tail isoprenoids—Synthesis of 1'-1-structures and 1'-3-structures by recombinant yeast squalene synthase. J. Am. Chem. Soc. 117:1641-1642. Zhang, Y. W., X. Y. Li, and T. Koyama. 2000. Chain length determination of prenyltransferases: Both heteromeric subunits of medium-chain (E)-prenyl diphosphate synthase are involved in the product chain length determination. Biochemistry 39:12717-12722. Zhang, Y. W., X. Y. Li, H. Sugawara, and T. Koyama. 1999. Site-directed mutagenesis of the conserved residues in component I of Bacillus subtilis heptaprenyl diphosphate synthase. Biochemistry 38:14638-14643. Zhao, H., and F. H. Arnold. 1999. Directed evolution converts subtilisin E into a functional equivalent of thermitase. Protein Eng. 12:47-53.  91 CHAPTER 2 Evolution of the C30 Carotenoid Synthase CrtM for Function in a C40 Pathway Material from this chapter appears in Evolution of the C30 Carotenoid Synthase CrtM for Function in a C40 Pathway, Daisuke Umeno, Alexander V. Tobias, and Frances H. Arnold, Journal of Bacteriology 184(23): 6690-6699 (2002) and is reprinted with permission from the American Society for Microbiology. 92 SUMMARY The C30 carotene synthase CrtM from Staphylococcus aureus and the C40 carotene synthase CrtB from Erwinia uredovora were swapped into their respective foreign C40 and C30 biosynthetic pathways (heterologously expressed in Escherichia coli) and evaluated for function. Each displayed negligible ability to synthesize the natural carotenoid product of the other. After one round of mutagenesis and screening, we isolated 116 variants of CrtM able to synthesize C40 carotenoids. In contrast, we failed to find a single variant of CrtB with detectable C30 activity. Subsequent analysis revealed that the best CrtM mutants performed comparably to CrtB in an in vivo C40 pathway and that Phe 26 of CrtM is a key specificity-determining residue. The CrtM mutants showed significant variation in performance in their original C30 pathway, indicating the emergence of enzymes with broadened substrate specificity as well as those with shifted specificity. We also report for the first time the isolation of carotenoid pigments based on a C35 carbon backbone formed by condensation of farnesyl diphosphate (FPP) and geranylgeranyl dipohosphate (GGPP) by wild-type and variants of CrtM. The expanded substrate and product range of the CrtM mutants reported herein highlights the potential for creating further new carotenoid backbone structures. 93 INTRODUCTION A common feature of small molecule natural product biosynthetic pathways is the extensive use of enzymes with broad substrate and product specificities. Many isoprenoid biosynthetic enzymes, for example, accept a variety of both natural and unnatural substrates (27, 28, 31). Some have been shown to synthesize an impressively large number of compounds (sometimes >50) from a single substrate (9, 12, 45). Natural product biosynthetic pathways also use enzymes with remarkably stringent specificity. Such enzymes are frequently seen in key determinant positions, usually in the very early steps of a pathway, while promiscuous enzymes tend to be located further downstream. Thus, many natural product pathways have a “reverse tree” topology (3, 42) where the backbone structures of metabolites are dictated by a small number of stringent, upstream enzymes. When the substrate or product preferences of these key upstream enzymes are altered, pathway branches leading to sets of novel compounds may be opened (10). Our interest is to achieve the same by applying methods of directed enzyme evolution to recombinant pathways in Escherichia coli (43, 50). Among the most widespread of all small molecule natural products, carotenoids are natural pigments that play important biological roles. Some are accessory lightharvesting components of photosynthetic systems, while others are photo-protecting antioxidants or regulators of membrane fluidity. Recent studies advocate their effectiveness in preventing cancer and heart disease (26) as well as their potential hormonal activity (4, 18). Such diverse molecular functions justify exploring rare or novel carotenoid structures. At present, ~700 carotenoids from the naturally occurring C30 and C40 carotenoid biosynthetic pathways have been characterized (17). Most natural 94 carotenoid diversity arises from differences in types and levels of desaturation and other modifications of the C40 backbone. C40 carotenoids are also much more widespread in nature than their C30 counterparts. The former are synthesized by thousands of plant and microbial species, whereas the latter are known only in a select few bacteria (46, 48). Homocarotenoids (carotenoids with >40 carbon atoms) and apocarotenoids (carotenoids with <40 carbon atoms), which result from the action of downstream enzymes on a C40 substrate, are also known. Although these structures do not have 40 carbon atoms, they are nonetheless derived from C40 carotenoid precursors (5). The first committed step in carotenoid biosynthesis is the head-to-head condensation of two prenyl diphosphates catalyzed by a synthase enzyme (Figure 2.1). The C40 carotenoid phytoene is synthesized by the condensation of two molecules of geranylgeranyl diphosphate (GGPP, C20PP) catalyzed by the synthase CrtB. (Most phytoene synthases produce the 15Z isomer of phytoene (5)). C30 carotenoids are synthesized via an independent route whereby two molecules of farnesyl diphosphate (FPP, C15PP) are condensed to (15Z)-4,4'-diapophytoene by CrtM (48). The various downstream modification enzymes possess broad substrate specificity and therefore represent potential targets for generating biosynthetic routes to novel carotenoids. For example, when the three-step phytoene desaturase CrtI from Rhodobacter sphaeroides was replaced with a four-step enzyme from Erwinia herbicola, the cells accumulated a series of carotenoids produced neither by Erwinia nor Rhodobacter (16). Carotene desaturases (39), carotene cyclases (44), and β,β-carotene cleavage enzyme (40) have also been shown to accept a broad range of substrates. Combinatorial expression of such enzymes can create unusual and sometimes previously unidentified carotenoids (1, 2, 21). 95 Nevertheless, the greatest potential to further extend carotenoid biosynthetic diversity lies in creating whole new backbone structures, and therefore with engineering the carotene synthases. The C30 and C40 pathways are very similar except in the sizes of their precursor molecules and their distributions in nature, and it is clear that they diverged from a common ancestral pathway. We would like to determine the minimal genetic change required in key carotenoid biosynthetic enzymes to create such new pathway branches. Can the enzymes that synthesize one carotenoid be modified in a laboratory evolution experiment to synthesize others? How much of carotenoid diversity can be accessed in this way? And, can novel pathways to different, even unnatural structures (e.g., C35, C45, C50, or larger carotenoids) be accessed by using C30 or C40 enzymes as a starting point? To begin to answer these questions, we studied the performance of the C30 carotene synthase CrtM from Staphylococcus aureus in a C40 pathway and the C40 carotene synthase CrtB from Erwinia uredovora in a C30 pathway. We then examined the ability of these enzymes to adapt to their respective “foreign” pathways in order to assess the ease and uncover the mechanisms by which this might be accomplished. RESULTS AND DISCUSSION Constructing pathways for C30 and C40 carotenoids To establish a recombinant C40 pathway in E. coli, we subcloned crtE encoding GGPP (C20PP) synthase, crtB encoding phytoene synthase, and crtI encoding phytoene desaturase, all from E. uredovora, into a vector derived from pUC18, resulting in plasmid pUC-crtE-crtB-crtI (Figure 2.2a). For C30 carotenoid production, plasmid pUC-fps-crtM- 96 crtN was constructed by integrating the E. coli farnesyl diphosphate (C15PP) synthase (FPS) gene, fps, with crtM (4,4'-diapophytoene synthase gene) and crtN (4,4'diapophytoene desaturase gene) from S. aureus into the same vector. Plasmid pUC-crtMcrtN was constructed in an identical fashion, but it lacks fps. Each plasmid shares the cloning sites for the corresponding enzyme genes: EcoRI and XbaI sites flank isoprenyl diphosphate synthase (IDS) genes (crtE and fps), XbaI and XhoI sites flank carotene synthase genes (crtB and crtM), and XhoI and ApaI sites flank carotene desaturase genes (crtI and crtN) (Figure 2.2a). With this arrangement, corresponding genes could be easily swapped in order to evaluate their function in the other pathway. E. coli cells harboring pUC-crtE-crtB-crtI plasmids (C40 pathway) developed a characteristic red-pink color, whereas cells possessing pUC-fps-crtM-crtN and pUCcrtM-crtN plasmids (C30 pathway) were yellow (Figure 2.2b). HPLC analysis of extracted pigments showed that XL1-Blue(pUC-crtE-crtB-crtI) cells produce mostly lycopene (four-step desaturation) along with a small amount (5 to 10% of total pigment) of 3,4,3',4'-tetradehydrolycopene (six-step desaturation) under the conditions described. Although CrtI is classified as a four-step desaturase, production of 3,4- didehydrolycopene (five-step desaturation) by CrtI both in vivo and in vitro has been reported (15, 23). Several groups have expressed CrtM and CrtN from S. aureus in E. coli and observed almost exclusive production of 4,4'-diaponeurosporene (39, 51). However, in our XL1-Blue(pUC-crtM-crtN) expression system, the cells accumulated a significant amount of 4,4'-diapolycopene (~30% of total carotenoids). When a constitutive lac promoter (lacking the operator) was used for operon expression, the amount of 4,4'- 97 diapolycopene increased further and reached 50% of carotenoids produced (D. Umeno, unpublished data). This phenomenon was observed in all E. coli strains we tested, BL21, BL21(DE3), JM109, JM101, DH5α, HB101, SCS110, and XL10-Gold, and was insensitive to growth temperature and plasmid copy number. Thus, it is clear that the apparent desaturation step number of CrtN depends on its expression level and the effective concentration of substrates. In E. coli, FPP (C15PP) is a precursor to a variety of important housekeeping molecules such as respiratory quinones, prenylated tRNA, and dolichol. Concerned about retarding or preventing the growth of our recombinant C30 cultures due to depletion of FPP, we first expressed the fps gene along with crtM and crtN. However, we observed no difference in growth rate, pigmentation level, or carotenoid composition between XL1Blue cells harboring the pUC-crtM-crtN plasmid and those harboring the pUC-fps-crtMcrtN plasmid. This demonstrates that endogenous FPP levels in E. coli suffice to support both growth and synthesis of C30 carotenoids. Functional analysis of CrtM and CrtB swapped into their respective foreign pathways To assess the function of wild-type CrtM in a C40 pathway, pUC-crtE-crtM-crtI was constructed and transformed into E. coli XL1-Blue. Under these circumstances, CrtM is supplied with GGPP (C20PP) produced by CrtE. If CrtM were able to synthesize the C40 carotenoid phytoene from GGPP, subsequent desaturation by CrtI to lycopene would cause the cells to develop a red-pink color. However, while cells expressing the crtE-crtB-crtI operon exhibited the characteristic red-pink of lycopene (Figure 2.2b) and synthesized this carotenoid in liquid culture (Figure 2.4), cells expressing the crtE-crtM- 98 crtI operon had only very subtle pink-orange color on agar plates and synthesized much less lycopene in liquid culture (Figure 2.4). As did Raisig and Sandmann (39), we thus conclude that CrtM fails to complement CrtB in a C40 pathway and has very poor ability compared to CrtB to synthesize the C40 carotenoid backbone. This observation cannot be explained by simple competition between FPP and GGPP for access to CrtM (coupled with poor ability of CrtI to desaturate the C30 product) because XL1-Blue cells expressing the crtE-crtM-crtN operon showed only very minor yellow color development. This indicates that the availability of FPP for carotenoid biosynthesis is significantly reduced upon expression of CrtE. The function of CrtB in a C30 pathway was examined by analyzing the pigmentation of XL1-Blue cells transformed with pUC-crtB-crtN. In this case, endogenous FPP is the only available prenyl diphosphate substrate for CrtB, since the level of GGPP is very low in E. coli compared with that of FPP. If CrtB could synthesize C30 carotenoids from FPP, the 4,4'-diapophytoene produced would be desaturated by CrtN and the cells would develop a yellow color. In contrast to the intense yellow of XL1-Blue transformed with pUC-crtM-crtN, XL1-Blue(pUC-crtB-crtN) showed no color development (Figure 2.2b). When expressed alone or with CrtN, CrtB synthesized C30 carotenoids very poorly in liquid culture (see Figures 2.5 and 2.6). We thus conclude that CrtB fails to complement CrtM in a C30 pathway. We also analyzed the pigment produced by XL1-Blue carrying pUC-fps-crtBcrtN. In this case, the cells displayed a yellow color similar to that of XL1-Blue transformed with pUC-fps-crtM-crtN (Figure 2.2b). HPLC analysis of carotenoid extracts from XL1-Blue(pUC-fps-crtB-crtN) revealed the C40 carotenoid neurosporene, 99 with trace amounts of the C30 carotenoids 4,4'-diapolycopene and 4,4'-diaponeurosporene. Thus, CrtB seems to have at least some C30 activity in the presence of high levels of FPP. Production of the C40 carotenoid neurosporene as the major pigment is explained by the promiscuous nature of both FPS and CrtN. This was verified by our observation that cells expressing an fps-crtB-crtI operon had a weak pink hue and accumulated lycopene and 3,4,3',4'-tetradehydrolycopene. Thus, FPS can produce significant amounts of GGPP in E. coli when overexpressed. It is known that avian FPS also possesses weak ability to synthesize GGPP (41). Indeed, other studies have shown a varied product distribution and strong dependence on conditions for FPS enzymes (25, 34). Additionally, CrtN can accept phytoene as a substrate and introduce two or three double bonds (39). When we transformed XL1-Blue with pUC-crtE-crtB-crtN, the resulting cells exhibited significant yellow color (Figure 2.2b) and accumulated neurosporene, thus demonstrating the promiscuity of CrtN. Screening for synthase function in a foreign pathway In the previous section, we confirmed that the carotene synthases CrtB and CrtM show negligible activity in their respective foreign pathways. We next proceeded to evolve the two enzymes, with the goal of improving the function of each in the other's native pathway. To uncover CrtB variants with significant CrtM-like ability to synthesize C30 carotenoids, we constructed pUC-[crtB]-crtN libraries and transformed them into XL1-Blue cells. Here GGPP is not available, so cells with the wild-type crtB-crtN operon fail to develop color. Any variants of CrtB able to convert FPP (C15PP) into 4,4'diapophytoene would produce yellow colonies. Similarly, we searched for CrtM mutants with improved C40 activity by transforming four pUC-crtE-[crtM]-crtI libraries into XL1- 100 Blue. As described in the previous section, the amount of FPP available for carotenoid biosynthesis becomes significantly depleted when CrtE is overexpressed, resulting in negligible production of C30 carotenoids, even by native C30 enzymes. Cells expressing wild-type CrtM from the crtE-crtM-crtI operon showed a weak pink-orange color due to trace production of lycopene as well as C30 and C35 carotenoids, but CrtM mutants able to complement CrtB via acquisition of enhanced C40 activity would be expected to yield intensely red-pink colonies and thus be distinguishable on the plates. Evolution of 4,4'-diapophytoene synthase (CrtM) for function in a C40 pathway Four different mutagenic libraries of crtM corresponding to four different mutation rates were generated by performing error-prone PCR (54) on the entire 843nucleotide crtM gene. PCR products from each reaction were ligated into the XbaI-XhoI site of pUC-crtE-crtM-crtI (Figure 2.2a), resulting in pUC-crtE-[crtM]-crtI libraries. Figure 2.3 shows a typical agar plate covered with a nitrocellulose membrane upon which lie colonies of E. coli XL1-Blue expressing a crtE-[crtM]-crtI library. In each library, colonies with pale orange, pale yellow, or virtually no color dominated the population. The pale orange colonies express variants of CrtM with phenotypes similar to that of the wild-type enzyme in this context, while the pale and colorless colonies express severely or completely inactivated synthase mutants. More rare were colonies that developed an intense red-pink color, indicating significant production of C40 carotenoids and hence improved CrtB-like activity of CrtM. On average, about 0.5% of the colonies screened showed intense red-pink color. The highest frequency of positives was obtained from the library prepared by PCR with the lowest MnCl2 concentration (0.02 mM). In this library, approximately 1 out of every 120 colonies was red-pink (0.8%). We screened 101 over 23,000 CrtM mutants from the four libraries and picked 116 positive clones. These clones were re-screened by stamping them onto an agar plate covered with a white nitrocellulose membrane. All 116 stamped clones exhibited red-pink coloration. We sequenced the 10 most intensely red stamped clones, as determined by visual assessment. Mutations found in these variants (Table 2.1) were heavily biased toward transitions: 36 versus only 3 transversions. Additionally, 87% of the base substitutions found by sequencing were A/T→G/C. This is a typical observation for PCR mutagenesis with MnCl2 (7, 24). Out of 39 total nucleotide substitutions, 24 resulted in amino acid substitutions. Most notably, 9 of the 10 sequenced CrtM mutants had a mutation at phenylalanine 26. Carotenoid production of evolved CrtM variants We analyzed in detail the in vivo carotenoid production of variant M8, which has the F26L mutation only; variant M9, which has the F26S mutation; and variant M10, which has no mutation at F26. To confirm the newly acquired CrtB-like function of these three sequenced variants of CrtM, XL1-Blue cultures carrying each of the three plasmids pUC-crtE-M8-crtI, pUC-crtE-M9-crtI, and pUC-crtE-M10-crtI (collectively referred to as pUC-crtE-M8-10-crtI) were cultivated in TB medium. Extracted pigments were analyzed by HPLC with a photodiode array detector (Figure 2.4). These analyses revealed that all three clones produced the C40 carotenoids lycopene (peak 5) and 3,4,3',4'tetradehydrolycopene (peak 4) as major products, whereas cells harboring the parent pUC-crtE-crtM-crtI plasmid produced mainly C30 and trace amounts of C40 and C35 carotenoids. Two carotenoids with C35 backbone structures were detected in extracts from cells harboring pUC-crtE-crtM-crtI and pUC-crtE-M8-10-crtI. Elution profiles, UV-visible 102 spectra, and mass spectra confirm that one of the structures is the fully conjugated C35 carotenoid 4-apo-3',4'-didehydrolycopene. We also detected C35 carotenoids with 11 conjugated double bonds. Because C35 carotenoids are asymmetric, there are two possible C35 structures that possess 11 conjugated double bonds: 4-apolycopene and 4-apo-3',4'didehydro-7,8-dihydrolycopene. At present, we have not determined whether the cells synthesize one (and if so, which one) or both of these C35 carotenoids. Direct product distribution of CrtM variants in the presence of GGPP (C20PP) To directly evaluate the product specificities of the three CrtM mutants, we constructed pUC-crtE-M8-10 plasmids and transformed the plasmids into XL1-Blue cells. Here the CrtM variants are supplied with GGPP, but the carotenoid products cannot be desaturated. Because all three possible products in this scenario, 4,4'-diapophytoene (C30), 4-apophytoene (C35), and phytoene (C40), have an identical chromophore structure consisting of three conjugated double bonds, the molecular extinction coefficients for all three can be assumed to be equivalent, irrespective of the total number of carbon atoms in the carotenoid molecule (49). Thus, the product distribution of the CrtM variants can be discerned from the HPLC chromatogram peak heights (at 286 nm) for each product. As can be seen in Figure 2.5, cultures expressing CrtB along with CrtE produced approximately 230 nmol of phytoene/g of dry cell mass but did not detectably synthesize C30 or C35 carotenoids. CrtE-CrtM cultures produced about 20 to 35 nmol of each of the C30, C35, and C40 carotenoids/g. In stark contrast, CrtE-M8 and CrtE-M9 cultures, which express synthases mutated at F26, generated over 300 nmol of phytoene/g. These cultures also produced 40 to 75% more C35 carotenoids but 70 to 90% fewer C30 carotenoids than CrtE-CrtM cultures. Cultures expressing M10, which has no mutation at F26, along with 103 CrtE synthesized roughly 100 nmol of phytoene/g as well as about 20 and 14 nmol of C35 and C30 carotenoids/g, respectively. Comparison of the C40 and C30 performance of CrtM variants To compare the acquired CrtB-like C40 function of the CrtM mutants with their CrtM-like ability to synthesize C30 carotenoids, the three mutants were placed back into the original C30 pathway, resulting in pUC-M8-10-crtN plasmids. Pigmentation analysis of cells carrying these as well as pUC-crtE-M8-10-crtI plasmids (Figure 2.6) revealed that the CrtM variants retained C30 activity, although the C30 pathway performance of cells expressing these mutants varied. Acetone extracts of cultures expressing variant M8, which has the F26L mutation alone, along with CrtE and CrtI (CrtE-M8-CrtI cultures) had more than threefold-higher C40 carotenoid absorbance (475 nm) than extracts of CrtECrtM-CrtI cultures. However, the C30 carotenoid absorbance (470 nm) of extracts of cultures expressing variant M8 and CrtN was only about 40% that of CrtM-CrtN cultures. Cultures expressing variant M9, which has the F26S mutation, along with CrtE and CrtI also yielded extracts with over three times the C40 signal of CrtE-CrtM-CrtI culture extracts. Yet the C30 signal of M9-CrtN culture extracts was only about 10% that of CrtMCrtN culture extracts. Cultures expressing mutant M10, which has no mutation at F26, along with CrtE and CrtI generated extracts with approximately 70% higher C40 absorbance than extracts of CrtE-CrtM-CrtI cultures. Interestingly, cultures expressing M10 and CrtN showed no reduction in C30 pathway performance compared to CrtM-CrtN cultures. M10 was the only one of the 10 sequenced variants that gave this result (data not shown). 104 Analysis of mutations The most significant and only recurring mutations found in the 10 sequenced CrtM variants were those at F26. In seven variants, phenylalanine is replaced by leucine, while two have serine at this position. The F26L substitution alone is sufficient for acquisition of C40 activity by CrtM (M8; Table 2.1). Thus, we conclude that mutation at residue 26 of CrtM directly alters the enzyme's specificity. Changing enzyme expression level or stability would not lead to increased C40 performance and decreased C30 performance of cultures expressing CrtM variants compared to those expressing wildtype CrtM (Figure 2.6). Variant M10 possesses no mutation at amino acid position 26. Thus, it is apparent that mutation at this residue is not the only means by which CrtM can acquire CrtB-like activity. Of all 10 sequenced variants, M10 is the only one with no substitution for phenylalanine at position 26 and is also the only one whose cultures did not have decreased C30 pathway performance compared to CrtM cultures. Structural considerations: mapping mutations onto human squalene synthase Most structurally characterized isoprenoid biosynthetic enzymes, including FPS, squalene synthase (SqS), and terpene cyclases, have the same “isoprenoid synthase fold,” consisting predominantly of α-helices (22). In addition, secondary structure prediction (11) and sequence alignment (8) of CrtM and CrtB with their related enzymes also suggest that the enzymes have a common fold. Given this, and the lack of a crystal structure for a carotenoid synthase, we mapped the amino acid substitutions in our CrtM variants onto the crystal structure of human SqS (37). SqSs catalyze the first committed step in cholesterol biosynthesis. As with carotene synthases, this is the head-to-head condensation of two identical prenyl 105 diphosphates (FPP for SqS). The condensation reaction catalyzed by SqS proceeds in two distinct steps (38). The first half-reaction generates the stable intermediate presqualene diphosphate, which forms upon abstraction of a diphosphate group from a prenyl donor, followed by 1-1' condensation of the donor and acceptor molecules. In the second halfreaction, the intermediate undergoes a complex rearrangement followed by a second removal of diphosphate and a final carbocation-quenching process (Figure 2.7). SqSs catalyze the additional reduction of the central double bond of 4,4'-diapophytoene (also called dehydrosqualene) by NADPH to form squalene, a reaction not performed by carotene synthases. Because the SqS and carotene synthase enzymes share clusters of conserved amino acids and catalyze essentially identical reactions, it is probable that they also have the same reaction mechanism. Indeed, when NADPH is in short supply, SqS produces 4,4'-diapophytoene, the natural product of CrtM (19, 52). Sequence alignment of CrtM with related enzymes implies that F26 in CrtM corresponds to I58 in human SqS, which is located in helix B and points into the pocket that accommodates the second half-reaction. This residue is located four amino acids downstream of a flexible “flap” region in SqS that is believed to form a “lid” that shields intermediates in the reaction pocket from water (37). The amino acids constituting the flap are almost completely conserved among all known head-to-head isoprenoid synthase enzymes that catalyze 1-1' condensation. It is noteworthy that a single mutation at F26 of CrtM is sufficient to permit this enzyme to synthesize C40 carotenoids. Because this position is thought to lie in the site of the second half-reaction (rearrangement and quenching of a cyclopropylcarbinyl intermediate) (37), and because wild-type CrtM produces trace amounts of phytoene 106 (indicating that initially accepting two molecules of GGPP is not impossible), it is likely that wild-type CrtM is able to perform the first half-reaction of phytoene synthesis (condensation of two molecules of GGPP to form a presqualene diphosphate-like structure). We hypothesize that the F26 residue prevents the second half-reaction from going to completion by acting as a steric or electrostatic inhibitor of intermediate rearrangement. When this bulky phenylalanine residue is replaced with a smaller or more flexible amino acid such as serine or leucine, the second half-reaction is permitted to proceed and phytoene is produced. Similar results for a variety of short-chain isoprenyl diphosphate synthases (IDSs) have been reported. In this class of enzymes, the size of the fifth amino acid upstream of the first aspartate-rich motif determines product length (29, 32, 33, 35, 36). Based on a very strong correlation between average product length and surface area of amino acids in this position (36), as well as the available crystal structure for avian FPS (47), it was hypothesized that this residue forms a steric barrier or wall that controls the size of the products (30). This model has been successfully applied to a variety of other enzymes in this family, including medium-chain IDSs (53). It is unknown why so many IDSs differing so greatly in sequence share a single key residue that determines product specificity. Evolution of phytoene synthase (CrtB) in a C30 pathway We constructed mutant libraries of crtB to search for variants with C30 activity. Four mutagenic PCR libraries differing in MnCl2 concentration were ligated into the XbaI-XhoI site of pUC-crtB-crtN, resulting in four pUC-[crtB]-crtN plasmid libraries. Upon transformation into XL1-Blue, pUC-crtB-crtN, containing wild-type crtB, gave no 107 discernible pigmentation, while the pUC-crtM-crtN cells produced had intense yellow pigmentation. Among the ~43,000 colonies expressing pUC-[crtB]-crtN variants screened, not a single one showed distinguishable yellow (or other) pigmentation. Thus, we found no CrtB mutants with improved C30 activity. We also constructed five additional pUC-[crtB]-crtN libraries by using the Genemorph PCR mutagenesis kit (Stratagene), which enables the construction of randomly mutagenized gene libraries with a mutational spectrum different from that of those generated by mutagenic PCR with MnCl2 (7). We screened an additional ~10,000 variants, but again found no variants of CrtB able to synthesize C30 carotenoids at appreciable levels. An explanation for the relative difficulty in acquiring C30 function for CrtB may be that accepting a smaller-than-natural substrate is a more difficult task for this type of enzyme than accepting a larger-than-natural substrate. However, an evolutionary explanation may also be in order. The contexts in which the two enzymes evolved differ markedly. FPP is a precursor for many life-supporting compounds and is present in all organisms. Thus, C40 enzymes such as CrtB have evolved in the presence of FPP throughout their history. It is not unreasonable to infer that CrtB has evolved under a nontrivial selection pressure to minimize consumption of FPP, for accepting FPP as a substrate and bypassing GGPP could be detrimental to the host organism's fitness. In stark contrast, C30 synthases have evolved in an environment essentially devoid of GGPP. Consequently, no pressure to reject this substrate has been placed on these enzymes. 108 CONCLUSIONS We have demonstrated for the first time that the specificity of a carotenoid synthase is easily and profoundly altered by directed evolution. In our experiments, the carotene synthases CrtM and CrtB failed to complement one another in their respective foreign pathways. However, upon random mutagenesis of crtM followed by C40-specific color complementation screening, we isolated 116 mutants of the enzyme (~0.5% of the total screened) with significant C40 activity. The in vivo C40 pathway performance of the best CrtM variants is comparable to that of CrtB, the native C40 synthase. That CrtM, a key biosynthetic enzyme that determines the size of the carotenoids in the downstream pathway, is capable of synthesizing C35 carotenoid backbones and is one amino acid substitution from becoming a C40 phytoene synthase is a finding of evolutionary and technological significance. Firn and Jones have suggested that natural product biosynthetic pathways have evolved traits that enhance their ability to generate and retain chemical diversity in order to maximize their likelihood of discovering new biologically active molecules (13, 14, 20). The two major traits that Firn and Jones have identified in these pathways are the use of enzymes with broad substrate or product specificity and a high degree of pathway branching or bifurcation. Our work has revealed a special type of combinatorial pathway branching that exploits the precursor-fusion chemistry of carotenoid synthases. The native reaction catalyzed by CrtM is the condensation of two molecules of FPP to form a C30 carotenoid backbone. Here we have shown that wild-type CrtM also possesses the ability to condense one molecule of FPP with one molecule of GGPP to form a C35 carotenoid backbone. However, the enzyme is very poor at condensing two molecules of 109 GGPP to form the C40 carotenoid backbone, phytoene. By broadening the specificity of CrtM through point mutagenesis, we have created variants that can also synthesize C40 carotenoids. That these mutants can synthesize two non-native products as a result of the addition of only one new precursor (GGPP) to their substrate repertoires is a consequence of both their broadened specificity as well as the nature of the coupling reaction catalyzed by carotenoid synthases. If a (mutant) carotenoid synthase does not discriminate between n different prenyl diphosphate substrates, it will synthesize n(n+1)/2 different carotenoid backbones by virtue of the combinatorics of substrate coupling. Therefore, carotenoid synthases, by virtue of their special chemistry, can act as key “diversity-multiplying” enzymes in carotenoid biosynthetic pathways if suitable mutants able to accept nonnative precursors can be found. In the following chapter, we describe the continuation of our efforts to further expand carotenoid biosynthesis by creating additional backbones that can serve as new branch points for carotenoid pathway diversification. MATERIALS AND METHODS Materials Erwinia uredovora (current approved name: Pantoea ananatis) C40 carotenoid pathway genes crtE encoding GGPP (C20PP) synthase, crtB encoding phytoene synthase, and crtI encoding phytoene desaturase were obtained by genomic PCR as previously described (43). The Escherichia coli farnesyl diphosphate (FPP, C15PP) synthase gene fps was cloned from E. coli strain JM109. The C30 pathway genes crtM (4,4'-diapophytoene synthase) and crtN (4,4'-diapophytoene desaturase) were cloned by PCR from Staphylococcus aureus genomic DNA (ATCC no. 35556D). We used E. coli XL1-Blue 110 supercompetent cells (Stratagene, La Jolla, CA) for cloning, screening, and carotenoid biosynthesis. AmpliTaq polymerase (Perkin-Elmer, Boston, MA) was employed for mutagenic PCR, while Vent polymerase (New England Biolabs, Beverly, MA) was used for cloning PCR. All chemicals and reagents used were of the highest available grade. Plasmid construction Plasmid maps and sequences can be found in Appendix A. Plasmid pUC18m was constructed by removing the entire lacZ fragment and multi-cloning site from pUC18 and inserting the multi-restriction CTCGAG-GGGCCC-GGCGCC-3' site sequence 5'-CATATG-GAATTC-TCTAGA- (NdeI-EcoRI-XbaI-XhoI-ApaI-EheI). Each open reading frame following a Shine-Dalgarno ribosomal binding sequence (boldface) and a spacer (AGGAGGATTACAAA) was cloned into pUC18m (see Appendix A) to form artificial operons for acyclic C40 carotenoids (pUC-crtE-crtB-crtI) or acyclic C30 carotenoids (pUC-fps-crtM-crtN or pUC-crtM-crtN) (the genes in plasmids and operons are always listed in transcriptional order). To facilitate exchange between the two pathways, corresponding genes were flanked by the same restriction sites: isoprenyl diphosphate synthase genes (fps and crtE) were flanked by EcoRI and XbaI sites, carotene synthase genes (crtM and crtB) were flanked by XbaI and XhoI sites, and carotene desaturase genes (crtN and crtI) were flanked by XhoI and ApaI sites (Figure 2.2a). Error-prone PCR mutagenesis and screening A pair of primers (5'-GCTGCCGTCAGTTAATCTAGAAGGAGG-3') and (5'AGACGAATTGCCAGTGCCAGGCCACCG-3') flanking crtM were designed to amplify the 0.85-kb gene by PCR under mutagenic conditions: 5 U AmpliTaq (100 µl 111 total volume); 20 ng of template DNA (entire plasmid); 50 pmol of each primer; 0.2 mM dATP; 1.0 mM (each) dTTP, dGTP, and dCTP; and 5.5 mM MgCl2. Four different mutagenic libraries were made by using four different MnCl2 concentrations: 0.2, 0.1, 0.05, and 0.02 mM. The temperature cycling scheme was 95 °C for 4 min followed by 30 cycles of 95 °C for 30 s, 40 °C for 45 s, and 72 °C for 2 min and by a final stage of 72 °C for 10 min. PCR yields for the 0.85-kb amplified fragment were 5 µg, corresponding to an amplification factor of ~1,000 or ~10 effective cycles. The PCR product from each library was purified with a Zymoclean gel purification kit (Zymo Research, Orange, CA), followed by digestion with XhoI and XbaI and DpnI treatment to digest the template. The PCR products were ligated into the carotene synthase gene site of vector pUC-crtE-crtMcrtI, resulting in pUC-crtE-[crtM]-crtI libraries (square brackets indicate the randomly mutagenized gene). PCR mutagenesis of crtB on plasmid pUC-crtB-crtN was performed with primers 5'-CTTTACACTTTATGCTTCCGG-3' and 5'-TCCTGTGACACCTG CACCAATTACTGC-3' under the same conditions used for mutagenesis of crtM. The PCR products were purified, digested, and ligated as described above into the carotene synthase gene site of pUC-crtB-crtN, resulting in four pUC-[crtB]-crtN libraries. The ligation mixtures were transformed into E. coli XL1-Blue supercompetent cells. Colonies were grown on Luria-Bertani (LB) plates containing carbenicillin (50 mg/l) as a selective marker at 37 °C for 12 h. Colonies were lifted onto white nitrocellulose membranes (Pall, Port Washington, NY), transferred onto LB+carbenicillin plates, and visually screened for color variants after an additional 12 to 24 h at room temperature. Selected colonies were picked and cultured overnight in 96-well plates, each well containing 0.5 ml of liquid LB medium supplemented with carbenicillin (50 mg/l). 112 Pigment analysis Among the strains we tested as expression hosts, XL1-Blue showed the best results in terms of stability and intensity of the color developed by colonies on agar plates. Although all of the genes assembled in each plasmid are grouped under a single lac operator/promoter, our expression system showed no response in terms of pigmentation levels to different IPTG (isopropyl-β-D-thiogalactopyranoside) concentrations. Thus, leaky transcription from the lac promoter was sufficient for carotenoid production in E. coli. Based on this observation, all experiments described in this report were performed without IPTG induction. To measure the relative amounts of carotenoids synthesized (see Figure 2.6), single colonies were inoculated into 3-ml precultures (LB medium containing 50 mg/l of carbenicillin) and shaken at 250 rpm and 37 °C overnight. Twenty microliters of each preculture were inoculated into 3 ml of Terrific broth (TB) medium (also containing 50 mg/l of carbenicillin) and shaken for 24 (C30 carotenoid cultures) or 30 h (C40 carotenoid cultures) at 250 rpm and 30 °C. The optical density at 600 nm (OD600) of each culture was measured immediately before harvesting. Then, 2 ml of each TB culture was centrifuged, the liquid was decanted, and the resulting cell pellet was extracted with 1 ml of acetone. The absorbance spectrum of each extract was measured with a SpectraMax Plus 384 microplate spectrophotometer (Molecular Devices, Sunnyvale, CA). Pigmentation levels in the culture extracts were determined from the height of absorption maxima (λmax): 470 nm for C30 carotenoids and 475 nm for C40 carotenoids. For accurate determination of the carotenoids produced by the cultures, 500 µl of LB preculture was inoculated into 50 ml of TB+carbenicillin (50 mg/l) and shaken in a 113 250-ml tissue culture flask (Becton Dickinson-Falcon, Bedford, MA) at 170 rpm and 30 °C for 24 to 30 h. Cultures expressing only CrtE plus a carotenoid synthase (CrtB, CrtM, or a mutant CrtM) were cultivated in 50 ml of TB+carbenicillin (50 mg/l) for 40 h at 160 rpm and 28 °C in 250-ml tissue culture flasks. The OD600 of each culture was measured immediately before harvesting, and the dry cell mass was determined from this measurement by using a calibration curve generated for similar cultures. After centrifugation, the cell pellets were extracted with 10 ml of an acetone-methanol mixture (2:1 [vol/vol]). Pigments were concentrated, and the solvent was replaced with 20 ml of hexane. Then, an equal volume of aqueous NaCl (100 g/l) was added, and the mixture was shaken vigorously to remove oily lipids. The upper phase containing the carotenoids was dewatered with anhydrous MgSO4 and concentrated in a rotary evaporator. The final volume of extract from each 50-ml culture was 1 ml. A 30- to 50-µl aliquot of extract was passed through a Spherisorb ODS2 column (4.6 × 250 mm, 5-µm particle size; Waters, Milford, MA) and eluted with an acetonitrile-isopropanol mixture (93:7 or 80:20 [vol/vol]) at a flow rate of 1 ml/min using an Alliance high-pressure liquid chromatography (HPLC) system (Waters) equipped with a photodiode array detector. Mass spectra were obtained with a series 1100 HPLC-mass spectrometer (HewlettPackard/Agilent, Palo Alto, CA) coupled with an atmospheric pressure chemical ionization interface. The molar quantities of the carotenoid backbones shown in Figure 2.5 were determined by comparing their HPLC chromatogram peak heights (at 286 nm) to a calibration curve generated using known amounts of a β,β-carotene standard (Sigma), and then multiplying by εβ,β-carotene (450 nm)/εphytoene (286 nm). The values of the molar 114 extinction coefficients (ε) used in the calculation were 138,900 and 49,800, respectively (6). The molar quantities of carotenoids were then normalized to the dry cell mass of each culture. 115 Table 2.1. Mutations found in sequenced CrtM variants Mutant designation Nonsynonymous mutations (amino acid change) Synonymous mutations M1 T76C (F26L) A364T (T122S) A561G M2 A58G (K20E) T77C (F26S) A471T M3 T76C (F26L) G127A (V43M) A408G M4 T76C(F26L) A446G (E149G) T150C G489A A726G M5 T76C (F26L) T800C (F267S) M6 A35G (H12R) T76C (F26L) A80G (D27G) A290G (K97R) A620G (H207R) A688G M7 T76C (F26L) A186G A447G M8 T78A (F26L) A345G M9 T77C (F26S) T119C (I40T) T135C T141C M10 A10G (M4V) A35G (H12R) T176C (F59S) A242G (Q81R) A539G (E180G) A39G 116 Figure 2.1 117 Figure 2.1. Natural carotenoid biosynthetic pathways. Carotenoid pathways are branches of the general isoprenoid pathway. In nature, two distinctive routes to carotenoid structures are known. C40 pathways, which start from the head-to-head condensation of two molecules of GGPP (C20PP), are found in a variety of plant and microbial species. C30 pathways, which begin with the condensation of two molecules of FPP (C15PP), have been identified only in a small number of bacterial species. Shown are the 15Z isomers of 4,4'-diapophytoene and phytoene, which are produced by CrtM and CrtB, respectively. Bacterial desaturases CrtN and CrtI catalyze Z-E isomerization of the central double bond in addition to desaturation of their carotenoid backbone substrates (15). The enzyme FPS is an FPP synthase; CrtE is a bacterial GGPP synthase; CrtM and CrtB are bacterial carotenoid synthases. DMAPP, dimethylallyl diphosphate; IPP, isopentenyl diphosphate. 118 Figure 2.2 119 Figure 2.2. C30 and C40 production systems used in this work. (a) Plasmids used in this work. Under the control of the lac promoter and operator of a pUC18-derived plasmid, carotene synthase genes (crtB and crtM) were cloned into an XbaI-XhoI site, along with the isoprenyl diphosphate synthase genes (crtE and fps; EcoRI-XbaI site) and the carotene desaturase genes (crtN and crtI; XhoI-ApaI site). Listed on the right are the approximate mole percentages (as a fraction of total carotenoids) of the main carotenoids produced by E. coli XL1-Blue cells transformed with each plasmid. Only major species consisting of at least 10% of total carotenoids are shown. ND, none detected. (b) Cell pellets of XL1-Blue harboring various carotenogenic plasmids. 120 Figure 2.3 121 Figure 2.3. Typical plate with E. coli XL1-Blue colonies expressing a mutagenic library of CrtM together with CrtI and CrtE. XL1-Blue cells were transformed with pUC-crtE-[crtM]-crtI (E[M]I), where [crtM] represents a mutagenic library of crtM. Among a majority of pale colonies can be seen deep red-pink colonies (arrows) expressing CrtM variants that have acquired C40 pathway functionality. EMI and EBI, XL1-Blue cells respectively. transformed with pUC-crtE-crtM-crtI and pUC-crtE-crtB-crtI, 122 Figure 2.4 123 Figure 2.4. HPLC-photodiode array analysis of carotenoid extracts of E. coli transformants carrying plasmids pUC-crtE-crtB-crtI, pUC-crtE-crtM-crtI, and pUCcrtE-M8-10-crtI. The following carotenoids were identified: peak 1, 4,4'-diapolycopene (λmax [nm]: 501, 470, 444, M+ at m/z = 400.4); peak 2, 4-apo-3',4'-didehydrolycopene (λmax [nm]: 527, 490, 465, M+ at m/z = 466.4); peak 3, 4-apolycopene or 4-apo-3',4'didehydro-7,8-dihydrolycopene (λmax [nm]: 500, 470, 441, M+ at m/z = 468.4); peak 4, 3,4,3',4'-tetradehydrolycopene (λmax [nm]: 540, 510, 480, M+ at m/z = 532.4); peak 5, lycopene (λmax [nm]: 502, 470, 445, M+ at m/z = 536.5). Double peaks indicate different geometrical isomers of the same compound. Insets, recorded absorption spectra of individual HPLC peaks. 124 Figure 2.5. Direct product distribution of CrtM and its mutants in the presence of CrtE (GGPP supply). Carotenoid extracts of XL1-Blue cells carrying plasmids pUCcrtE-crtB, pUC-crtE-crtM, and pUC-crtE-M8-10 were analyzed by HPLC with a photodiode array detector. Peaks for 4,4'-diapophytoene (C30), 4-apophytoene (C35), and phytoene (C40) were monitored at 286 nm. Molar quantities of the various carotenoids were determined as described in Materials and Methods. Bar heights are normalized to dry cell mass, each represents the average of three independent cultures; error bars, standard deviations. ND, not detected. 125 Figure 2.6. Pigmentation produced by CrtM variants in C40 and C30 pathways. XL1Blue cells were transformed with either pUC-crtE-M8-10-crtI (C40 pathway) or pUC-M8-10-crtN (C30 pathway) and cultured in a test tube (3 ml of TB) as described in Materials and Methods. Pigmentation levels in the culture extracts were determined from the absorption peak height of λmax (470 nm for C30 carotenoids, 475 nm for C40 carotenoids) of each sample. Bar heights are normalized to OD600 and represent the averages of at least three replicates; error bars, standard deviations. 126 Figure 2.7. Reaction schemes for SqS and CrtM. PSPP, presqualene diphosphate. 127 REFERENCES 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. Albrecht, M., S. Takaichi, N. Misawa, G. Schnurr, P. Boger, and G. Sandmann. 1997. Synthesis of atypical cyclic and acyclic hydroxy carotenoids in Escherichia coli transformants. J. Biotechnol. 58:177-185. Albrecht, M., S. Takaichi, S. Steiger, Z. Y. Wang, and G. Sandmann. 2000. Novel hydroxycarotenoids with improved antioxidative properties produced by gene combination in Escherichia coli. Nat. Biotechnol. 18:843-846. Armstrong, G. A., and J. E. Hearst. 1996. Carotenoids 2: Genetics and molecular biology of carotenoid pigment biosynthesis. Faseb J 10:228-37. Ben-Dor, A., A. Nahum, M. Danilenko, Y. Giat, W. Stahl, H. D. Martin, T. Emmerich, N. Noy, J. Levy, and Y. Sharoni. 2001. Effects of acyclo-retinoic acid and lycopene on activation of the retinoic acid receptor and proliferation of mammary cancer cells. Arch. Biochem. Biophys. 391:295-302. Britton, G. 1998. Overview of carotenoid biosynthesis, p. 13-140. In G. Britton, S. Liaaen-Jensen, and H. Pfander (ed.). Carotenoids vol. 3: Biosynthesis and Metabolism. Birkhäuser Verlag, Basel. Britton, G. 1995. UV/Visible Spectroscopy, p. 13-62. In G. Britton, S. LiaaenJensen, and H. Pfander (ed.). Carotenoids, vol. 1B: Spectroscopy. Birkhäuser Verlag, Basel. Cline, J., and H. Hogrefeo. 1999. Randomize gene sequences with new PCR mutagenesis kit. Stratagies 13:157-162. Corpet, F. 1988. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res. 16:10881-90. Crock, J., M. Wildung, and R. Croteau. 1997. Isolation and bacterial expression of a sesquiterpene synthase cDNA clone from peppermint (Mentha x piperita, L.) that produces the aphid alarm pheromone (E)-beta-farnesene. Proc. Natl. Acad. Sci. USA 94:12833-12838. Croteau, R., F. Karp, K. C. Wagschal, D. M. Satterwhite, D. C. Hyatt, and C. B. Skotland. 1991. Biochemical characterization of a spearmint mutant that resembles peppermint in monoterpene content. Plant Physiol. 96:744-752. Cuff, J. A., M. E. Clamp, A. S. Siddiqui, M. Finlay, and G. J. Barton. 1998. JPred: a consensus secondary structure prediction server. Bioinformatics 14:892-3. Facchini, P. J., and J. Chappell. 1992. Gene family for an elicitor-induced sesquiterpene cyclase in tobacco. Proc. Natl. Acad. Sci. USA 89:11088-11092. Firn, R. D., and C. G. Jones. 2000. The evolution of secondary metabolism—a unifying model. Mol. Microbiol. 37:989-994. Firn, R. D., and C. G. Jones. 2003. Natural products—a simple model to explain chemical diversity. Nat. Prod. Rep. 20:382-391. Fraser, P. D., N. Misawa, H. Linden, S. Yamano, K. Kobayashi, and G. Sandmann. 1992. Expression in Escherichia coli, purification, and reactivation of the recombinant Erwinia uredovora phytoene desaturase. J. Biol. Chem. 267:19891-19895. Garcia-Asua, G., H. P. Lang, C. N. Hunter, and R. J. Cogdell. 1998. Carotenoid diversity: a modular role for the phytoene desaturase step. Trends Plant Sci. 3:445-449. 128 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. Hornero-Méndez, D., and G. Britton. 2002. Involvement of NADPH in the cyclization reaction of carotenoid biosynthesis. FEBS Lett. 515:133-136. Ishimi, Y., M. Ohmura, X. X. Wang, M. Yamaguchi, and S. Ikegami. 1999. Inhibition by carotenoids and retinoic acid of osteoclast-like cell formation induced by bone-resorbing agents in vitro. J. Clin. Biochem. Nutr. 27:113-122. Jarstfer, M. B., B. S. J. Blagg, D. H. Rogers, and C. D. Poulter. 1996. Biosynthesis of squalene. Evidence for a tertiary cyclopropylcarbinyl cationic intermediate in the rearrangement of presqualene diphosphate to squalene. J. Am. Chem. Soc. 118:13089-13090. Jones, C. G., and R. D. Firn. 1991. On the evolution of plant secondary chemical diversity. Philos. Trans. R. Soc. Lond. Ser. B-Biol. Sci. 333:273-280. Komori, M., R. Ghosh, S. Takaichi, Y. Hu, T. Mizoguchi, Y. Koyama, and M. Kuki. 1998. A null lesion in the rhodopin 3,4-desaturase of Rhodospirillum rubrum unmasks a cryptic branch of the carotenoid biosynthetic pathway. Biochemistry 37:8987-8994. Lesburg, C. A., J. M. Caruthers, C. M. Paschall, and D. W. Christianson. 1998. Managing and manipulating carbocations in biology: terpenoid cyclase structure and mechanism. Curr. Opin. Struct. Biol. 8:695-703. Linden, H., N. Misawa, D. Chamovitz, I. Pecker, J. Hirschberg, and G. Sandmann. 1991. Functional complementation in Escherichia coli of different phytoene desaturase genes and analysis of accumulated carotenes. Z. Naturforsch. (C) 46:1045-1051. LinGoerke, J. L., D. J. Robbins, and J. D. Burczak. 1997. PCR-based random mutagenesis using manganese and reduced dNTP concentration. Biotechniques 23:409-412. Matsuoka, S., H. Sagami, A. Kurisaki, and K. Ogura 1991. Variable product specificity of microsomal dehydrodolichyl diphosphate synthase from rat liver. J. Biol. Chem. 266:3464-3468. Mayne, S. T. 1996. Beta-carotene, carotenoids, and disease prevention in humans. Faseb J. 10:690-701. Nagaki, M., S. Sato, Y. Maki, T. Nishino, and T. Koyama. 2000. Artificial substrates for undecaprenyl diphosphate synthase from Micrococcus luteus B-P 26. J. Mol. Catal. B-Enzym. 9:33-38. Nagaki, M., A. Takaya, Y. Maki, J. Ishibashi, Y. Kato, T. Nishino, and T. Koyama. 2000. One-pot syntheses of the sex pheromone homologs of a codling moth, Laspeyresia promonella L. J. Mol. Catal. B-Enzym. 10:517-522. Narita, K., S. Ohnuma, and T. Nishino. 1999. Protein design of geranyl diphosphate synthase. Structural features that define the product specificities of prenyltransferases. J Biochem (Tokyo) 126:566-71. Ogura, K., and T. Koyama. 1998. Enzymatic aspects of isoprenoid chain elongation. Chem. Rev. 98:1263-1276. Ohnuma, S., H. Hemmi, T. Koyama, K. Ogura, and T. Nishino. 1998. Recognition of allylic substrates in Sulfolobus acidocaldarius geranylgeranyl diphosphate synthase: Analysis using mutated enzymes and artificial allylic substrates. J. Biochem. (Tokyo) 123:1036-1040. 129 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. Ohnuma, S., K. Hirooka, H. Hemmi, C. Ishida, C. Ohto, and T. Nishino. 1996. Conversion of product specificity of archaebacterial geranylgeranyl-diphosphate synthase—identification of essential amino acid residues for chain length determination of prenyltransferase reaction. J. Biol. Chem. 271:18831-18837. Ohnuma, S., K. Hirooka, C. Ohto, and T. Nishino. 1997. Conversion from archaeal geranylgeranyl diphosphate synthase to farnesyl diphosphate synthase— Two amino acids before the first aspartate-rich motif solely determine eukaryotic farnesyl diphosphate synthase activity. J. Biol. Chem. 272:5192-5198. Ohnuma, S., T. Koyama, and K. Ogura 1993. Alternation of the product specificities of prenyltransferases by metal ions. Biochem. Biophys. Res. Commun. 192:407-412. Ohnuma, S., T. Nakazawa, H. Hemmi, A. M. Hallberg, T. Koyama, K. Ogura, and T. Nishino. 1996. Conversion from farnesyl diphosphate synthase to geranylgeranyl diphosphate synthase by random chemical mutagenesis. J. Biol. Chem. 271:10087-10095. Ohnuma, S., K. Narita, T. Nakazawa, C. Ishida, Y. Takeuchi, C. Ohto, and T. Nishino. 1996. A role of the amino acid residue located on the fifth position before the first aspartate-rich motif of farnesyl diphosphate synthase on determination of the final product. J. Biol. Chem. 271:30748-30754. Pandit, J., D. E. Danley, G. K. Schulte, S. Mazzalupo, T. A. Pauly, C. M. Hayward, E. S. Hamanaka, J. F. Thompson, and H. J. Harwood. 2000. Crystal structure of human squalene synthase—A key enzyme in cholesterol biosynthesis. J. Biol. Chem. 275:30610-30617. Poulter, C. D., T. L. Capson, M. D. Thompson, and R. S. Bard. 1989. Squalene synthetase—inhibition by ammonium analogs of carbocationic intermediates in the conversion of presqualene diphosphate to squalene. J. Am. Chem. Soc. 111:3734-3739. Raisig, A., and G. Sandmann. 2001. Functional properties of diapophytoene and related desaturases of C30 and C40 carotenoid biosynthetic pathways. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 1533:164-170. Redmond, T. M., S. Gentleman, T. Duncan, S. Yu, B. Wiggert, E. Gantt, and F. X. Cunningham. 2001. Identification, expression, and substrate specificity of a mammalian beta-carotene 15,15'-dioxygenase. J. Biol. Chem. 276:6560-6565. Reed, B. C., and H. C. Rilling. 1976. Substrate binding of avian liver prenyltransferase. Biochemistry 15:3739-45. Sacchettini, J. C., and C. D. Poulter. 1997. Creating isoprenoid diversity. Science 277:1788-1789. Schmidt-Dannert, C., D. Umeno, and F. H. Arnold. 2000. Molecular breeding of carotenoid biosynthetic pathways. Nat Biotechnol 18:750-3. Schnurr, G., N. Misawa, and G. Sandmann. 1996. Expression, purification and properties of lycopene cyclase from Erwinia uredovora. Biochem. J. 315:869-74. Steele, C. L., J. Crock, J. Bohlmann, and R. Croteau. 1998. Sesquiterpene synthases from grand fir (Abies grandis)—comparison of constitutive and woundinduced activities, and cDNA isolation, characterization and bacterial expression of delta-selinene synthase and gamma-humulene synthase. J. Biol. Chem. 273:2078-2089. 130 46. 47. 48. 49. 50. 51. 52. 53. 54. Takaichi, S., K. Inoue, M. Akaike, M. Kobayashi, H. Ohoka, and M. T. Madigan. 1997. The major carotenoid in all known species of heliobacteria is the C30 carotenoid 4,4'-diaponeurosporene, not neurosporene. Arch. Microbiol. 168:277-281. Tarshis, L. C., M. J. Yan, C. D. Poulter, and J. C. Sacchettini. 1994. Crystal structure of recombinant farnesyl diphosphate synthase at 2.6-angstrom resolution. Biochemistry 33:10871-10877. Taylor, R. F. 1984. Bacterial triterpenoids. Microbiol. Rev. 48:181-198. Taylor, R. F., and B. H. Davies. 1974. Triterpenoid carotenoids of Streptococcus faecium UNH 564P. Biochem. J. 139:751-760. Wang, C. W., and J. C. Liao. 2001. Alteration of product specificity of Rhodobacter sphaeroides phytoene desaturase by directed evolution. J. Biol. Chem. 276:41161-41164. Wieland, B., C. Feil, E. Gloriamaercker, G. Thumm, M. Lechner, J. M. Bravo, K. Poralla, and F. Gotz. 1994. Genetic and biochemical analyses of the biosynthesis of the yellow carotenoid 4,4'-diaponeurosporene of Staphylococcus aureus. J. Bacteriol. 176:7719-7726. Zhang, D. L., and C. D. Poulter. 1995. Biosynthesis of non-head-to-tail isoprenoids—Synthesis of 1'-1-structures and 1'-3-structures by recombinant yeast squalene synthase. J. Am. Chem. Soc. 117:1641-1642. Zhang, Y. W., X. Y. Li, and T. Koyama. 2000. Chain length determination of prenyltransferases: both heteromeric subunits of medium-chain (E)-prenyl diphosphate synthase are involved in the product chain length determination. Biochemistry 39:12717-12722. Zhao, H., J. C. Moore, A. Volkov, and F. H. Arnold. 1999. Methods for optimizing industrial enzymes by directed evolution, p. 597-604. In A. L. Demain and J. E. Davies (ed.). Methods of Industrial Microbiology and Biotechnology. 2nd ed, ASM Press, Washington DC.  131 CHAPTER 3 Taking Natural Products to New Lengths: Biosynthesis of Novel Carotenoid Families Based on Unnatural Carbon Scaffolds 132 SUMMARY In an extension of previous work in which biosynthetic routes to novel C45 and C50 carotenoid backbones were established in recombinant E. coli, we demonstrate the capacity of the C40 carotenoid desaturase CrtI from Erwinia uredovora to accept and desaturate these unnatural substrates. Desaturation step number in the C45 and C50 pathways was not very specific, resulting in the production of at least 10 more C45 and C50 carotenoids. These compounds have never before been identified in nature or chemically synthesized. We also present evidence of the biosynthesis of a novel asymmetric C40 backbone formed by condensation of farnesyl diphosphate (C15PP) with farnesylgeranyl diphosphate (C25PP), and the subsequent desaturation of this backbone by CrtI in an unusual manner. Under some conditions, we found that C40, C45, and C50 carotenoid backbones synthesized in E. coli were oxidized by unknown chemical or enzymatic means, giving monohydroxylated backbone derivatives. Some of these hydroxylated species served as substrates for CrtI in vitro, leading to the production of still more novel carotenoids. The ability to supply CrtI with unnaturally large substrates in vivo has allowed us to show that this enzyme regulates its desaturation step number by sensing the end groups of its substrate, unlike certain fungal carotenoid desaturases whose step number is apparently determined by their particular multimeric state. Analysis of the different molecular mechanisms by which chemical diversity is generated and then propagated through our nascent pathways provides insight into how this occurs in nature and the selective pressures that have shaped the evolution of natural product biosynthetic enzymes and pathways. 133 INTRODUCTION Nature’s wealth of small molecules has proven extremely useful to humankind as a source of medicines, fragrances, pigments, toxins, and other functional compounds. Many of these natural products have captivated scientists for decades with their highly complex structures and the elaborate biosynthetic routes by which they are generated. As products of evolution, the ~170,000 natural products characterized thus far (10) are a collective demonstration of the power of this simple algorithm to generate immense chemical diversity. Inspired by the importance of natural products to health, culture, chemistry, and biology, we have been conducting our own evolution experiments with natural product biosynthetic pathways in the laboratory. By mimicking and accelerating some of the very same processes that drive natural evolution—mutation, gene transfer, and selection—we and others have shown that it is possible to evolve carotenoid biosynthetic pathways, a model system of choice, in new, unnatural directions in standard laboratory bacteria (3, 4, 31, 35, 42, 43, 45, 46, 48, 53, 54, 56). (See Chapter 1 for a detailed description of how biosynthetic pathways can be evolved in the laboratory.) Carotenoids are ancient natural pigments that play vital roles in key biological processes such as photosynthesis, quenching of free radicals, and vision (57). The ~700 carotenoids identified in nature branch from only two major pathways. Over 95% of natural carotenoids are biosynthesized from the symmetric C40 backbone phytoene, which is formed by condensation of two molecules of geranylgeranyl diphosphate (GGPP, C20PP) (Figure 3.1). The C40 pathway, in addition to being the most diverse carotenoid pathway, is also the most widespread in nature, appearing in thousands of species of 134 bacteria, archaea, algae, fungi, and plants. A separate C30 pathway that begins with the fusion of two molecules of farnesyl diphosphate (FPP, C15PP) (Figure 3.1) accounts for the remainder of natural carotenoid diversity. C30 carotenoids are known in only a small group of bacteria such as Staphylococcus, Streptococcus, Methylobacterium, and Heliobacterium species (52). (See Chapter 1 for a more thorough description of the key enzymatic steps in carotenoid biosynthesis.) Previously, our group reported the expansion of carotenoid biosynthesis with the generation of a novel C35 carotenoid pathway in recombinant E. coli (53, 56). This unusual pathway, which begins with the heterocondensation of C15PP and C20PP to form an unnatural, asymmetric C35 carotenoid backbone, was further diversified by coexpression of downstream carotenoid desaturases and cyclases, some of which were evolved in our laboratory for a particular function in the new pathway (see Chapter 1). This work led to the biosynthesis of at least ten new carotenoids never before identified in nature or chemically synthesized (53). Our laboratory also reported the biosynthesis of novel C45 and C50 carotenoid backbones in recombinant E. coli expressing the Y81A mutant of the farnesyl diphosphate (C15PP) synthase from Bacillus stearothermophilus, BstFPSY81A (37), and the F26A+W38A double mutant of the C30 carotenoid synthase CrtM from Staphylococcus aureus, CrtMF26A,W38A (54). The first enzyme, BstFPSY81A, synthesizes a mixture of C15PP, C20PP, and the very rare (see Discussion) farnesylgeranyl diphosphate (FGPP, C25PP). The next enzyme, CrtMF26A,W38A, has an expanded substrate and product range compared to wild-type CrtM, which can only synthesize C30 and C35 carotenoid backbones (53, 56). When BstFPSY81A and CrtMF26A,W38A were coexpressed in E. coli, a 135 mixture of C35, C40, C45, and C50 carotenoid backbones was produced (Figure 3.1, ref. (54)). The above work did not investigate whether these unnaturally large C45 and C50 carotenoid backbones could be metabolized by carotenoid desaturases, leading to the introduction of an extended conjugated system (chromophore) and the resulting emergence of pigmentation in the C45 and C50 pathways. In addition, the lack of an asymmetric C40 carotenoid backbone detected in extracts of E. coli cultures coexpressing BstFPSY81A and CrtMF26A,W38A warranted further examination. From homo- or heterocondensation of the three precursors C15PP, C20PP, and C25PP, six different carotenoid backbones are theoretically possible: C30, C35, symmetric C40 (phytoene, C20+C20), asymmetric C40 (C15+C25), C45, and C50 (see Figure 3.1). However, only one population of C40 backbones was isolated, and it was assumed to be all phytoene (54). Since C15PP, C20PP, and C25PP are all present in the cells, as indicated by the biosynthesis of C35, C45, and C50 carotenoid backbones (CrtMF26A,W38A has lost most of its C30 synthesis capability (54)), it was unclear if asymmetric C40 backbones were not discovered because they were not synthesized or because they could not be separated and distinguished from phytoene. In this work, we demonstrate the remarkable substrate promiscuity of the carotenoid desaturase CrtI from Erwinia uredovora by showing that it can desaturate C45 and C50 backbones, leading to an array of pigmented C45 and C50 carotenoids. We reveal that the production of specific desaturation products and the absence of others provides insight into the mechanism by which CrtI regulates its desaturation step number. We also present evidence that the asymmetric C40 carotenoid backbone is indeed synthesized by E. 136 coli expressing BstFPSY81A and variants of CrtM, and that this unnatural backbone is processed by CrtI in an unusual manner. Finally, we show that large carotenoid backbones are further diversified in an unexpected manner by in vivo hydroxylation under certain conditions, and that some of these hydroxylated backbones can serve as alternative substrates for CrtI. In addition to the potential technological uses of the new carotenoids we report herein, the biosynthetic routes by which they are synthesized provide a convenient laboratory model to study emergent metabolic pathways in nature. We show how analysis of the modes by which chemical diversity is propagated in the new carotenoid pathways can enhance our understanding of the mechanisms used by evolution to continually discover new small molecules. RESULTS CrtI desaturates unnatural C45, C50, and asymmetric C40 carotenoid backbones, resulting in the biosynthesis of numerous novel carotenoids E. coli XL1-Blue cells coexpressing BstFPSY81A, a CrtM variant (either the F26L single mutant CrtMF26L or the F26A+W38A double mutant CrtMF26A,W38A), and wild-type CrtI from E. uredovora synthesize at least ten novel desaturated carotenoids with C45 or C50 backbones. Structures 3, 4, 5, 6, 10, 11a, 11b, 12a, 12b/c, and 13, reported here for the first time, were identified by their high-performance liquid chromatography (HPLC) retention times, UV-visible spectra, and mass spectra (Table 3.1; Figures 3.2, 3.3, and 3.6). We also isolated an unusual 2-step desaturated C40 carotenoid that is likely based on 137 an asymmetric C40 backbone (structure 1, see below). Table 3.2 lists trivial and IUPACIUB semi-systematic names for the structures depicted in Figures 3.2-3.4. E. coli cultures harboring the plasmid pUCmodII-crtMF26L-crtI-bstFPSY81A, pUCmodII-crtMF26A,W38A-crtI-bstFPSY81A, or the plasmids pUC18m-bstFPSY81A and pACcrtMF26A,W38A-crtI together synthesized mixtures of all of these novel desaturated carotenoids in different proportions and titers, depending on the expression plasmid(s). With all of these expression systems, we observed almost 100% conversion of the C45 carotenoid backbone 16-isopentenylphytoene to desaturated C45 carotenoids, while only about 25% of the C50 backbone 16,16'-diisopentenylphytoene was converted to desaturated products (Table 3.1). Whereas E. uredovora CrtI primarily catalyzes four desaturation steps on phytoene (24, 33, 56), acts predominantly as a 4-step desaturase in a C30 pathway (56), and performs 4-5 desaturation steps on C35 carotenoids (53), the step number of CrtI is less well defined on C45 and C50 substrates. In the C45 pathway, 2-, 3-, 5-, and 6-step products were isolated from E. coli cultures harboring the plasmids listed above; in the same cultures, 2-, 3-, 4-, and 6-step C50 products were found. In both pathways, there was no clear majority product (Table 3.1). We refer to this imprecise desaturase behavior as “stuttering.” Figures 3.2 and 3.3 depict the desaturation isomers of these C45 and C50 products whose biosynthesis is supported by the HPLC and MS data (see below). In general, the UV-visible absorption spectra of the desaturated C45 and C50 carotenoids are hypsochromically shifted compared to those of C40 carotenoids with the same number of conjugated double bonds (Figure 3.6: 3 and 10 vs. ζ-carotene, 4 and 11a vs. neurosporene, 12a vs. lycopene; see Figure 2.1 for C40 structures). The spectra shown 138 in Figure 3.6 are the most bathochromic of those measured before and after iodinecatalyzed photoisomerization, and most of these spectra exhibit cis-peaks (9) that are less or only slightly more intense than the corresponding C40 standard (e.g., 11a vs. neurosporene, 10 vs. ζ-carotene). We therefore hypothesize that the hypsochromic shifts in the spectra of 3, 4, 10, 11a, and 12a are not caused by a high proportion of Z- (cis) isomers, but rather by unfavorable interactions between these highly non-polar carotenoids and the much more polar, mostly-acetonitrile solvent. Of special interest are C50 carotenoids 11b and 12b/c. Compared with 11a, the former has a spectrum that is hypsochromically shifted by 11 nm at the wavelength of maximum absorption, λmax (Figure 3.6), elutes slightly earlier in reverse-phase HPLC, is only one-tenth as abundant, and has an identical molecular ion at m/z = 674.2 (Table 3.1). We believe that these properties are best explained by an unusual desaturation pattern in 11b in which all three desaturation steps are on one side of the molecule (Figure 3.3) (we denote this as “3+0” desaturation). We are not aware of other carotenoids with a 3+0 desaturation pattern whose spectra we can compare with that of 11b. However, 7,8,11,12tetrahydrolycopene, an isomer of ζ-carotene with a 2+0 desaturation pattern instead of the 1+1 pattern of ζ-carotene (see Figure 3.4), has an absorption spectrum that is hypsochromically shifted by ~5 nm compared with that of ζ-carotene (9, 14, 15, 51). Product 12b/c has a spectrum that is hypsochromically shifted by 4 nm at λmax compared with that for 12a (Figure 3.6), and it elutes slightly before 12a in HPLC (Table 3.1). This species is only slightly less abundant than 12a and has the same molecular ion at m/z = 672.3 (Table 3.1). These properties suggest that 12b/c is a 4-step desaturated C50 carotenoid with a 3+1 desaturation pattern (12b in Figure 3.3). However, we cannot rule 139 out the possibility that 12b/c has a 4+0 desaturation pattern (12c) or is a mixture of 12b and 12c, which is why we have designated its spectrum in Figure 3.6 as “12b/c.” Carotenoid 5 has the mass of a 5-step desaturated C45 carotenoid, and its absorption spectrum corresponds closely with that of 3,4-didehydrolycopene, which has a 3+2 desaturation pattern (9, 25). There are two possible C45 carotenoids with this desaturation pattern (Figure 3.2), and we could not distinguish by HPLC and MS analysis whether carotenoid 5 has specific structure 5a or 5b, or represents a mixture of the two. Similarly, it is not possible to confirm whether carotenoid 4 has precise structure 4a or 4b without synthetic standards or the use of advanced nuclear magnetic resonance techniques requiring up to tens of milligrams of sample (18, 32). Spectra 6 and 13 are similar to the spectrum of 3,4,3',4'-tetradehydrolycopene with 6 desaturation steps in a 3+3 pattern (9). Spectrum 6 is slightly hypsochromically shifted compared to spectrum 13; this effect is likely due to a significant proportion of Zisomers in our sample of carotenoid 6, evidenced by the greater relative absorbance of its cis peaks at 396 and 415 nm. Having no reason to believe that either 6 or 13 has an unusual desaturation pattern, we have depicted these structures in Figures 3.2 and 3.3, respectively, with symmetrical 3+3 desaturation. Notably absent in all the extracts we analyzed of cultures expressing BstFPSY81A, CrtMF26L or CrtMF26A,W38A, and CrtI were 4-step desaturated C45 and 5-step desaturated C50 carotenoids. We believe these observations, which may initially seem merely curious, can help to clarify the means by which this desaturase regulates its step number (see Discussion). 140 Carotenoid 1 was initially surprising to find in the above extracts. This molecule and ζ-carotene have the same molecular ion at m/z = 540.2 (Table 3.1), but compared with ζ-carotene, carotenoid 1 has a slightly longer HPLC retention time (~19 vs. ~18 min) and a UV-visible spectrum that is hypsochromically shifted by 5 nm at λmax (Figure 3.6). Because both molecules are C40 carotenoids with equal masses and virtually identical polarities, this wavelength shift cannot be due to a change in solvent–analyte interaction. Rather, we believe the shift is due to a 2+0 desaturation pattern, and that carotenoid 1 is based on an asymmetric C40 (C15+C25) backbone as shown in Figure 3.4 (see Discussion). E. coli expressing only BstFPSY81A and a variant of CrtM accumulate hydroxylated carotenoid backbones When E. coli XL1-Blue cells were transformed with the desaturase-free plasmids pUCmodII-crtMF26L-bstFPSY81A or pUCmodII-crtMF26A,W38A-bstFPSY81A and grown in liquid culture, they accumulated novel monohydroxylated C45 and C50 carotenoid backbones 7 and 14 as well as monohydroxylated C40 backbones, which may be novel depending on the location of the OH-group and whether the C40 backbone is symmetric or asymmetric (Figures 3.5, 3.7 and 3.8). The biosynthesis of these hydroxylated carotenoids was confirmed by MS and chemical derivatization (Figure 3.9), and their proportions relative to each other and the unmodified backbones were quite reproducible (Figure 3.8). On the other hand, similar XL1-Blue cultures harboring the plasmids pUC18m-bstFPSY81A and pAC-crtMF26A,W38A did not produce hydroxylated backbones. Some possible reasons for this disparity are presented in the Discussion. 141 Although we could not identify the specific locations of the hydroxy groups by HPLC and MS analysis, we can exclude several possible regioisomers. The in vitro acetylation reactions with acetic anhydride described in Materials and Methods were positive for all the hydroxylated C40, C45, and C50 backbones, with conversions above 90% in all cases. This indicates that the hydroxy groups are primary or secondary (19). Also, the propensity of the hydroxylated and acetylated carotenoids to lose water or acetate, respectively, in atmospheric pressure chemical ionization mass spectrometry (APCI-MS) (Figure 3.9) is evidence that the substituents are located in an allylic position (2). Finally, that some of these hydroxylated backbones are desaturated by CrtI in vitro (see below) suggests the OH group is located far from the center of the molecule. A hydroxy group located close to the center of a carotenoid backbone, which is where desaturases initiate their catalytic action, might interfere with the ability of a desaturase to process such a substrate. Only one C40 backbone fraction was seen in HPLC; likewise, hydroxylated C40 backbones eluted as a single peak (Figure 3.7). Attempts to further separate these fractions using a linear gradient of acetonitrile:isopropanol (98:2 to 93:7 over 30 min.) also failed. However, because of the strong evidence that carotenoid 1 is based on the asymmetric C40 carotenoid backbone 16-isopentenyl-4'-apophytoene, we nevertheless believe that the C40 backbone fraction is a mixture of phytoene and 16-isopentenyl-4'apophytoene, and that the C40-OH fraction may also be a mixture of hydroxylated versions of these backbones. Indeed, the subtle structural differences between symmetric and asymmetric backbones of the same length should have minimal effects on 142 chromatographic retention. Therefore, co-elution under our separation conditions would not be unexpected. Cultures of E. coli strain HB101 carrying either plasmid pUCmodII-crtMF26LbstFPSY81A or pUCmodII-crtMF26A,W38A-bstFPSY81A also synthesized hydroxylated C40, C45, and C50 carotenoids, but in different relative proportions compared with the XL1-Blue cultures (data not shown). Surprisingly, significant proportions of acetylated C40 and C45 carotenoid backbones (~10 and ~19 mol% of total carotenoids, respectively) were detected in cultures of HB101(pUC18m-bstFPSY81A + pAC-crtMF26A,W38A) in addition to smaller amounts of hydroxylated C40 and C45 carotenoid backbones (~2 and ~4 mol%, respectively). The in vivo-acetylated carotenoids behaved identically in HPLC and APCIMS to their counterparts produced by in vitro derivatization of hydroxylated carotenoids with acetic anhydride. These acetylated backbones are probably formed by the reaction of hydroxylated carotenoids with acetyl-CoA, a process that is somehow promoted in HB101 cells carrying these plasmids. In vitro desaturation experiments with CrtI In an effort to learn more about the substrate specificity of E. uredovora CrtI and to potentially access new desaturated carotenoids, we carried out in vitro desaturation reactions in which an invariant amount of E. coli lysate containing CrtI was incubated with an individual carotenoid backbone (see Materials and Methods). These experiments, in which substrates dissolved in a small amount of acetone were added to cell lysate, yielded markedly different results compared with carotenoid desaturation in living cells, where carotenoid backbones already present in intact cell membranes are converted by membrane-bound desaturases. E. uredovora CrtI converts all the available phytoene to 143 lycopene (and even tetradehydrolycopene) in vivo, leaving no intermediates (33, 56). In vitro, on the other hand, the enzyme converted an average of 19% of the phytoene to a mixture of mainly lycopene and intermediate products (Table 3.3). A similarly reduced in vitro efficiency on both native and non-native substrates was also seen for purified CrtI from Rhodobacter capsulatus and CrtN from S. aureus (39, 40), and appears to be a general feature of in vitro compared with in vivo carotenoid desaturation. This reduced efficiency is probably a consequence of suboptimal reaction conditions and substrate delivery in vitro. In vivo, carotenoids are sequestered together with desaturases in cell membranes, increasing the effective concentration of both enzyme and substrate. In vitro, proper association of carotenoid backbones and desaturases may be hampered. Additionally, inactivated desaturases are replenished with newly synthesized copies in vivo but not in vitro. Of the intermediates detected and quantified by HPLC, 1-step phytofluene and 2step ζ-carotene were each present at approximately twice the level of 3-step neurosporene (Table 3.3, structures of these carotenoids are shown in Figure 3.4). This result qualitatively agrees with that of Fraser et al., who detected phytofluene and ζcarotene but not neurosporene in the product mixture when they supplied purified E. uredovora CrtI with phytoene in vitro (24). If we take the in vitro conversion statistics as a measure of the degree of compatibility between a substrate and CrtI, then comparing the fractional conversion of other backbones to the benchmark of ~19% conversion of phytoene can allow us to assess the substrate range of the enzyme, at least with respect to this relevant parameter. In this context, the C30 diapophytoene is a much less favored substrate for CrtI, while the 144 C45 backbone ranks between phytoene and diapophytoene in acceptability (Table 3.3). The C50 backbone diisopentenylphytoene was not converted at all in vitro, reaffirming our in vivo results showing that a substantial proportion of this backbone synthesized in E. coli cells remained unmetabolized by CrtI. These results also further highlight the reduced efficiency that carotenoid desaturases display in vitro. In addition to its much lower conversion in vitro (~5% vs. ~100% in vivo), the C45 backbone also underwent fewer desaturation steps in vitro, with the terminal in vitro product being the 2-step carotenoid 3. The predominant C45 desaturation product in vitro was the 1-step carotenoid 2, which was not detected at all in vivo. Therefore, the reduced step number displayed by CrtI in vitro on the C45 backbone allowed access to a novel carotenoid that did not accumulate in cultured cells. CrtI also desaturated hydroxylated C40 and C45 backbones, resulting in the production of (at least) two more new carotenoids, 8 and 9. (The desaturated monohydroxy C40 carotenoids OH-phytofluene, OH-ζ-carotene, OH-neurosporene, and OH-lycopene (see Figure 3.5) may also be novel, depending on the location of the hydroxy group.) Although the fungal carotenoid desaturase Al-1 from Neurospora crassa was reported to desaturate 1-OH-neurosporene and 1-OH-lycopene (25) and the 3-step desaturase from R. capsulatus was shown to efficiently accept 1,2-epoxyphytoene as a substrate (39), this is to our knowledge the first report of the desaturation of oxygenated carotenoids by a bacterial desaturase. Because the precise position of the hydroxy group in the C45-OH substrate 7 is unknown, we do not know the exact structures of products 8 and 9. Accordingly, we have represented these carotenoids only by name in Figure 3.5. Interestingly, the average fractional conversion of the hydroxylated C45 backbone was 145 almost three times that of the unmodified C45 backbone, implying that the hydroxy group promotes desaturation in vitro. We are uncertain of the reason for this, but hypothesize that the increased polarity brought about by hydroxylation may enhance the ability of the substrate to be solubilized and therefore mix with the enzyme in the reaction medium. The hydroxy group on the C50-OH substrate 14, however, did not appear to assist desaturation by CrtI in vitro. Neither it nor its unmodified counterpart was desaturated in these experiments. As with the C45 backbone, the C45-OH backbone 7 was desaturated two steps in vitro, with a greater proportion of 2-step products accumulating in the latter reactions. The hydroxy group clearly does not interfere with the desaturation sequence of CrtI, at least up to the first two steps. We interpret this as evidence that the OH group is located distal to the center of the molecule. Hydroxylated C40 carotenoid backbones were also converted at a relatively high level (Table 3.3). It is not certain whether this substrate pool was a mixture of hydroxylated phytoene and hydroxylated 16-isopentenyl-4'-apophytoene, and if so, the proportion of each. However, judging by the relatively similar percentages of 1- to 4-step products in the phytoene and C40-OH desaturation experiments, we surmise that most of the C40-OH pool was hydroxylated phytoene. Therefore, we did not depict any hydroxylated asymmetric C40 pathway products in Figure 3.5. We are not sure of the reason(s) for the increased proportion of 3-step products in the reactions with C40-OH backbones compared to phytoene. This may be somehow due to the hydroxy group on the substrate, but many other explanations are plausible. HPLC analysis of the 2-step desaturation products from the C40-OH reactions did not yield convincing evidence of a hydroxylated derivative of carotenoid 1. This can be taken as additional evidence that 146 hydroxylated phytoene dominated the C40-OH backbone population. As with the C45-OH backbone, the hydroxy group on the C40-OH substrate does not inhibit the desaturation sequence of CrtI, as evidenced by the high proportion of 4-step desaturation products. We believe this result points to a terminal or near-terminal position of the OH group in the hydroxylated C40 backbones. Carotenoid biosynthesis in cultures expressing the C25PP synthase from Aeropyrum pernix In an attempt to increase the proportion of C50 carotenoids synthesized by our recombinant E. coli, we substituted BstFPSY81A with the C25PP synthase from the thermophilic archaeon Aeropyrum pernix, ApFGS. Farnesylgeranyl diphosphate (FGPP, C25PP) is a very rare molecule in nature, and apFGS is the only natural C25PP synthase gene sequenced to date (50). We cloned apFGS from A. pernix genomic DNA and coexpressed it with crtMF26A,W38A on one plasmid as well as on separate plasmids. ApFGS turned out to be disappointing as a C25PP synthase and mainly behaved as a C20PP synthase in our cells, as shown in Figure 3.10. When CrtMF26A,W38A is expressed alone in E. coli XL1-Blue(pUC18m-crtMF26A,W38A), only C30 and C35 carotenoids are synthesized (Figure 3.10, first data set). Expression of wild-type CrtM alone in E. coli results in almost exclusive production of C30 diapophytoene (54), but CrtMF26A,W38A is a much poorer C30 synthase and apparently a very effective scavenger of C20PP. Therefore, even though the endogenous level of C20PP is very low in E. coli and cannot support C40 phytoene synthesis by the native C40 synthase CrtB (see Chapter 2) or by CrtMF26A,W38A (Figure 3.10, first data set), the latter enzyme condenses abundant C15PP with much less abundant C20PP to such an extent that C30 backbones outnumber C35 backbones by only a 147 factor of 2 in XL1-Blue(pUC18m-crtMF26A,W38A). When ApFGS was coexpressed with CrtMF26A,W38A together on plasmid pUC18m-apFGS-crtMF26A,W38A, approximately equal proportions of C35 and C40 carotenoid backbones were synthesized (Figure 3.10, second data set). This indicates that ApFGS primarily synthesizes C20PP and also that a substantial amount of C15PP remains available for carotenoid biosynthesis in XL1Blue(pUC18m-apFGS-crtMF26A,W38A) cells. When the same two genes were expressed on separate plasmids, XL1-Blue cultures harboring pUC18m-apFGS and pAC-crtMF26A,W38A synthesized the C40 backbone phytoene almost exclusively, with traces of C45 and C50 backbones also being detected (Figure 3.10, fourth data set). This difference is most likely due to the differential copy number of the two plasmids. Being on a high-copy pUC-based plasmid, apFGS should be more highly expressed than crtMF26A,W38A, which is on a medium-copy pAC-based plasmid (both genes are under the control of identical lac promoter and operator sequences). The higher relative ApFGS level should therefore allow this enzyme to more completely consume the available C15PP before it can be incorporated into carotenoids by CrtMF26A,W38A. However, even when given this opportunity, ApFGS still releases primarily C20PP and only small amounts of C25PP. ApFGS was shown to prefer C20PP as a substrate for synthesizing C25PP (50). Therefore, to see if increasing the supply of C20PP in the cells would result in a higher proportion of C45 or C50 carotenoids, we co-transformed XL1-Blue cells with pUC18mapFGS-crtMF26A,W38A and pAC-crtE containing the C20PP synthase gene from E. uredovora. This resulted in a ~3-fold increase in total carotenoids, and some C45 backbones were detected, but phytoene represented the vast majority of the carotenoid 148 backbone pool in these cells (Figure 3.10, third data set). Evidently, ApFGS could not effectively compete with CrtMF26A,W38A for the additional C20PP supplied by CrtE. A. pernix is a thermophilic organism, and ApFGS probably has an optimum temperature much higher than that at which E. coli cultures can be grown. However, cultivating ApFGS-expressing cultures at 37 °C instead of the usual 28 °C at which we grow our carotenogenic E. coli cultures did not increase the proportion of C45 or C50 carotenoids (data not shown). When CrtMF26A,W38A was coexpressed with ApFGS at 37 °C, almost no carotenoid backbones were synthesized. This may be due to compromised stability of this CrtM double mutant. The distribution of carotenoids synthesized by cells expressing BstFPSY81A is strongly influenced by Idi overexpression and physiological state It is known that the biosynthesis of isoprenoids in E. coli is limited by the supply of the C5PP “starter unit” dimethylallyl diphosphate (DMAPP, structure shown in Figure 1.4), and that overexpression of isopentenyl diphosphate isomerase (Idi) can increase carotenoid titers by approximately an order of magnitude (59). In an effort to increase our carotenoid titers, we transformed XL1-Blue cells with plasmids pUC18m-bstFPSY81A-idi (containing the idi gene from E. coli) and pAC-crtMF26A,W38A. After culturing these cells in TB medium, we found that Idi overexpression resulted in a ~10-fold increase in the quantity of carotenoids synthesized by the cells, but also dramatically shifted the distribution of carotenoid backbones toward production of phytoene (cf. first and second data sets in Figure 3.11). This result is likely due to alteration of the relative levels of isoprenyl diphosphate precursors of different lengths brought about by Idi overexpression (see Discussion). 149 In the course of our experiments involving coexpression of bstFPSY81A, crtMF26L or crtMF26A,W38A, and crtI, we noticed that colonies expressing these genes from one or two plasmids reproducibly displayed a dramatically deeper red color than cell pellets from liquid cultures harboring the same plasmid(s). To investigate this further, we collected a sufficient quantity of the colonies (~0.5 g wet cells) to permit carotenoid extraction and HPLC analysis, and compared the carotenoid content of the colonies with that of the cell pellets. We discovered that the colonies primarily synthesized C40 carotenoids and barely made any C45 and C50 products, while the liquid cultures inoculated by the very same colonies made substantial amounts of the larger carotenoids. This effect was also observed with no desaturase present (cf. first and third data sets in Figure 3.11) and occurred whether colonies were grown on LB- or TB-agar plates. Therefore, the dissimilar carotenoid distributions do not result from “defective” colonies, but rather, from differences in the physiology of E. coli colonies and liquid cultures. The strikingly similar shift toward an increased proportion of C40 carotenoids at the expense of larger products caused by Idi overexpression and by cell growth in colonies is examined in more detail in the Discussion. Attempted creation of a C60 carotenoid biosynthetic pathway To ascertain whether our best C50 carotenoid-producing CrtM variants or the C40 synthase CrtB could also synthesize C60 carotenoid backbones, we coexpressed the hexaprenyl diphosphate (C30PP) synthase HexPS from Micrococcus luteus (47) with CrtMF26L, CrtMF26A,W38A, or CrtB on plasmids pUC18m-hexPS-crtMF26L, pUC18mhexPS-crtMF26A,W38A, and pUC18m-hexPS-crtB, respectively. However, we did not detect any carotenoids at all in cultures of XL1-Blue transformed with these plasmids. This 150 result indicates that HexPS is an active enzyme that consumes C15PP, since expression of crtMF26A,W38A alone on a pUC18m-based plasmid yields C30 and C35 carotenoids (Figure 3.10), and also that these synthases cannot synthesize C60 carotenoids. Additional evidence also demonstrates that HexPS efficiently consumes C15PP and specifically synthesizes C30PP. XL1-Blue colonies harboring pUC18m-crtM-crtN are bright yellow due to the synthesis of large amounts of desaturated C30 carotenoids (Figure 3.12a, panel 1). However, colonies transformed with pUC18m-hexPS-crtM-crtN are colorless, indicating considerable consumption of C15PP by HexPS (Figure 3.12a, panel 2). Coexpression of the C40 carotenoid genes CrtB and CrtI further demonstrates that HexPS does not release C20PP. Whereas colonies harboring pUC18m-crtE-crtB-crtI are red-pink due to production of desaturated C40 carotenoids beginning with the synthesis of C20PP by CrtE (Figure 3.12a, panel 3), colonies transformed with plasmid pUC18m-hexPScrtB-crtI are colorless because hexPS does not supply CrtB with C20PP (Figure 3.12a, panel 4). Finally, in vitro experiments performed by Adam Hartwick show that when supplied with C15PP and isopentenyl diphosphate (IPP, structures shown in Figures 3.13.5), CrtE synthesizes the expected C20PP product (Figure 3.12b, lane 1), BstFPSY81A synthesizes the expected C25PP product (Figure 3.12b, lane 2), and HexPS specifically synthesizes an even larger product (Figure 3.12b, lane 3). Similar experiments performed by Shimizu et al. confirmed with authentic standards that M. luteus HexPS indeed synthesizes primarily C30PP from C15PP and IPP (47). No known carotenoid synthase, including our CrtM mutants, can convert C30PP to a C60 carotenoid backbone. It may be possible to evolve one of these mutants or another carotenoid synthase in the laboratory for C60 carotenoid synthesis. However, our results 151 showing poor conversion of the C50 backbone to desaturated carotenoids by CrtI (Tables 3.1 and 3.3) and no conversion by the C30 desaturase CrtN (data not shown) indicate that, should a biosynthetic route to C60 backbones be established, desaturation of this substrate would be even less efficient by these enzymes. Therefore, no simple colorimetric assay exists for the screening of synthase variants in a directed evolution experiment aimed at evolving a C60 carotenoid synthase. DISCUSSION Determination of desaturation step number by Erwinia CrtI Elegant genetic complementation experiments with heterokaryons of the fungus Phycomyces blakesleeanus have provided convincing evidence for the existence of multienzyme complexes that function as assembly lines for carotenoid biosynthesis in that organism (5, 12, 16, 36). In these complexes, carotenoid substrates undergo stepwise chemical transformations as they are processed by one enzyme and then passed on to the next one in the complex, hence the analogy to an industrial assembly line. Therefore, phytoene undergoes four desaturation steps in Phycomyces because four desaturase subunits are present in that organism’s carotenoid biosynthetic enzyme complexes (5). Carotenogenic enzyme complexes are believed to be widespread in other organisms as well, although there are many uncertainties regarding the factors that determine the extent of carotenoid desaturation (7). Our results on the in vivo desaturation of the C45 backbone isopentenylphytoene by E. uredovora CrtI provide evidence against the idea that the number of subunits in a complex determines the desaturation step number. As mentioned, E. uredovora CrtI is 152 primarily a 4-step desaturase in the symmetric C40 pathway, converting phytoene to lycopene as the majority product (24, 33, 56). If the primary determinant of this 4-step product specificity were the association of CrtI subunits as tetramers, we should also expect primarily 4-step products with other carotenoid backbones as well, assuming these substrates are accepted and processed by the complex. However, not only is this not the case in the C45 pathway, but 4-step C45 products do not accumulate at all, even though 5and 6-step C45 carotenoids are detected (Table 3.1, Figure 3.2). Therefore, 4-step C45 carotenoids are “skipped over” by CrtI in vivo, indicating a preference for synthesizing the higher step-number C45 products 5 (5 steps, majority product) and 6 (6 steps, secondmost abundant). We believe this observation is related to two others. First, in the C50 pathway, we observed no accumulation of 5-step products in vivo (Table 3.1, Figure 3.3), even though 6-step C50 products were formed. Second, in vitro desaturation experiments with E. uredovora CrtI on phytoene have shown that the 3-step neurosporene is the least abundant intermediate, accumulating at low levels (Table 3.3) or not at all (24). (In vivo, the enzyme leaves behind no intermediates and even catalyzes six desaturation steps on phytoene (33, 56).) These seemingly disparate phenomena are all connected by a common trait shared by neurosporene and the likeliest possible 4-step C45 and 5-step C50 products: all have one ψ-end and one dihydro-ψ-end. This structural feature (see Figure 1.8) shared by all three disfavored products implies that E. uredovora CrtI has a strong propensity to avoid terminating its desaturation sequence at products with this combination of ends, regardless of the size of the carotenoid backbone substrate or the number of steps 153 required. Therefore, CrtI appears to regulate desaturation step number by sensing its substrate’s end groups, with particular preference for carotenoids with one ψ- and one dihydro-ψ-end, which are desaturated with high efficiency. The enzyme may accomplish this by having a higher affinity for substrates with these ends, but other strategies are possible. Whatever the specific mechanism, our results on C45 and C50 backbones clarify that the step number of this enzyme is significantly influenced by the size and end groups of its substrate. Thus, nature has apparently solved the problem of regulating carotenoid desaturation step number in at least two very different ways, as demonstrated by the distinct biochemical strategies employed by the phytoene desaturases of E. uredovora and P. blakesleeanus. These results also shed light on the functional plasticity displayed by bacterial carotenoid desaturases in directed evolution experiments aimed at altering desaturation step number (Chapter 1, refs. (46, 53, 58)). If a change in desaturation step number required a change in multimeric state, then converting a 4-step desaturase into a 6-step enzyme would require conversion of a tetrameric enzyme into a hexameric one. This would have to result from only a small number of mutations. While mutations can abolish the ability of a protein to form multimers, it seems much less plausible that the number of subunits in a complex could be so finely-tuned by minimal mutation. It is easier to envision how a desaturase’s catalytic rate or tendency to synthesize products with particular end groups could be modified by mutation. Therefore, the relative ease and high frequency with which desaturation mutants have been discovered by directed evolution of bacterial desaturases are more easily rationalized in the light of altered specificity rather than multimeric state. 154 Evidence of a novel asymmetric C40 carotenoid biosynthetic pathway We stated earlier that carotenoid 1 is likely the 2+0 desaturation product of an asymmetric C40 (C15+C25) carotenoid backbone, as shown in Figure 3.4. Although 1 has the same mass and chromophore size as ζ-carotene, it is unlikely that 1 is ζ-carotene with the hypsochromic shift in its spectrum resulting from Z-isomerization. The spectrum of 1 (Figure 3.6) shows the hallmarks of a majority all-E sample population: the cis peaks at 286 and 295 are low (~10% of λmax) and the ratio of the height of the longest-wavelength absorption band (419 nm) to the absorption at λmax (the so-called “III/II” ratio (9)) is 1.0. In fact, the spectrum shown for ζ-carotene in Figure 3.6 is that of a sample with more Zisomer content than 1. In that spectrum, III/II is only 0.83 (for all-trans ζ-carotene, III/II is between 1.0 and 1.028 (14, 15)). A 2+0 desaturation pattern also results in a hypsochromic shift of 5 nm, as shown by comparison of the spectrum of the 2+0 desaturation product of phytoene, 7,8,11,12tetrahydrolycopene with that of ζ-carotene, a 1+1 desaturated carotenoid (9, 14, 15, 51). However, although the absorption spectrum of 7,8,11,12-tetrahydrolycopene is strikingly similar to that of 1 (9, 14, 15, 51), it is also unlikely that carotenoid 1 is 7,8,11,12tetrahydrolycopene, because E. uredovora CrtI desaturates phytoene to lycopene via ζcarotene (Table 3.3, ref. (24)) and has not been shown to synthesize 7,8,11,12tetrahydrolycopene. Furthermore, a 2-step desaturation product of phytoene like ζcarotene or 7,8,11,12-tetrahydrolycopene is not expected to accumulate in a culture expressing E. uredovora CrtI. As mentioned previously, this enzyme desaturates all the available phytoene to lycopene and even 3,4,3',4'-tetradehydrolycopene in vivo, with no intermediates being detected. Indeed, in the same cultures in which 1 was found, 155 lycopene was also present and was usually at least twice as abundant; tetradehydrolycopene was also detected in smaller amounts (data not shown). Finally, the presence of a 2-step C40 carotenoid cannot be explained by a “phytoene overload” that overwhelms CrtI, for even in engineered E. coli that accumulate orders of magnitude more carotenoids than XL1-Blue, this desaturase is capable of efficiently converting the vastly increased phytoene supply to lycopene despite being expressed from a low-copy plasmid (20). The most reasonable conclusion from the above evidence is that carotenoid 1 has an asymmetric C40 (C15+C25) carbon backbone that has undergone two desaturation steps on its C15-side. Although we were unable to separate the asymmetric C40 backbone 16isopentenyl-4'-apophytoene from phytoene by HPLC of culture extracts of E. coli cultures expressing only BstFPSY81A and a mutant of CrtM (Figures 3.7 and 3.8), it is reasonable to expect that the former backbone is made by these cultures, whose additional synthesis of C35, C45, and C50 carotenoid backbones proves that both C15PP and C25PP are present in the cells. Furthermore, it is not surprising that CrtI would desaturate 16-isopentenyl-4'-apophytoene differently than phytoene. Although equal in size, the former is the most asymmetric of the six possible carotenoid backbones shown in Figure 3.1, and this likely affects the catalytic action of CrtI. When presented with the asymmetric C40 backbone, CrtI apparently catalyzes two desaturation steps on the C15side of the substrate (which is all that this side can accommodate) rather easily, but has trouble desaturating the C25-side of the molecule; therefore, product 1 accumulates. (This scenario seems more probable than 2 steps on the C25-side and none on the C15-side since CrtI can desaturate the C30 (C15+C15) backbone more efficiently than the C50 (C25+C25) 156 backbone (Table 3.3).) We are unsure why we did not detect any asymmetric C40 pathway products with longer chromophores than 1. Given that CrtI can desaturate C45 and C50 backbones, it is possible that some 4-6 step asymmetric C40 pathway products were made but were not distinguished from symmetric C40 carotenoids in our analysis, leaving only product 1 to stand out because of the lack of ζ-carotene produced. Because of this possibility, we could not quantify the relative proportions of symmetric and asymmetric C40 carotenoids made in the cultures. Potential utility of novel desaturated C45 and C50 carotenoids In this chapter, we report the biosynthesis of at least 14 new carotenoids based on unnatural carbon backbones. However, it remains to be seen whether any of these new products will prove technologically useful. Carotenoids are primarily sold for use as pigments, nutriceuticals, and as food and animal feed supplements (34). In some circumstances, a specific natural carotenoid is required, e.g., astaxanthin for salmon feed. However, in other current and envisioned applications such as antioxidant research and even microelectronics (11), “designer” molecules with specific properties not seen in natural carotenoids may prove extremely useful. The chromophore of a carotenoid is the primary determinant of its color and chemical properties (8, 61, 63). C45 and C50 carotenoid backbones can in principle accommodate chromophores of 17 and 19 conjugated carbon-carbon double bonds, respectively, which is longer than the 15 possible on a C40 backbone. Carotenoids with such large chromophores can absorb light at wavelengths above 600 nm, and their colors range from dark red to bluish purple (29, 35). Such carotenoids should be extremely reactive toward free radicals and could prove useful as potent antioxidants or colorants. 157 Although we did not generate carotenoids with more than 15 conjugated double bonds in this work, we have made progress toward this goal, and we believe that it will be possible to discover a desaturase in nature or to evolve one in the laboratory that can fully desaturate a C45 or C50 backbone. The insights we have gained about CrtI show that to evolve a 7- or 8-step desaturase will not require the discovery of extraordinarily rare mutants able to form heptamers or octamers, but merely variants with an altered preference for synthesizing carotenoids with fully desaturated end groups. Also, it may be possible to chemically desaturate 6-step C45 and C50 carotenoids even further (64), leading to carotenoids with chromophores of 17 or 19 conjugated double bonds. Desaturated C45 carotenoids 2, 3, 4, 5, and 6 (Figure 3.2) and desaturated C50 carotenoids 10, 11, 12, and 13 (Figure 3.3) reported in this work may be of interest for research purposes. Studies comparing the reactivity of these molecules toward free radicals in artificial lipid membranes could help researchers dissect the individual contributions of a carotenoid’s chromophore, polarity, and end groups in determining this reactivity. For example, it is expected that the novel C45 and C50 carotenoids produced in this work should orient themselves deep within the hydrophobic core of a lipid bilayer, and such orientation effects are believed to strongly influence the in vivo antioxidant properties of a carotenoid (63). Finally, it has been demonstrated that the presence of a single terminal hydroxy group in a carotenoid can dramatically improve its antioxidative properties (4). Therefore, the hydroxylation of carotenoid backbones we have observed in E. coli may be advantageous for the generation of monohydroxylated C45 and C50 carotenoids with desirable antioxidative abilities. Although we only observed hydroxylation of carotenoid 158 backbones in vivo, we showed that the hydroxylated C45 backbone could be desaturated in vitro, generating 1- and 2-step monohydroxy C45 structures 8 and 9. Our results showing increased desaturation step number in vivo compared with in vitro (cf. Tables 3.1 and 3.3) point to a promising strategy for generating hydroxylated C45 and C50 carotenoids with longer chromophores: co-transform cells harboring pUCmodII-crtMF26LbstFPSY81A or pUCmodII-crtMF26A,W38A-bstFPSY81A with another plasmid containing crtI under the control of a tightly-regulated promoter, and induce desaturase expression late in the culture. This approach would allow the cells to first accumulate monohydroxylated C45 and C50 backbones, which would then be desaturated in vivo upon desaturase expression. In nature, carotenoids are desaturated before they are hydroxylated. Therefore, it is interesting to note that this scheme could potentially produce highly desaturated monohydroxy C45 and C50 carotenoids with beneficial characteristics by an inverse biocatalytic route. Origins of in vivo-hydroxylated carotenoids We remain uncertain of the mechanism by which the carotenoid backbones are hydroxylated in vivo. Krubasik et al. observed some hydroxylation of the C50 flavuxanthin in recombinant E. coli cells (30) and C30 carotenoids synthesized in E. coli have also been reported to be hydroxylated by unknown processes (31, 40). Lee et al. postulated that their C30 diapocarotenoids were hydroxylated by free peroxy radicals present in E. coli membranes (31). Like us (56), they did not observe hydroxylation of C40 carotenoids in E. coli. Albrecht et al. reported a significant amount of epoxidation and hydroxylation of phytoene in cells of the green algae Scenedesmus acutus whose phytoene desaturase was inhibited by the herbicide norflurazon (2). Their report 159 suggested that the origins of the oxygenated phytoene derivatives might be enzymatic, but the oxidation was later attributed to reaction with free radicals (G. Sandmann, personal communication). As mentioned, XL1-Blue cultures harboring the plasmids pUC18m-bstFPSY81A and pAC-crtMF26A,W38A produced no hydroxylated backbones (Figure 3.8). These cultures also produced fewer total carotenoids than the single-plasmid cultures (see Figure 3.8 caption). This expression vector-dependency of carotenoid backbone hydroxylation suggests that E. coli cells selectively induce carotenoid oxidation only under certain conditions. Perhaps the lack of a lac operator in the pUCmodII-based plasmids and the resulting high-level constitutive expression of the carotenoid biosynthetic genes therein elicits this activation in E. coli. Plasmids pUC18m-bstFPSY81A and pAC-crtMF26A,W38A have their carotenogenic genes under the control of a lac promoter and operator, which should limit gene expression somewhat and possibly avoid the same response in the cells. Alternatively, the induction of carotenoid backbone hydroxylation might be triggered when the quantity of large carotenoid backbones in the cell membrane reaches a critical threshold. It is possible that, in response to excessive loss of membrane fluidity brought on by the accumulation of highly nonpolar C45 and C50 carotenoid backbones, the cells up-regulate an oxidase or radical-producing enzyme that helps to rectify this problem by effecting hydroxylation of the offending molecules, thereby increasing their polarity. Similarly, accumulation of these carotenoids may disrupt a portion of the respiratory electron transport chain only when their concentration reaches a certain value, causing electron leakage and the production of reactive oxygen species. These hypotheses, although attractive, are only weakly supported by the fact that the carotenoid titer of 160 XL1-Blue(pUCmodII-crtMF26L-bstFPSY81A) is a mere ~50% higher than that of XL1Blue(pUC18m-bstFPSY81A + pAC-crtMF26A,W38A) (see Figure 3.8 caption). Coexpressing CrtI along with BstFPSY81A and either CrtMF26L or CrtMF26A,W38A abolished almost all carotenoid backbone hydroxylation in the cells even though C50 backbones were quite abundant and accounted for ~50 mol% of total carotenoids. In these cultures, hydroxylated C50 backbones represented only ~1 mol% of the carotenoid pool. A possible reason for this is that free radicals preferentially react with and are quenched by desaturated carotenoids, whose extended chromophores are much more reactive toward radical species compared with undesaturated carotenoid backbones (17, 57, 61, 63). The above evidence points to radical oxygen species as the culprit in carotenoid backbone hydroxylation. However, the sharp, single HPLC peaks in Figure 3.7 suggest a high degree of regiospecificity of the hydroxylation reactions and therefore direct enzymatic oxidation. If multiple positions of these backbones were hydroxylated, as might be expected if the mechanism were chemical oxidation by reactive oxygen species, we should observe multiple clustered HPLC peaks, each corresponding to a different positional isomer of a hydroxylated backbone. (Different hydroxylated regioisomers should have much more distinct chromatographic properties than symmetric or asymmetric versions of a C40 backbone.) Indeed, an HPLC chromatogram showing multiple clustered peaks corresponding to different regioisomers of hydroxylated phytoene was generated by Albrecht et al. under chromatographic conditions similar to ours (2). On the other hand, the apparent regiospecific hydroxylation of our carotenoid backbones may result from their orientation in the cell membranes. For example, it is 161 possible that the backbones are positioned in such a manner that one end of the molecule protrudes from the membrane and consequently becomes prone to free-radical oxidation. Clearly, additional research will be required to uncover the origins of carotenoid backbone hydroxylation in E. coli. It would probably be simplest to first conduct in vitro investigations of the reactions of the various backbones with free radicals generated in situ in a manner similar to that described by Woodall et al. (61). If hydroxylated products from these reactions closely match those we have reported, this result would support the hypothesis that similar radical reactions are responsible for carotenoid hydroxylation in vivo. On the other hand, if the products are not a close match, and especially if multiple clustered peaks are observed under the same HPLC conditions, then the possibility of enzymatic hydroxylation might warrant further investigation. We anticipate, however, that the search for an enzyme responsible for these transformations would be a very challenging experiment. For one, screening of genomic libraries would be very difficult since this could not be done in E. coli, and selection of another host organism does not seem straightforward. However, the fact that carotenoid hydroxylation only occurs with certain strain and plasmid combinations suggests that microarray identification of differentially expressed genes might be fruitful. Properties of nascent biosynthetic pathways—lessons for biology and metabolic pathway engineering In addition to producing several novel carotenoids based on unnatural carbon scaffolds, this work has allowed us to investigate the precise biomolecular phenomena that resulted in the evolution of three novel biosynthetic pathways to carotenoid pigments. In this section, we analyze the specific mechanisms by which novel chemical diversity 162 was generated and propagated along these new pathways by their constituent enzymes. We then discuss key properties our pathways likely share with nascent biosynthetic pathways in general. The Y81A amino acid substitution in BstFPSY81A dramatically broadens the specificity of this enzyme, converting it from a strict C15PP synthase into an enzyme that synthesizes a mixture of C15PP, C20PP, and C25PP. This mutation has been studied in detail, and its effect on the enzyme’s product range has been shown to result from an enlarged product elongation pocket (37). The Y81A mutation transforms BstFPS into a “statistical” biocatalyst. Although capable of synthesizing products up to C25PP by catalyzing two additional condensations of IPP with the growing prenyl chain, BstFPSY81A also releases intermediates C15PP and C20PP; hence a distribution of prenyl diphosphate products with 3, 4, and 5 isoprene units is generated. The diversity of this product mixture is then amplified by the next enzyme in the pathway, a mutant of the S. aureus C30 carotenoid synthase CrtM. In Chapter 1, we discussed the molecular effects of mutations at F26 and W38 in CrtM. A homology model with human squalene synthase allowed us to map these residues to the site of the second half-reaction and led us to propose that their substitution with smaller amino acids increases the size of the cavity where cyclopropyl intermediates are rearranged into carotenoid backbones. From this analysis, we conjectured that wildtype CrtM could accept C20PP and even C25PP as substrates and form cyclopropyl intermediates from these precursors, but cannot rearrange intermediates larger than C35 into carotenoid backbones. When additional space is created in the rearrangement pocket by replacement of F26 and/or W38 with smaller amino acids, conversion of the larger 163 intermediates becomes possible, resulting in the synthesis of carotenoid backbones up to C50. Like BstFPSY81A, these CrtM mutants have lost much of their capacity to regulate the size of their products. When coexpressed with BstFPSY81A in vivo, the CrtM mutants condense every possible pairwise combination among C15PP, C20PP, and C25PP except, intriguingly, the wild-type’s combination of two molecules of C15PP (a consequence of the relatively low C15PP concentration combined with the intrinsically poor ability of the CrtM variants to make C30 carotenoids). The result is a mixture of C35, symmetric (C20+C20), and asymmetric (C15+C25) C40, C45, and C50 carotenoid backbone products. The desaturase CrtI then further diversifies the five carotenoid backbones generated by the two previous enzymes. CrtI possesses no mutations, but its inherent promiscuity allows it to accept all of the above backbones to some degree. In the C45 and C50 pathways, the step number of CrtI is not very well defined (except for the absence of certain products discussed above), and there was no clear majority desaturation product in these pathways in vivo (Table 3.1). Therefore, the stuttering action of CrtI on the C45 and C50 backbones is the primary catalytic basis for the branching of these new pathways. As previously discussed, CrtI very efficiently catalyzes four desaturation steps on its native substrate phytoene in vivo. Under less optimal in vitro conditions, however, substantial stuttering occurs with the same substrate, and all possible intermediates in the desaturation sequence are detected (Table 3.3). In the more favorable milieu of a cell membrane, however, CrtI can still be made to stutter when presented with unnaturally large carotenoid backbones. We do not know the exact reason for this, but expect it is due to a decreased catalytic efficiency on these substrates. CrtI also produces carotenoids with unusual desaturation patterns like 1, 11b, and 12b/c (Figures 3.3, 3.4, and 3.6; 164 Table 3.1), indicating that unnaturally large or asymmetric substrates can cause the enzyme to become slightly “confused” and carry out non-standard desaturation sequences. It is interesting that the unusual catalytic behavior that can result when an iterative enzyme is challenged with a new substrate can serve as a diversity-generating mechanism in the evolution of novel biosynthetic pathways. This work demonstrates the rapid product diversification that is possible when biosynthetic pathways are constructed from multiple broad-specificity enzymes arranged consecutively. Such arrangements were likely very common in the early evolution of metabolism. The widely accepted “patchwork” model states that the first metabolic pathways were assembled from promiscuous enzymes whose specificities were then narrowed by natural selection, yielding the relatively specific pathways we see in nature today, especially in so-called primary metabolism (27, 41, 62). Our laboratory-generated carotenoid biosynthetic pathways also probably share key features with recently evolved metabolic pathways in nature. Most notably, a lack of overall pathway specificity characterized by the generation of multiple products is a trait likely common to nascent pathways created both in nature and in the laboratory. Directed evolution experiments on a wide range of enzymes demonstrate that it is rare for enzymes to completely shift their substrate or product specificity after accumulating only a small number (1-2) of mutations. Rather, mutants with broadened specificity are the norm, even if the selection pressure of the experiment requires only one particular reaction to be catalyzed (1). In nature, enzymes that have recently evolved the ability to accept non-native substrates such as man-made antibiotics also tend to have broadened rather than shifted specificities, hence the emergence of so-called “extended-spectrum” beta-lactamases (13). Therefore, 165 new biosynthetic pathways (or pathway branches) that have emerged in nature as a result of enzyme mutation probably possess low product specificity, similar to our nascent carotenoid pathways, especially when multiple enzymes have been mutated. In many if not most cases, it remains to be seen how many more mutations would be required and how strong the selection pressures would have to be in order to convert newly emerged pathways into mature ones capable of specifically synthesizing a particular complex end product. Analysis of the means by which our novel carotenoid pathways have emerged also helps to clarify some aspects of a popular theory about the evolution of natural product biosynthetic pathways. The “screening hypothesis” put forth by Jones and Firn argues that natural product pathways have evolved under selection for particular traits, such as pathway branching and enzymatic promiscuity, because such traits promote the production and retention of product diversity at minimal cost (Chapter 1, refs. (21-23, 28)). However, our highly branched carotenoid pathways comprising laboratory-evolved promiscuous enzymes emerged despite a lack of selection for these properties. In no instance was selection for a diverse array of products applied in the laboratory evolution and subsequent site-directed mutagenesis experiments that resulted in the discovery of mutants BstFPSY81A, CrtMF26L, and CrtMF26A,W38A (37, 38, 54-56). Yet, in all these cases, as is typical in directed evolution (see previous paragraph), enzyme variants with broadened specificity were obtained. This implies that traits such as enzyme promiscuity and the types of pathway branching to which it can lead do not require selection to arise or be maintained, but merely represent the default state of enzymes and metabolic pathways in the absence of strong and sustained selective pressure to be highly specific. 166 Therefore, we believe that the low specificity of many natural product biosynthetic enzymes and pathways is not the outcome of positive selection for promiscuity, but is more aptly attributed to genetic drift caused by weak selection pressure for narrow specificity, or to selection pressures that change rapidly and hence do not allow sufficient evolutionary time for any particular narrow specificity to fully develop. Challenges for achieving new pathway specificity In the Results section, we described several unsuccessful experiments aimed at establishing more specific pathways in E. coli to particular novel-backboned carotenoids. For example, it should be possible to increase the proportion of C50 carotenoids by increasing the proportion of C25PP relative to C15PP and C20PP. If it were possible to drive the fraction of C25PP to nearly 100%, it would not be necessary to further evolve a carotenoid synthase for increased C50 product specificity because only one substrate would be available and therefore only the C50 carotenoid backbone would be possible. As mentioned earlier, C25PP is a very rare molecule in nature. Its only biological role found to date is as a precursor for the C25-C25 and C20-C25 ether-linked membrane lipids of some archaea such as Aeropyrum pernix and Natronomonas pharaonis (6, 49, 50). C25PP synthase enzymes are correspondingly very rare in nature, and only one such enzyme has been cloned to date: the farnesylgeranyl diphosphate synthase from Aeropyrum pernix, ApFGS (50). We cloned the apFGS gene from A. pernix genomic DNA, but found it inferior to BstFPSY81A for producing C25PP in E. coli cells. ApFGS actually behaved more like a C20PP synthase with peripheral C25PP synthase activity in our carotenogenic E. coli (Figure 3.10). 167 In their paper describing the first cloning of ApFGS, Tachibana et al. showed that the enzyme produces a mixture of C10PP to C25PP products, with C20PP being the most abundant, when supplied with the C5PP starter unit DMAPP and the C5PP extender unit IPP in vitro (50). (See Figure 1.4 for structures.) Only when supplied with C20PP did ApFGS exhibit specific C25PP synthase ability, but neither the rate nor the extent of the reaction was reported. The extensive production of C40 carotenoids in E. coli expressing ApFGS and CrtMF26A,W38A (Figure 3.10) appears to stem from the ability of the latter enzyme to incorporate C20PP into carotenoids faster than it can be readmitted to ApFGS for further prenyl chain elongation to C25PP. A similar effect likely occurs with BstFPSY81A. When supplied with C15PP and IPP in vitro, this enzyme synthesizes C25PP as the major product, with much smaller amounts of C20PP being detected (Figure 3.12 and ref. (37)). However, when BstFPSY81A is coexpressed with a CrtM variant in E. coli, significant amounts of C40 and C45 carotenoids are synthesized (Figure 3.8), indicating that C20PP is frequently released by BstFPSY81A in vivo. Production of C20PP by BstFPSY81A is more common in the elongation of the 5-carbon DMAPP (see below), a substrate also present in E. coli. Whereas in vitro, released C20PP is readily readmitted to BstFPSY81A and extended to C25PP (37), in the above cells, BstFPSY81A must compete with a CrtM variant for C20PP. Therefore, in E. coli cells also expressing CrtMF26L or CrtMF26A,W38A, much of the C20PP released by BstFPSY81A is instead used to synthesize C40 and C45 carotenoids. An important lesson from these observations is that the performance of an enzyme in vitro may not be representative of its performance as part of an in vivo biosynthetic pathway. 168 In the course of other work aimed at increasing the total quantity of carotenoids synthesized by our cultures, we overexpressed E. coli isopentenyl diphosphate isomerase (Idi) along with BstFPSY81A and a CrtM variant on plasmids (Figure 3.11). The isomerization of IPP to DMAPP is a rate-limiting step for the production of isoprenoids in E. coli (59). IPP is the basic isoprene unit synthesized by both the mevalonate and nonmevalonate pathways of isoprenoid biosynthesis in nature (7). However, IPP serves as an extender unit in prenyl chain elongation, and its isomer, DMAPP, which serves as the starter unit, is only synthesized by Idi-catalyzed isomerization of IPP (7). Overexpression of Idi increases carbon flux to DMAPP, which in turn increases flux through downstream isoprenoid biosynthetic pathways (59). When we transformed E. coli XL1-Blue cells with the plasmids pUC18mbstFPSY81A-idi and pAC-crtMF26A,W38A, the resulting liquid cultures did indeed synthesize about an order of magnitude more total carotenoids compared with XL1-Blue(pUC18mbstFPSY81A + pAC-crtMF26A,W38A) cultures (Figure 3.11 caption). However, the distribution of carotenoid backbones was also dramatically shifted toward the production of C40 carotenoids (Figure 3.11). This result can be rationalized by the “statistical” nature of BstFPSY81A and the increased level of DMAPP in cells overexpressing Idi. Fivecarbon DMAPP, the smallest isoprenyl diphosphate starter unit, is in addition to C15PP and C20PP, an acceptable substrate for BstFPSY81A (37). With the isoprenyl diphosphate pool of cells overexpressing Idi enriched in DMAPP, BstFPSY81A will admit this substrate more often. As a “statistical” iterative biocatalyst, BstFPSY81A tends to discharge shorter products on average when supplied with shorter substrates, and indeed, the enzyme frequently releases C20PP as it catalyzes prenyl chain elongation starting 169 from DMAPP (37). It follows that an increased level of DMAPP in the cells will result in increased production of C20PP by BstFPSY81A. Since the CrtM variants can condense a variety of prenyl diphosphates into different carotenoids, the larger proportion of C20PP in their substrate pool results in the observed shift toward the production of C40 carotenoids. This example illuminates the importance of the composition of the first enzyme’s substrate pool in determining the mixture of end-products of biosynthetic pathways composed of a succession of mutant enzymes with low substrate specificity. As stated previously, C50 carotenoids were only desaturated to a relatively small extent in vivo by CrtI, and unmetabolized C50 carotenoid backbones comprised approximately 50 mol% of the carotenoid pool in cultures of XL1-Blue(pUCmodIIcrtMF26A,W38A-crtI-bstFPSY81A). If we could evolve a desaturase to more efficiently convert C50 backbones, it might be possible to use colorimetric screening of bacterial colonies in order to further evolve either BstFPSY81A for more specific production of C25PP, or to evolve a CrtM variant for more specific synthesis of either C45 or C50 carotenoid backbones. Such a screen would require that a given desaturase variant could proficiently desaturate both C45 and C50 backbones, and also that the major desaturation product of each pathway be a different color. However, before we could attempt to evolve CrtI or another desaturase for improved performance on a C50 substrate, we encountered an unexpected roadblock. The first indication of this issue occurred when we noticed that E. coli colonies expressing BstFPSY81A, a CrtM variant, and CrtI from one or two plasmids reproducibly displayed a dramatically deeper red color than cell pellets from liquid cultures harboring the same plasmid(s). HPLC analysis revealed that the distribution of carotenoids in our recombinant E. coli colonies was shifted toward C40 170 products, with C50 and C45 carotenoids each representing less than 10% of total carotenoids (Figure 3.11). The similarity of this shift to that brought on by Idi overexpression in liquid cultures leads us to hypothesize that our E. coli cells grown in colonies on agar plates contain a higher proportion of DMAPP than cells harboring the same plasmids grown in liquid culture. As we have seen with Idi, such a difference in the relative proportions of C5-C25 prenyl diphosphates between the two physiological states would be sufficient to explain the different carotenoid distributions. However, we can only speculate on the origins of this putative difference in the isoprenyl diphosphate pools of cells cultivated in liquid medium versus those grown on agar plates. One of our early goals was to generate biosynthetic pathways to C60 carotenoids. When we formulated that objective, the C45 and C50 pathways had not yet been generated, and it was not known for certain which aspects of the C60 project would be the most problematic. Now, in retrospect, we have substantially more understanding of the experimental bottlenecks to expect. The first step of the pathway, generation of a C30PP precursor, has already been discovered by nature. Unlike C25PP, C30PP is found in bacteria, archaea, and eukaryotes, serving as a precursor to the side chain of quinones (26, 60). Isoprenyl diphosphate synthases that synthesize C30PP are therefore rather widespread in nature. The results of our work as well as that of Shimizu et al. with the C30PP synthase HexPS from M. luteus demonstrate that it is quite efficient and specific at converting C15PP to C30PP (Figure 3.12 and ref. (47)). Despite the ability of HexPS to supply C30PP in E. coli, enzymes capable of catalyzing C60 carotenoid backbone synthesis and desaturation remain undiscovered. We found that neither the C40 synthase CrtB nor CrtM mutants capable of C50 carotenoid 171 backbone synthesis could convert C30PP into a C60 backbone. Furthermore, screening for a carotenoid synthase variant capable of producing C60 backbones will likely not be a simple procedure. Our preferred screening method for evolving carotenoid biosynthetic enzymes, colorimetric screening of colonies, is probably not possible at present in a C60 pathway, since it cannot be assumed that any known carotenoid desaturase will impart pigmentation on a C60 backbone. We believe it is unlikely that any wild-type carotenoid desaturase would detectably desaturate a C60 substrate, since even processing of C50 backbones poses a great challenge to the broad-specificity desaturase CrtI. On the other hand, if a C60 carotenoid synthase were to be discovered first, screening for a desaturase variant capable of accepting C60 backbones should be relatively straightforward. Since C30PP is the only substrate available for carotenoid biosynthesis in E. coli expressing HexPS, C60 carotenoid backbones should be the only carotenoids possible in cells expressing HexPS and a C60 synthase. Therefore, screening E. coli colonies additionally transformed with a library of variant desaturases for the emergence of color should be a reliable method to search for desaturase variants capable of converting C60 backbones into pigmented C60 products. The production of hydroxylated carotenoid backbones we have reported in this work is an example of another type of hurdle to pathway specificity that can be encountered by metabolic pathway engineers. Although assembling and coexpressing a series of foreign biosynthetic genes in a heterologous host may look simple on paper, it is not possible to predict all the unwanted side reactions that might occur in the complex environment of a living cell. As we have shown, even E. coli, the most studied of all organisms, will carry out unexpected chemical modification of the products of foreign 172 biosynthetic genes it is forced to express. This is probably especially common when such products are harmful to the cell in some way and elicit poorly understood “emergency” responses. Therefore, given the current state of the art in the heterologous production of small molecules in microorganisms, the old adage, “expect the unexpected” is definitely sage advice. CONCLUSIONS The complexity and variety of small molecules in nature is a testament to the power of evolution to innovate and diversify. Our experiments on carotenoid biosynthetic enzymes and pathways represent an attempt to simultaneously harness and study these remarkable features of evolution. By capturing entire new pathways in the very earliest stages of their emergence, we have learned that new enzyme specificities are discovered rather easily upon mutation, and that new chemical diversity generated early in a pathway can be multiplied by downstream enzymes via many different chemical mechanisms. It is likely that our nascent pathways resemble their counterparts in nature in their rapid gain of access to a variety of new products upon very limited genetic change. However, the evolutionary “pruning” process by which the unwanted majority of a nascent pathway’s products are discarded in favor of a desired few remains unreproduced in the laboratory and, consequently, less well understood. Therefore, the generation of new pathways in the laboratory by directed evolution of biosynthetic enzymes, especially those located early in a pathway, remains primarily a tool for molecular discovery. It is hoped that future directed evolution experiments will shed light on how biosynthetic pathways shift their focus toward the synthesis of advantageous new products. If such research proves 173 fruitful, the exciting prospect of a commercial-scale whole-cell process for the specific production of a useful new molecule originally discovered in the laboratory by directed evolution may become a reality. MATERIALS AND METHODS Genes and plasmids Plasmid maps and sequences can be found in Appendix A. Genes are listed in transcriptional order in the names of all the plasmids in this report. Plasmids based on the high-copy pUCmodII vector (46, 54) are designated by names beginning with “pUCmodII.” The carotenoid biosynthetic genes on these plasmids are expressed as an operon under the control of a single lac promoter with no lac operator. In plasmids pUCmodII-crtMF26L-bstFPSY81A and pUCmodII-crtMF26A,W38A-bstFPSY81A, a variant of the C30 carotenoid synthase gene crtM from Staphylococcus aureus (crtMF26L or crtMF26A,W38A, respectively (54-56)) is flanked by XbaI and XhoI restriction sites. bstFPSY81A, which encodes the Y81A mutant of the farnesyl diphosphate synthase from Bacillus stearothermophilus (37, 54), is flanked by EcoRI and NcoI restriction sites and directly follows the crtM variant. Plasmids pUCmodII-crtMF26L-crtI-bstFPSY81A and pUCmodII-crtMF26A,W38A-crtI-bstFPSY81A additionally contain the gene encoding the carotenoid desaturase CrtI from Erwinia uredovora (current approved name: Pantoea ananatis), which is inserted between the crtM and bstFPS variants and is flanked by XhoI and EcoRI restriction sites. Plasmid pUCmodII-crtI, used to express E. uredovora CrtI alone for in vitro desaturation experiments, contains crtI flanked by EcoRI and NcoI restriction sites. 174 The genes on plasmids based on the high-copy vector pUC18m (56) are expressed as an operon under the control of a lac promoter and operator. Plasmid pUC18mbstFPSY81A contains the bstFPSY81A gene flanked by XbaI and XhoI restriction sites. Plasmid pUC18m-bstFPSY81A-idi additionally contains the idi gene encoding E. coli isopentenyl diphosphate isomerase, which is inserted between XhoI and ApaI restriction sites. Plasmid pUC18m-crtMF26A,W38A contains crtMF26A,W38A flanked by XbaI and XhoI sites. We cloned apFGS, the FGPP (C25PP) synthase gene from Aeropyrum pernix (50) from A. pernix genomic DNA (ATCC no. 700893D) by PCR. pUC18m-apFGS contains the apFGS gene flanked by NdeI and EcoRI sites. Plasmid pUC18m-apFGScrtMF26A,W38A additionally contains crtMF26A,W38A flanked by XbaI and XhoI sites. Plasmid pUC18m-hexPS contains the operon from Micrococcus luteus strain B-P 26 encoding the two polypeptide components of hexaprenyl diphosphate (C30PP) synthase (47). This operon, referred to as “hexPS,” is flanked by EcoRI and XbaI restriction sites. pUC18mhexPS-crtM-crtN additionally includes wild-type crtM flanked by XbaI and XhoI sites and crtN, the S. aureus C30 carotenoid desaturase gene, between XhoI and ApaI sites. In plasmid pUC18m-crtM-crtN, crtM and crtN are flanked by the same sites as in pUC18mhexPS-crtM-crtN. Plasmid pUC18m-hexPS-crtB-crtI has the same construction as pUC18m-hexPS-crtM-crtN but contains crtB, the C40 carotenoid synthase gene from E. uredovora, in place of crtM and crtI from the same bacterium in place of crtN. The plasmids pUC18m-hexPS-crtMF26L and pUC18m-hexPS-crtMF26A,W38A have the same construction as pUC18m-hexPS-crtM-crtN but lack crtN. pUC18m-hexPS-crtB is the same as pUC18m-hexPS-crtB-crtI but lacks crtI, while plasmid pUC18m-crtE-crtB-crtI 175 has the same construction as pUC18m-hexPS-crtB-crtI but has crtE, the gene encoding the GGPP (C20PP) synthase from E. uredovora, in place of hexPS. Plasmids based on the medium-copy vector pACmod (pACYC184 with the XbaI site removed) (46) were constructed by insertion of a fragment containing the entire operon from a pUC18m-based plasmid (including the lac promoter and operator) into pACmod. In plasmid pAC-crtMF26A,W38A, crtMF26A,W38A is inserted between XbaI and XhoI restriction sites. In pAC-crtMF26A,W38A-crtI, crtI from E. uredovora is also present and is flanked by XhoI and ApaI sites. Plasmid pAC-crtE contains crtE flanked by EcoRI and XbaI sites. In all plasmids listed above, an optimized Shine-Dalgarno ribosomal binding sequence (AGGAGG) followed by eight spacer nucleotides is situated directly upstream of each gene’s start codon. Even for the plasmids with lac operator sequences, leaky transcription was sufficient to effect the expression of carotenogenic genes. Therefore, all experiments described in this report were performed without IPTG (isopropyl-β-Dthiogalactopyranoside) induction. Bacterial cultures and carotenoid extraction E. coli XL1-Blue cells (Stratagene, La Jolla, CA) were transformed with plasmid DNA and plated on Luria-Bertani (LB)-agar plates supplemented with 50 mg/l of each appropriate antibiotic (carbenicillin for pUC-based plasmids, chloramphenicol for pACbased plasmids). Colonies were usually visible after 12 h at 37 °C, at which point 2-ml precultures of LB+antibiotics (50 mg/l each) were inoculated with single colonies and shaken at 37 °C and 250 rpm for 12-18 h. One milliliter of preculture was inoculated into 1 liter of Terrific broth (TB)+antibiotics (50 mg/l each) in a 2.8-liter Erlenmeyer flask. 176 One-liter cultures were shaken at 28 °C and 250 rpm for 48 h. Optical densities at 600 nm of 1-liter cultures (OD600nm) were measured after 10-fold dilution into fresh TB medium. Dry cell masses were determined from OD600nm values using a calibration curve generated for XL1-Blue cultures. Cells were pelleted by centrifugation at 2500 × g for 15 min. For accurate quantification of total carotenoid titers, a known amount of β,β-carotene (Fluka/Sigma, St. Louis, MO) was added to pellets as an internal standard before extraction. Cell lysis and initial carotenoid extraction was achieved by addition of 100 ml of acetone supplemented with 30 mg/l of 3,5-di-tert-butyl-4-hydroxytoluene (BHT; Sigma) followed by vigorous shaking. After this point, to avoid difficulties with mass spectrometry (MS), contact with plasticware was avoided and only glassware was used. After filtration and concentration to ~5 ml under a stream of N2, lipids including carotenoids were partitioned twice into 8 ml of hexanes and then concentrated to ~4 ml under a stream of N2. This extract was then washed 5 times with 2 ml of deionized water, dewatered with anhydrous MgSO4, filtered, and then evaporated to dryness under a stream of N2. After resuspension in 2 ml of acetone + BHT (30 mg/l), a significant amount of fatty material usually precipitated on the sides of the vial. The mixture was sonicated at 40 °C for 10-20 min. to dissolve carotenoids trapped by the precipitate and was then filtered and evaporated to dryness under a stream of N2. Dried extracts were stored under argon gas at -20 °C. Extracts were dissolved into 0.1-1 ml of acetonitrile prior to separation and analysis. For analysis of carotenoids synthesized by E. coli colonies, LB-agar plates were removed from 37 °C after colonies had formed (usually 12 h). The plates were incubated 177 at 25 °C for 48 h to promote carotenoid biosynthesis. Colonies were lifted onto white nitrocellulose membranes (Pall, Port Washington, NY) for imaging on a flatbed scanner. For extraction of carotenoids from colonies, TB medium was used to suspend the colonies, after which the mixture was centrifuged at 2500 × g for 15 min. After decanting the liquid, dry cell masses were determined from measured wet cell masses using a calibration curve generated for XL1-Blue cells. The same steps listed above for carotenoid extraction from liquid culture pellets were followed but all volumes were scaled by a factor of 0.2 due to the smaller cell pellets obtained from scraping colonies compared with pellets from liquid cultures. We generally found that ~0.5 g of wet cells was sufficient to obtain enough extract for HPLC analysis. Separation and analysis of carotenoids The above extracts dissolved in acetonitrile were injected into an Xterra MS C18 column (3.0 × 150 mm, 3.5-μm particle size; Waters, Milford, MA) outfitted with a guard cartridge (3.0 × 20 mm, identical particles) using an Alliance 2690 HPLC system (Waters) equipped with a photodiode array detector (PDA) set to 1.2-nm resolution. For isocratic elution, the mobile phase was acetonitrile:isopropanol 93:7 (by volume) and the flowrate was 0.4 ml/min. For more rapid elution of highly nonpolar C45 and C50 carotenoids, a gradient method with the same flowrate was employed: 0-35 min, acetonitrile:isopropanol 93:7; 35-37 min, linear gradient to acetonitrile:isopropanol 50:50; 37-50 min, acetonitrile:isopropanol 50:50. Carotenoids injected to HPLC were quantified by comparing their chromatogram peak areas (determined at the wavelength of maximum absorption for each carotenoid in the sample) to a calibration curve generated using known amounts of β,β-carotene and then multiplying by the ratio of molar 178 extinction coefficients (εβ,β-carotene/εsample carotenoid) (9). The calibration curve and internal standard peak areas enabled the calculation of scaling factors, which permitted the computation of total carotenoid titers from the HPLC data. Fractions of the HPLC eluent containing separated carotenoids were collected and evaporated to dryness under N2. Mass spectra of carotenoids were obtained using either an 1100 Series HPLC-PDA-MS system (Hewlett Packard/Agilent, Palo Alto, CA) equipped with an atmospheric pressure chemical ionization (APCI) interface or a Finnigan LCQ mass spectrometer equipped with an electrospray ionization (ESI) source (Thermo Electron, San Jose, CA). Previously separated carotenoids were resuspended in either hexanes (for APCI-MS) or methanol:dichloromethane 85:15 (by volume) (for ESIMS) and flow-injected into the mobile phase, which was the same as the solvent used to dissolve the sample. Carotenoids were identified and the putative structures of novel carotenoids were assigned based on their HPLC retention times, UV-visible spectra, and mass spectra. Acetylation of hydroxylated carotenoid backbones To confirm the presence of a hydroxy group on carotenoid backbones, the acetylation protocol suggested by Eugster (19) was followed with slight modification. Briefly, 5-10 nmol of a hydroxylated carotenoid backbone was dissolved in 0.5 ml of pyridine (dried over BaO powder). Fifty microliters of acetic anhydride was then added, and the reactions were carried out at room temperature for 1 h. The reactions were terminated by addition of 4 ml of deionized water, and carotenoids were extracted by partitioning twice with 1 ml of hexanes. After evaporation of the solvent under a stream of N2, the product mixture was analyzed and separated by HPLC as described above. The 179 separated product and unreacted fractions were dried under N2, resuspended in hexanes, and analyzed by APCI-MS as described above. In vitro desaturation of carotenoid backbones Cell lysate of E. coli cultures expressing CrtI was prepared for in vitro desaturation reactions as follows. 150-ml cultures of XL1-Blue(pUCmodII-crtI) were shaken in TB medium supplemented with carbenicillin (50 mg/l) at 28 °C and 113 rpm in upright 175 cm2 tissue culture flasks (BD Falcon, Bedford, MA) until they reached an OD600nm of 5-6 (~48 h). Cells were centrifuged at 2500 × g for 15 min., and each pellet from a 150-ml culture was resuspended in 20 ml of Tris-HCl buffer (50 mM, pH 8) containing 1 mM phenylmethylsulfonylfluoride (PMSF). Cells were lysed by French press, and the lysate was stored at -20 °C in 1-ml aliquots until use. Carotenoid backbone substrates for in vitro desaturation reactions were separated and purified as described above from cultures of XL1-Blue(pUCmodII-crtMF26LbstFPSY81A), XL1-Blue(pUCmodII-crtMF26A,W38A-bstFPSY81A), or XL1-Blue(pUC18mcrtE-crtB) (synthesizing authentic phytoene only (56)). After resuspension in a known amount of hexanes, carotenoid backbones were quantified by their absorbance at 286 nm using a Cary 100 Bio UV-visible spectrophotometer (Varian, Palo Alto, CA). For each in vitro desaturation reaction, 10 nmol of a carotenoid backbone was resuspended in 10 μl of acetone and added to a thawed 1-ml aliquot of XL1-Blue(pUCmodII-crtI) lysate supplemented with additional flavin adenine dinucleotide (FAD, 1mM) and MgCl2 (4 mM). Reaction mixtures were then incubated at 30 °C with gentle end-over-end rotation for 12-18 h. 180 To extract carotenoids from in vitro reactions for HPLC analysis, the reaction mixtures were centrifuged at 14,000 × g for 5 min. and the pellets were separated from the supernatants. Pellets were extracted with 1 ml of acetone + BHT (30 mg/l), thoroughly vortexed, and then filtered. Carotenoids were extracted from the aqueous supernatants by partitioning twice with 1 ml of hexanes. The hexane and acetone extracts of each reaction mixture were pooled and evaporated to dryness under a stream of N2. Carotenoids were then resuspended in 150 μl of acetonitrile and analyzed by HPLC as described above. Iodine-catalyzed photoisomerization To enrich mixtures of E- and Z-carotenoids in all-E (trans) isomers or verify the all-E configuration of specific carotenoids, individual carotenoids or culture extracts were subjected to iodine-catalyzed photoisomerization following the protocol suggested by Schiedt and Liaaen-Jensen (44). After photoisomerization, samples were analyzed by HPLC and changes in E/Z isomeric configuration were identified by the bathochromic (or hypsochromic) shifts in their absorption spectra and the intensity change of cis-peaks (9) compared with control samples not subjected to photoisomerization. Thin-layer chromatography and autoradiography analysis of isoprenyl diphosphate synthase reactions In vitro investigations of isoprenyl diphosphate synthase reactions were performed by Adam Hartwick as follows. E.coli XL1-Blue cells transformed with pUC18m-crtE, pUC18m-bstFPSY81A, or pUC18m-hexPS were cultured for 24 h in 100 ml of TB medium supplemented with carbenicillin (50 mg/l) at 37 °C in 500-ml Erlenmeyer 181 flasks shaken at 250 rpm for 24 h. Each culture was divided into 4 equal aliquots, which were centrifuged at 4 °C for 10 min. at 3000 × g. The cell pellets were stored at -80 °C. Pellets were thawed on ice and then resuspended in 5 ml of Tris-HCl buffer (25 mM, pH 8.5) supplemented with 1 mM EDTA and 10 mM 2-mercaptoethanol. The resuspended cells were lysed by microtip sonication and then centrifuged at 4500 × g for 20 min. The supernatants were stored in 250-μl aliquots at -80 °C until use. Enzyme reactions were carried out by mixing the following: 100 μl of reaction buffer (50 mM HEPES buffer, pH 8.2 supplemented with 40 mM MgCl2, 40 mM MnCl2, and 200 mM 2-mercaptoethanol), 100 μl of FPP (C15PP) buffer (100 μM FPP in 25 mM HEPES buffer, pH 8.2), 100 μl of 14C-IPP buffer (12 μM 14C-labeled IPP in 25 mM HEPES buffer, pH 8.2), and 100 μl of one of the above lysates. The reaction mixtures were shaken at 37 °C and 1000 rpm for 4 h. Radiolabeled isoprenyl diphosphate products were extracted from the reactions by addition of 200 μl of 1-butanol followed by vortexing and centrifugation at 14000 × g for 30 sec. The butanol epiphase was withdrawn and used directly in the subsequent dephosphorylation reaction by potato acid phosphatase (Sigma). The butanol extracts were combined with 400 μl of methanol, 100 μl of acetate buffer (1 M, pH 5.6), 100 μl of 1% (w/v) Triton X-100, and 200 μl of acid phosphatase buffer (44 units enzyme/ml in acetate buffer). The dephosphorylation reactions were then shaken at 37 °C and 1000 rpm for 24 h. Following dephosphorylation, 14C-labeled isoprenyl alcohols were extracted with 0.1 ml of n-pentane. After vortexing and centrifugation, the organic layer was removed by pipette. A portion of each pentane extract was spotted onto a C18 reverse-phase TLC 182 plate, which was developed with a mobile phase of acetone:water 9:1 (by volume). TLC plates were then exposed to a phosphor plate for ~24 h. Autoradiogram images were obtained by scanning the phosphor plates with a Typhoon Imager (Amersham). 183 Table 3.1. Properties of novel desaturated carotenoids synthesized by XL1Blue(pUCmodII-crtMF26A,W38A-crtI-bstFPSY81A) Backbone Conjugated double bonds Retention timea (min) Molecular ion (m/z)b Mol%c UV-visible spectrum (Fig. 3.6) and putative structure (Figs. 3.2-3.4) C40 7 19.2 540.2 5 1 C45 7 30.0 608.4 0.5 3 C45 9 28.5 606.2 1 4 C45 13 15.6, 16.4 602.0 4 5 C45 15 13.9 600.2 2 6 C50 7 42.0 676.2 2 10 C50 9 39.6, 40.4 674.2 5 11a C50 9 38.0 674.2 0.5 11b C50 11 35.9 672.3 3 12a C50 11 34.8 672.3 2 12b/c C50 15 20.3, 21.4 668.1 5 13 a. Using the column and gradient method described in Materials and Methods. Multiple times refer to E/Z isomers of the same carotenoid. b. Determined by electrospray mass spectrometry. Carotenoids underwent direct electrochemical oxidation to give the radical molecular cation [M⋅]+. c. Approximate, of all carotenoids detected in the culture extract by HPLC. Unmetabolized 16,16'-diisopentenylphytoene (C50 backbone) represented ~50 mol% of this population. 184 Table 3.2. Names of numbered carotenoid structures depicted in Figures 3.2-3.4 Structure number Trivial namea IUPAC-IUB semi-systematic name 1 16-isopentenyl-7,8,11,12tetrahydro-4'-apolycopene 16-(3-methylbut-2-enyl)-7,8,11,12tetrahydro-4'-apo-ψ,ψ-carotene 2a C45-phytofluene (9-13') 16-(3-methylbut-2-enyl)-7,8,7',8',11',12'hexahydro-ψ,ψ-carotene 2b C45-phytofluene (13-9') 16-(3-methylbut-2-enyl)-7,8,11,12,7',8'hexahydro-ψ,ψ-carotene 3 C45-ζ-carotene 4a C45-neurosporene (5-9') 16-(3-methylbut-2-enyl)-7,8,7',8'tetrahydro-ψ,ψ-carotene 16-(3-methylbut-2-enyl)-7',8'-dihydro-ψ,ψcarotene 4b C45-neurosporene (9-5') 5a C45-didehydrolycopene (1-5') 5b C45-didehydrolycopene (5-1') 6 C45-tetradehydrolycopene (1-1') 10 C50-ζ-carotene 11a C50-neurosporene (5-9') 11b C50-neurosporene (1-13') 12a C50-lycopene (5-5') 12b C50-lycopene (9-1') 12c C50-lycopene (13-3'') 13 C50-tetradehydrolycopene 16-(3-methylbut-2-enyl)-7,8-dihydro-ψ,ψcarotene 16-(3-methylbut-2-enyl)-3,4-didehydroψ,ψ-carotene 16-(3-methylbut-2-enyl)-3',4'-didehydroψ,ψ-carotene 16-(3-methylbut-2-enyl)-3,4,3',4'tetradehydro-ψ,ψ-carotene 16,16'-di-(3-methylbut-2-enyl)-7,8,7',8'tetrahydro-ψ,ψ-carotene 16,16'-di-(3-methylbut-2-enyl)-7,8dihydro-ψ,ψ-carotene 16,16'-di-(3-methylbut-2-enyl)-3,4didehydro-7',8',11',12'-tetrahydro-ψ,ψcarotene 16,16'-di-(3-methylbut-2-enyl)-ψ,ψcarotene 16,16'-di-(3-methylbut-2-enyl)-3,4didehydro-7',8'-dihydro-ψ,ψ-carotene 16-(3-methylbut-2-enylidene),16'-(3methylbut-2-enyl)-3,4-didehydro7',8',11',12'-dihydro-ψ,ψ-carotene 16,16'-di-(3-methylbut-2-enyl)-3,4,3',4'tetradehydro-ψ,ψ-carotene a. Numbers in brackets refer to the carbon atoms that mark the ends of the conjugated double-bond system. The double prime in the trivial name for carotenoid 12c refers to the numbering of the 3-methylbut-2-enylidene group on the right side of the molecule as shown in Figure 3.3. 185 Table 3.3. Results of in vitro desaturation experiments with XL1-Blue(pUCmodII-crtI) lysate on various carotenoid backbonesa Backbone Conversion (%) Desaturation products (mol% of product mixture) 1-step 2-step 3-step 4-step C30 1 28 41 9 22 phytoeneb 19 14 13c 7 66 C40-OHd 30 11 12 19 58 C45 5 71 [2]e 29 [3] – – C45-OH [7] 14 48 [8] 52 [9] – – C50 0 – – – – C50-OH [14] 0 – – – Numbers in square brackets refer to products shown in Figures 3.2 and 3.5. – a. Values represent the average of at least two independent experiments rounded to the closest percentage point. Coefficients of variation were less than 0.25. b. The native substrate of CrtI and positive control. Phytoene was purified from cultures of XL1-Blue(pUC18m-crtE-crtB) (56), which produces authentic phytoene only. c. Identified by its absorbance spectrum as ζ-carotene. d. Most likely predominantly OH-phytoene but may have contained some hydroxylated 16-isopentenyl-4'-apophytoene (asymmetric C40 backbone). e. This product was detected only from in vitro desaturation of 16-isopentenylphytoene (C45 backbone) and was not found in vivo. 186 Figure 3.1. Six carotenoid biosynthetic pathways from three prenyl diphosphate precursors. Only the C30 and symmetric C40 pathways synthesized from C15PP and C20PP, respectively, have been identified in nature. E. coli cells expressing BstFPSY81A synthesize the rare C25PP precursor FGPP, which can be incorporated into three unnatural carotenoid backbones—C45, C50 (54), and asymmetric C40—upon coexpression of one of a number of CrtM mutants with altered specificity, CrtMmut. Wild-type and variants of CrtM can also synthesize C35 carotenoids by fusion of C15PP and C20PP as reported previously (53, 56). Prenyl diphosphate precursors endogenous to E. coli are depicted in blue. Carotenoid backbones are depicted as the 15Z isomer synthesized by these bacterial carotenoid synthases. CrtB, phytoene synthase; IPP, isopentenyl diphosphate; FPP, farnesyl diphosphate; GGPP, geranylgeranyl diphosphate; FGPP, farnesylgeranyl diphosphate. 187 Figure 3.2. Desaturation in the C45 pathway. Simultaneous coexpression of BstFPSY81A, CrtMF26L or CrtMF26A,W38A (CrtMmut), and the carotenoid desaturase CrtI from E. uredovora resulted in the biosynthesis of desaturated C45 carotenoids with putative structures 3, 4, 5, and 6, reported for the first time in this work. Carotenoid 2 was only detected from in vitro desaturation of 16-isopentenylphytoene. Colored boxes highlighting carotenoid chromophores depict the approximate color of the molecule in white light. Double arrows signify two desaturation steps. Structure numbers (and letters for different desaturation isomers) are used throughout the text and other figures. Names for the numbered structures are listed in Table 3.2. Prenyl diphosphate precursors endogenous to E. coli are depicted in blue. IPP, isopentenyl diphosphate; FPP, farnesyl diphosphate; GGPP, geranylgeranyl diphosphate; FGPP, farnesylgeranyl diphosphate. 188 Figure 3.3 189 Figure 3.3. Desaturation in the C50 pathway. Simultaneous coexpression of BstFPSY81A, CrtMF26L or CrtMF26A,W38A (CrtMmut), and the carotenoid desaturase CrtI from E. uredovora resulted in the biosynthesis of desaturated C50 carotenoids with putative structures 10, 11, 12, and 13, reported for the first time in this work. Colored boxes highlighting carotenoid chromophores depict the approximate color of the molecule in white light. Double arrows signify two desaturation steps. Structure numbers (and letters for different desaturation isomers) are used throughout the text and other figures. Names for the numbered structures are listed in Table 3.2. Prenyl diphosphate precursors endogenous to E. coli are depicted in blue. IPP, isopentenyl diphosphate; FPP, farnesyl diphosphate; GGPP, geranylgeranyl diphosphate; FGPP, farnesylgeranyl diphosphate. 190 Figure 3.4 191 Figure 3.4. An asymmetric C40 pathway. Simultaneous coexpression of BstFPSY81A, CrtMF26L or CrtMF26A,W38A (CrtMmut), and the carotenoid desaturase CrtI from E. uredovora resulted in the biosynthesis of 2-step carotenoid 1, putatively the first carotenoid from the novel asymmetric C40 carotenoid biosynthetic pathway (blue shading) to be isolated. Several lines of evidence support the precise structure of 1 (named in Table 3.2) shown in the figure, including its biosynthesis via 2+0 desaturation of an asymmetric C40 carotenoid backbone formed by condensation of C15PP and C25PP (see Discussion). Symmetric C40 pathway carotenoids phytoene, phytofluene, ζ-carotene, neurosporene, and lycopene are shown for comparison; lycopene was also detected in the same cultures as 1. The structure of 7,8,11,12-tetrahydrolycopene, with the same 2+0 desaturation pattern as 1, is also shown for comparison. This carotenoid is not known to be made by E. uredovora CrtI (crossed-out arrow). Colored boxes highlighting carotenoid chromophores depict the approximate color of the molecule in white light. Prenyl diphosphate precursors endogenous to E. coli are depicted in blue. CrtB, phytoene synthase; IPP, isopentenyl diphosphate; FPP, farnesyl geranylgeranyl diphosphate; FGPP, farnesylgeranyl diphosphate. diphosphate; GGPP, 192 Figure 3.5 193 Figure 3.5. Hydroxylation and subsequent in vitro desaturation of carotenoid backbones. E. coli cells harboring plasmid pUCmodII-crtMF26L-bstFPSY81A or pUCmodII-crtMF26A,W38A-bstFPSY81A accumulate monohydroxylated phytoene as well as monohydroxylated C45 and C50 carotenoid backbones 7 and 14, respectively (Figures 3.73.9). Neither the mechanism nor the specific sites of hydroxylation are known. In vitro, E. uredovora CrtI catalyzes 4 desaturation steps on the hydroxylated C40 backbone, with each intermediate in the desaturation sequence being detected (Table 3.3). In vitro desaturation of the hydroxylated C45 backbone 7 yielded 1-step product 8 and 2-step product 9. The hydroxylated C50 backbone 14 was not detectably desaturated by CrtI in vitro (crossed-out arrow). CrtB, phytoene synthase; CrtMmut, mutant synthase CrtMF26L or CrtMF26A,W38A; IPP, isopentenyl diphosphate; FPP, farnesyl diphosphate; GGPP, geranylgeranyl diphosphate; FGPP, farnesylgeranyl diphosphate. 194 Figure 3.6 195 Figure 3.6. UV-visible absorption spectra of novel carotenoids biosynthesized by recombinant E. coli. Numeric labels refer to structures depicted in Figures 3.2-3.4; multiple letters indicate that the spectrum may be that of either or both structures. Spectra were measured by photodiode array directly after HPLC separation, with a mobile phase of acetonitrile:isopropanol 93:7 (by volume, see Materials and Methods). Spectra were taken before and after iodine-catalyzed photoisomerization; each spectrum shown is the most bathochromically shifted of the two. Absorption spectra of ζ-carotene, neurosporene, and lycopene generated by in vitro desaturation of authentic phytoene are shown for comparison (See Figure 3.4 for structures of these C40 carotenoids). Absorption maxima are labeled with the corresponding wavelength. Table 3.1 lists additional properties of these molecules; Table 3.2 lists their names. 196 Figure 3.7. HPLC trace of carotenoid backbones extracted from a culture of XL1Blue(pUCmodII-crtMF26L-bstFPSY81A). Carotenoids were eluted using the gradient method described in Materials and Methods. The identity of each peak was confirmed by MS; the presence of monohydroxy substituents was further confirmed by acetylation and subsequent MS (see Figure 3.9). The C40 and C40-OH peaks likely represent mixtures of symmetric and asymmetric C40 backbones that did not separate under these elution conditions. Labeled major peaks represent 15Z isomers; minor peaks eluting just after major peaks represent all-E isomers. Numbers in square brackets refer to products shown in Figure 3.5. 197 Figure 3.8. Relative molar quantities of the carotenoid backbones produced by recombinant XL1-Blue cultures expressing BstFPSY81A and a CrtM variant. Transformed plasmid(s) are shown on the horizontal axis. Bar heights represent the average of measurements of at least three independent cultures; error bars, standard deviations. Total carotenoid titers varied to a greater extent than relative molar quantities, approximate values were: pUCmodII-crtMF26L-bstFPSY81A, ~100 nmol/g dry cells; pUCmodII-crtMF26A,W38A-bstFPSY81A, ~300 nmol/g dry cells; pUC18m-bstFPSY81A + pAC-crtMF26A,W38A, ~70 nmol/g dry cells. ND, not detected. The C40 and C40-OH data series likely represent mixtures of symmetric and asymmetric C40 backbones that did not separate by the HPLC methods described in Materials and Methods. 198 Figure 3.9 199 Figure 3.9. APCI mass spectra of unmodified, hydroxylated, and acetylated carotenoid backbones. Unmodified carotenoid backbones ionize by protonation in APCI-MS, giving [M+H]+ quasimolecular ions (calculated monoisotopic masses for carotenoid backbones: C40, 544.5 Da; C45, 612.6 Da; C50, 680.6 Da). Hydroxylated carotenoid backbones ionize by protonation followed by loss of water, yielding an [(M+H)-H2O]+ ion (m/z = 543.9 for C40-OH, 611.5 for C45-OH, and 679.5 for C50-OH) in addition to the [M+H]+ quasimolecular ion (m/z = 561.5 for C40-OH, 629.5 for C45-OH, and 697.5 for C50-OH). Hydroxylated backbones were acetylated by reaction with acetic anhydride. Mass spectra of the acetylated products reveal a similar mode of ionization to their hydroxylated counterparts, yielding the [(M+H)-CH3COOH]+ ion (identical to the [(M+H)-H2O]+ ions listed above) in addition to the [M+H]+ quasimolecular ion (m/z = 603.9 for C40-OAc, 671.5 for C45-OAc, and 739.5 for C50-OAc). Numbers in square brackets refer to products shown in Figure 3.5. 200 Figure 3.10. Relative molar quantities of the carotenoid backbones produced by recombinant XL1-Blue cultures expressing ApFGS and CrtMF26A,W38A. Transformed plasmid(s) are shown on the horizontal axis. Bar heights represent the average of measurements on two independent cultures; error bars, standard deviations. Total carotenoid titers varied to a greater extent than relative molar quantities, approximate values were: pUC18m-crtMF26A,W38A, ~30 nmol/g dry cells; pUC18m-apFGScrtMF26A,W38A, ~100 nmol/g dry cells; pAC-crtE + pUC18m-apFGS-crtMF26A,W38A, ~300 nmol/g dry cells; pUC18m-apFGS + pAC-crtMF26A,W38A, ~100 nmol/g dry cells. ND, not detected. The relatively low proportion of C50 backbones in the cultures expressing ApFGS indicates a low C25PP supply in the cells. Therefore, ApFGS acts predominantly as a C20PP synthase under these conditions, and the C40 backbone population should thus consist almost exclusively of phytoene. 201 Figure 3.11 202 Figure 3.11. Idi overexpression and physiological state strongly influence the distribution of carotenoid backbones in recombinant XL1-Blue cells expressing BstFPSY81A and CrtMF26A,W38A. Transformed plasmid(s) and physiological state (liquid culture or colonies) are shown on the horizontal axis. For the first data set, which is repeated from Figure 3.8, bar heights represent the average of measurements on four replicate cultures. For the other sets, bar heights represent the average of measurements on two independent TB liquid cultures (second set) or on collected colonies from two independent LB-agar plates (third set). Total carotenoid titers varied to a greater extent than relative molar quantities, approximate values were: pUC18m-bstFPSY81A + pACcrtMF26A,W38A (liquid culture), ~70 nmol/g dry cells; pUC18m-bstFPSY81A-idi + pACcrtMF26A,W38A (liquid culture), ~700 nmol/g dry cells; pUC18m-bstFPSY81A + pACcrtMF26A,W38A (colonies), ~70 nmol/g dry cells. ND, not detected. The relatively low proportion of C50 backbones in the second and third data sets indicates a low C25PP supply in the cells; therefore, the C40 backbone population should consist predominantly of phytoene. 203 Figure 3.12 204 Figure 3.12. Product specificity of M. luteus hexaprenyl diphosphate synthase (HexPS). (a) Pigmentation of E. coli XL1-Blue colonies expressing different plasmids and imaged on white nitrocellulose: panel 1, pUC18m-crtM-crtN; panel 2, pUC18mhexPS-crtM-crtN; panel 3, pUC18m-crtE-crtB-crtI; panel 4, pUC18m-hexPS-crtB-crtI. (b) TLC-autoradiogram of the hydrolyzed products from in vitro reactions of FPP (C15PP) with 14C-labeled IPP catalyzed by various isoprenyl diphosphate synthases: lane 1, E. uredovora CrtE; lane 2, BstFPSY81A; lane 3, HexPS. Prenyl diphosphate products were hydrolyzed with acid phosphatase to the corresponding alcohol and then separated by reverse-phase TLC (see Materials and Methods). The direction of mobile phase flow was bottom to top. This autoradiogram was obtained by Adam Hartwick. 205 REFERENCES 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. Aharoni, A., L. Gaidukov, O. Khersonsky, Q. G. S. Mc, C. Roodveldt, and D. S. Tawfik. 2005. The 'evolvability' of promiscuous protein functions. Nat. Genet. 37:73-6. Albrecht, M., G. Sandmann, D. Musker, and G. Britton. 1991. Identification of epoxy- and hydroxyphytoene from norflurazon-treated Scenedesmus. J. Agric. Food Chem. 39:566-569. Albrecht, M., S. Takaichi, N. Misawa, G. Schnurr, P. Böger, and G. Sandmann. 1997. Synthesis of atypical cyclic and acyclic hydroxy carotenoids in Escherichia coli transformants. J. Biotechnol. 58:177-185. Albrecht, M., S. Takaichi, S. Steiger, Z. Y. Wang, and G. Sandmann. 2000. Novel hydroxycarotenoids with improved antioxidative properties produced by gene combination in Escherichia coli. Nat. Biotechnol. 18:843-846. Aragón, C. M., F. J. Murillo, M. D. de la Guardia, and E. Cerdá-Olmedo. 1976. An enzyme complex for the dehydrogenation of phytoene in Phycomyces. Eur. J. Biochem. 63:71-5. Boucher, Y., M. Kamekura, and W. F. Doolittle. 2004. Origins and evolution of isoprenoid lipid biosynthesis in archaea. Mol. Microbiol. 52:515-27. Britton, G. 1998. Overview of carotenoid biosynthesis, p. 13-147. In G. Britton, S. Liaaen-Jensen, and H. Pfander (ed.). Carotenoids, vol. 3: Biosynthesis and Metabolism. Birkhäuser Verlag, Basel. Britton, G. 1995. Structure and properties of carotenoids in relation to function. Faseb J. 9:1551-8. Britton, G. 1995. UV/Visible Spectroscopy, p. 13-62. In G. Britton, S. LiaaenJensen, and H. Pfander (ed.). Carotenoids, vol. 1B: Spectroscopy. Birkhäuser Verlag, Basel. Buckingham, J. 2004. Dictionary of Natural Products. Chapman & Hall/CRC Press. http://www.chemnetbase.com/scripts/dnpweb.exe. Burch, R. R., Y. Dong, C. Fincher, M. Goldfinger, and P. Rouviere. 2004. Electrical properties of polyunsaturated natural products: field effect mobility of carotenoid polyenes. Synth. Met. 146:43-46. Candau, R., E. R. Bejarano, and E. Cerdá-Olmedo. 1991. In vivo channeling of substrates in an enzyme aggregate for beta-carotene biosynthesis. Proc. Natl. Acad. Sci. U.S.A. 88:4936-40. Colodner, R. 2005. Extended-spectrum beta-lactamases: a challenge for clinical microbiologists and infection control specialists. Am. J. Infect. Control 33:104-7. Davies, B. H., C. J. Hallett, R. A. London, and A. F. Rees. 1974. The nature of "theta-carotene." Phytochemistry 13:1209-1217. Davis, J. B., L. M. Jackman, P. T. Siddons, and B. C. L. Weedon. 1966. Carotenoids and related compounds Part XV: The structure and synthesis of phytoene, phytofluene, zeta-carotene, and neurosporene. J. Chem. Soc. (C):21542165. 206 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. De la Guardia, M. D., C. M. Aragón, F. J. Murillo, and E. Cerdá-Olmedo. 1971. A carotenogenic enzyme aggregate in Phycomyces: evidence from quantitive complementation. Proc. Natl. Acad. Sci. U.S.A. 68:2012-5. Edge, R., D. J. McGarvey, and T. G. Truscott. 1997. The carotenoids as antioxidants—a review. J. Photochem. Photobiol. B. 41:189-200. Englert, G. 1995. NMR Spectroscopy, p. 147-260. In G. Britton, S. LiaaenJensen, and H. Pfander (ed.). Carotenoids, vol. 1B: Spectroscopy. Birkhäuser Verlag, Basel. Eugster, C. H. 1995. Chemical Derivatization: Microscale Tests for the Presence of Common Functional Groups in Carotenoids, p. 71-80. In G. Britton, S. LiaaenJensen, and H. Pfander (ed.). Carotenoids, vol. 1A: Isolation and Analysis. Birkhäuser Verlag, Basel. Farmer, W. R., and J. C. Liao. 2000. Improving lycopene production in Escherichia coli by engineering metabolic control. Nat. Biotechnol. 18:533-537. Firn, R. D., and C. G. Jones. 2000. The evolution of secondary metabolism—a unifying model. Mol. Microbiol. 37:989-994. Firn, R. D., and C. G. Jones. 1996. An explanation of secondary product "redundancy," p. 295-312. In J. T. Romeo, J. A. Saunders, and P. Barbosa (ed.), Recent Advances in Phytochemistry, vol. 30. Phytochemical Diversity and Redundancy in Ecological Interactions. Plenum Press, New York. Firn, R. D., and C. G. Jones. 2003. Natural products—a simple model to explain chemical diversity. Nat. Prod. Rep. 20:382-391. Fraser, P. D., N. Misawa, H. Linden, S. Yamano, K. Kobayashi, and G. Sandmann. 1992. Expression in Escherichia coli, purification, and reactivation of the recombinant Erwinia uredovora phytoene desaturase. J. Biol. Chem. 267:19891-19895. Hausmann, A., and G. Sandmann. 2000. A single five-step desaturase is involved in the carotenoid biosynthesis pathway to beta-carotene and torulene in Neurospora crassa. Fungal Genetics and Biology 30:147-153. Hemmi, H., S. Ikejiri, S. Yamashita, and T. Nishino. 2002. Novel mediumchain prenyl diphosphate synthase from the thermoacidophilic archaeon Sulfolobus solfataricus. J. Bacteriol. 184:615-20. Jensen, R. A. 1976. Enzyme recruitment in evolution of new function. Annu. Rev. Microbiol. 30:409-25. Jones, C. G., and R. D. Firn. 1991. On the evolution of plant secondary chemical diversity. Philos. Trans. R. Soc. Lond. Ser. B-Biol. Sci. 333:273-280. Karrer, P., and C. H. Eugster. 1951. Carotinoidsynthesen 8. Synthese des dodecapreno-beta-carotins. Helv. Chim. Acta 34:1805-1814. Krubasik, P., M. Kobayashi, and G. Sandmann. 2001. Expression and functional analysis of a gene cluster involved in the synthesis of decaprenoxanthin reveals the mechanisms for C50 carotenoid formation. Eur. J. Biochem. 268:37023708. Lee, P. C., A. Z. R. Momen, B. N. Mijts, and C. Schmidt-Dannert. 2003. Biosynthesis of structurally novel carotenoids in Escherichia coli. Chem. Biol. 10:453-462. 207 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. Liaaen-Jensen, S. 1995. Combined Approach: Identification and Structure Elucidation of Carotenoids, p. 343-354. In G. Britton, S. Liaaen-Jensen, and H. Pfander (ed.). Carotenoids, vol. 1B: Spectroscopy. Birkhäuser Verlag, Basel. Linden, H., N. Misawa, D. Chamovitz, I. Pecker, J. Hirschberg, and G. Sandmann. 1991. Functional complementation in Escherichia coli of different phytoene desaturase genes and analysis of accumulated carotenes. Z. Naturforsch. (C) 46:1045-1051. Lorenz, R. T., and G. R. Cysewski. 2000. Commercial potential for Haematococcus microalgae as a natural source of astaxanthin. Trends Biotechnol. 18:160-7. Mijts, B. N., P. C. Lee, and C. Schmidt-Dannert. 2005. Identification of a carotenoid oxygenase synthesizing acyclic xanthophylls: combinatorial biosynthesis and directed evolution. Chem. Biol. 12:453-60. Murillo, F. J., S. Torres-Martinez, C. M. Aragón, and E. Cerdá-Olmedo. 1981. Substrate transfer in carotene biosynthesis in Phycomyces. Eur. J. Biochem. 119:511-6. Ohnuma, S., K. Narita, T. Nakazawa, C. Ishida, Y. Takeuchi, C. Ohto, and T. Nishino. 1996. A role of the amino acid residue located on the fifth position before the first aspartate-rich motif of farnesyl diphosphate synthase on determination of the final product. J. Biol. Chem. 271:30748-30754. Ohnuma, S. I., T. Nakazawa, H. Hemmi, A. M. Hallberg, T. Koyama, K. Ogura, and T. Nishino. 1996. Conversion from farnesyl diphosphate synthase to geranylgeranyl diphosphate synthase by random chemical mutagenesis. J. Biol. Chem. 271:10087-10095. Raisig, A., G. Bartley, P. Scolnik, and G. Sandmann. 1996. Purification in an active state and properties of the 3-step phytoene desaturase from Rhodobacter capsulatus overexpressed in Escherichia coli. J. Biochem. (Tokyo) 119:559-64. Raisig, A., and G. Sandmann. 2001. Functional properties of diapophytoene and related desaturases of C30 and C40 carotenoid biosynthetic pathways. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 1533:164-170. Rison, S. C., and J. M. Thornton. 2002. Pathway evolution, structurally speaking. Curr. Opin. Struct. Biol. 12:374-82. Sandmann, G. 2002. Combinatorial biosynthesis of carotenoids in a heterologous host: A powerful approach for the biosynthesis of novel structures. ChemBioChem 3:629-635. Sandmann, G., M. Albrecht, G. Schnurr, O. Knorzer, and P. Boger. 1999. The biotechnological potential and design of novel carotenoids by gene combination in Escherichia coli. Trends Biotechnol. 17:233-237. Schiedt, K., and S. Liaaen-Jensen. 1995. Isolation and Analysis, p. 81-108. In G. Britton, S. Liaaen-Jensen, and H. Pfander (ed.). Carotenoids, vol. 1A: Isolation and Analysis. Birkhäuser Verlag, Basel. Schmidt-Dannert, C. 2000. Engineering novel carotenoids in microorganisms. Curr. Opin. Biotechnol. 11:255-261. Schmidt-Dannert, C., D. Umeno, and F. H. Arnold. 2000. Molecular breeding of carotenoid biosynthetic pathways. Nat. Biotechnol. 18:750-753. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 208 Shimizu, N., T. Koyama, and K. Ogura. 1998. Molecular cloning, expression, and characterization of the genes encoding the two essential protein components of Micrococcus luteus B-P 26 hexaprenyl diphosphate synthase. J. Bacteriol. 180:1578-81. Steiger, S., S. Takaichi, and G. Sandmann. 2002. Heterologous production of two unusual acyclic carotenoids, 1,1'-dihydroxy-3,4-didehydrolycopene and 1hydroxy-3,4,3',4'-tetradehydrolycopene by combination of the crtC and crtD genes from Rhodobacter and Rubrivivax. J. Biotechnol. 97:51-8. Tachibana, A. 1994. A novel prenyltransferase, farnesylgeranyl diphosphate synthase, from the haloalkaliphilic archaeon, Natronobacterium pharaonis. FEBS Lett. 341:291-4. Tachibana, A., Y. Yano, S. Otani, N. Nomura, Y. Sako, and M. Taniguchi. 2000. Novel prenyltransferase gene encoding farnesylgeranyl diphosphate synthase from a hyperthermophilic archaeon, Aeropyrum pernix: Molecular evolution with alteration in product specificity. Eur. J. Biochem. 267:321-8. Takaichi, S. 2000. Characterization of carotenes in a combination of a C18 HPLC column with isocratic elution and absorption spectra with a photodiode-array detector. Photosynth. Res. 65:93-99. Tao, L., A. Schenzle, J. M. Odom, and Q. Cheng. 2005. Novel carotenoid oxidase involved in biosynthesis of 4,4'-diapolycopene dialdehyde. Appl. Environ. Microbiol. 71:3294-301. Umeno, D., and F. H. Arnold. 2003. A C35 carotenoid biosynthetic pathway. Appl. Environ. Microbiol. 69:3573-3579. Umeno, D., and F. H. Arnold. 2004. Evolution of a pathway to novel long-chain carotenoids. J. Bacteriol. 186:1531-1536. Umeno, D., K. Hiraga, and F. H. Arnold. 2003. Method to protect a targeted amino acid residue during random mutagenesis. Nucleic Acids Res. 31:e91. Umeno, D., A. V. Tobias, and F. H. Arnold. 2002. Evolution of the C30 carotenoid synthase CrtM for function in a C40 pathway. J. Bacteriol. 184:66906699. Vershinin, A. 1999. Biological functions of carotenoids—diversity and evolution. Biofactors 10:99-104. Wang, C. W., and J. C. Liao. 2001. Alteration of product specificity of Rhodobacter sphaeroides phytoene desaturase by directed evolution. J. Biol. Chem. 276:41161-41164. Wang, C. W., M. K. Oh, and J. C. Liao. 1999. Engineered isoprenoid pathway enhances astaxanthin production in Escherichia coli. Biotechnol. Bioeng. 62:235241. Wang, K., and S. Ohnuma. 1999. Chain-length determination mechanism of isoprenyl diphosphate synthases and implications for molecular evolution. Trends Biochem. Sci. 24:445-451. Woodall, A. A., S. W. M. Lee, R. J. Weesie, M. J. Jackson, and G. Britton. 1997. Oxidation of carotenoids by free radicals: relationship between structure and reactivity. Biochim. Biophys. Acta-Gen. Subj. 1336:33-42. Ycas, M. 1974. On earlier states of the biochemical system. J. Theor. Biol. 44:145-60. 63. 64. 209 Young, A. J., and G. M. Lowe. 2001. Antioxidant and prooxidant properties of carotenoids. Arch. Biochem. Biophys. 385:20-7. Zechmeister, L., and B. K. Koe. 1954. Stepwise dehydrogenation of the colorless polyenes phytoene and phytofluene with N-bromosuccinimide to carotenoid pigments. J. Am. Chem. Soc. 76:2923-2926.  210 APPENDIX A Plasmid Sequences and Maps 211 Plasmid name pUC18m (empty vector); 2486 bp Construction The lacZ gene from pUC18 was cut out and replaced by a lac promoter/operator and the multi-cloning site: NdeI-EcoRI-XbaI-XhoI-ApaI-EheI/KasI. Plasmid map pUC18m sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacaCATATGGAATTCTCTAGACTCGAGGG GCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatc tgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggc atccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacg aaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatg tgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataata ttgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcaccca 212 gaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaa gatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattg acgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatc ttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaac gatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagct gaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcg aactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggccctt ccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggta agccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagatagg tgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaagga tctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaa gatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtt tgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtag ccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagt ggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttc gtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgctt cccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccaggg ggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcgg agcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatc ccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtc agtgagcgaggaagcggaaga 213 Plasmid name pUCmodII (empty vector); 2456 bp Construction Based on pUC19. The lac operator and multi cloning site from pUC19 were removed and replaced with multi cloning site: XbaI-SmaI-EcoRI-NcoI-NotI/EagI (see plasmid map below). Remarks High copy number (several hundred). Since the lac operator has been removed, the genes cloned into the MCS are expressed constitutively in E. coli. Plasmid map pUCmodII sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcgTCTAGAgcgCCCGGGGAATTCCCATGGGCGGCCGCtgcggtattttct ccttacgcatctgtgcggtatttcacaccgCATATGgtgcactctcagtacaatctgctctgatgccgcatagttaagccagc cccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtc tccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttat 214 aggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttct aaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattca acatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgct gaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaa cgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgc cgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaatt atgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccg cttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcg tgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaat taatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatct ggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacg acggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtca gaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatg accaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttct gcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttc cgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactct gtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttgga ctcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaac gacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtat ccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcg ggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcgg cctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcct ttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 215 Plasmid name pACmod (empty vector); 4245 bp; medium copy Construction Identical to commercially available pACYC184 except the XbaI site in that plasmid (TCTAGA) has been mutated to TCAAGA. Although this mutation is in the p15A origin of replication, the plasmid seems fine. Sequence landmarks Chloramphenicol resistance gene 3805-219 (reverse orientation); tetracycline resistance gene 1581-2771; p15A origin 581-1493 Plasmid map pACmod sequence gaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaa aaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccat tgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgc ccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccaggg cttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcg ggtgatgctgccaacttactgatttagtgtatgatggtgtttttgaggtgctccagtggcttctgtttctatcagctgtccctcctgttca gctactgacggggtggtgcgtaacggcaaaagcaccgccggacatcagcgctagcggagtgtatactggcttactatgttggc 216 actgatgagggtgtcagtgaagtgcttcatgtggcaggagaaaaaaggctgcaccggtgcgtcagcagaatatgtgatacagg atatattccgcttcctcgctcactgactcgctacgctcggtcgttcgactgcggcgagcggaaatggcttacgaacggggcgga gatttcctggaagatgccaggaagatacttaacagggaagtgagagggccgcggcaaagccgtttttccataggctccgcccc cctgacaagcatcacgaaatctgacgctcaaatcagtggtggcgaaacccgacaggactataaagataccaggcgtttccccct ggcggctccctcgtgcgctctcctgttcctgcctttcggtttaccggtgtcattccgctgttatggccgcgtttgtctcattccacgcc tgacactcagttccgggtaggcagttcgctccaagctggactgtatgcacgaaccccccgttcagtccgaccgctgcgccttatc cggtaactatcgtcttgagtccaacccggaaagacatgcaaaagcaccactggcagcagccactggtaattgatttagaggagtt agtcttgaagtcatgcgccggttaaggctaaactgaaaggacaagttttggtgactgcgctcctccaagccagttacctcggttca aagagttggtagctcagagaaccttcgaaaaaccgccctgcaaggcggttttttcgttttcagagcaagagattacgcgcagacc aaaacgatctcaagaagatcatcttattaatcagataaaatatttcaagatttcagtgcaatttatctcttcaaatgtagcacctgaagt cagccccatacgatataagttgtaattctcatgtttgacagcttatcATCGATaagctttaatgcggtagtttatcacagttaaatt gctaacgcagtcaggcaccgtgtatgaaatctaacaatgcgctcatcgtcatcctcggcaccgtcaccctggatgctgtaggcat aggcttggttatgccggtactgccgggcctcttgcgggatatcgtccattccgacagcatcgccagtcactatggcgtgctgcta gcgctatatgcgttgatgcaatttctatgcgcacccgttctcggagcactgtccgaccgctttggccgccgcccagtcctgctcgc ttcgctacttggagccactatcgactacgcgatcatggcgaccacacccgtcctgtGGATCCtctacgccggacgcatcgt ggccggcatcaccggcgccacaggtgcggttgctggcgcctatatcgccgacatcaccgatggggaagatcgggctcgcca cttcgggctcatgagcgcttgtttcggcgtgggtatggtggcaggccccgtggccgggggactgttgggcgccatctccttgcat gcaccattccttgcggcggcggtgctcaacggcctcaacctactactgggctgcttcctaatgcaggagtcgcataagggagag cGTCGACcgatgcccttgagagccttcaacccagtcagctccttccggtgggcgcggggcatgactatcgtcgccgcactt atgactgtcttctttatcatgcaactcgtaggacaggtgccggcagcgctctgggtcattttcggcgaggaccgctttcgctggag cgcgacgatgatcggcctgtcgcttgcggtattcggaatcttgcacgccctcgctcaagccttcgtcactggtcccgccaccaaa cgtttcggcgagaagcaggccattatcgccggcatggcggccgacgcgctgggctacgtcttgctggcgttcgcgacgcgag gctggatggccttccccattatgattcttctcgcttccggcggcatcgggatgcccgcgttgcaggccatgctgtccaggcaggt agatgacgaccatcagggacagcttcaaggatcgctcgcggctcttaccagcctaacttcgatcactggaccgctgatcgtcac ggcgatttatgccgcctcggcgagcacatggaacgggttggcatggattgtaggcgccgccctataccttgtctgcctccccgc gttgcgtcgcggtgcatggagccgggccacctcgacctgaatggaagccggcggcacctcgctaacggattcaccactccaa gaattggagccaatcaattcttgcggagaactgtgaatgcgcaaaccaacccttggcagaacatatccatcgcgtccgccatctc cagcagccgcacgcggcgcatctcgggcagcgttgggtcctggccacgggtgcgcatgatcgtgctcctgtcgttgaggacc cggctaggctggcggggttgccttactggttagcagaatgaatcaccgatacgcgagcgaacgtgaagcgactgctgctgcaa aacgtctgcgacctgagcaacaacatgaatggtcttcggtttccgtgtttcgtaaagtctggaaacgcggaagtcccctacgtgct gctgaagttgcccgcaacagagagtggaaccaaccggtgataccacgatactatgactgagagtcaacgccatgagcggcct catttcttattctgagttacaacagtccgcaccgctgtccggtagctccttccggtgggcgcggggcatgactatcgtcgccgcac ttatgactgtcttctttatcatgcaactcgtaggacaggtgccggcagcgcccaacagtcccccggccacggggcctgccaccat acccacgccgaaacaagcgccctgcaccattatgttccggatctgcatcgcaggatgctgctggctaccctgtggaacacctac atctgtattaacgaagcgctaaccgtttttatcaggctctgggaggcagaataaatgatcatatcgtcaattattacctccacgggg agagcctgagcaaactggcctcaggcatttgagaagcacacggtcacactgcttccggtagtcaataaaccggtaaaccagca atagacataagcggctatttaacgaccctgccctgaaccgacgaccgggtcgaatttgctttcgaatttctgccattcatccgcttat tatcacttattcaggcgtagcaccaggcgtttaagggcaccaataactgccttaaaaaaattacgccccgccctgccactcatcgc AGTACTgttgtaattcattaagcattctgccgacatggaagccatcacagacggcatgatgaacctgaatcgccagcggca tcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaa aactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcacc gtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcag tttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacg 217 Plasmid name pUC18m-crtE-crtB-crtI; 5807 bp Based on vector pUC18m. Construction All 3 genes are on a single operon, regulated by a single lac promoter and operator. Just upstream of each gene is an optimized Shine-Dalgarno site (AGGAGG) followed by 8 spacer nucleotides. The gene crtE from Erwinia uredovora, (GGPP synthase) is inserted between the EcoRI and XbaI sites. The gene crtB from Erwinia uredovora (C40 carotenoid synthase) is inserted between the XbaI and XhoI sites. The gene crtI from Erwinia uredovora (C40 carotenoid desaturase) is inserted between the XhoI and ApaI sites. Plasmid map pUC18m-crtE-crtB-crtI sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaa cgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca ggaaacaCATATGGAATTCaggaggattacaaaatgacggtctgcgcaaaaaaacacgttcatctcactcgcgatgctgcggagcagttactg gctgatattgatcgacgccttgatcagttattgcccgtggagggagaacgggatgttgtgggtgccgcgatgcgtgaaggtgcgctggcaccgggaaaac gtattcgccccatgttgctgttgctgaccgcccgcgatctgggttgcgctgtcagccatgacggattactggatttggcctgtgcggtggaaatggtccacgc ggcttcgctgatccttgacgatatgccctgcatggacgatgcgaagctgcggcgcggacgccctaccattcattctcattacggagagcatgtggcaatact ggcggcggttgccttgctgagtaaagcctttggcgtaattgccgatgcagatggcctcacgccgctggcaaaaaatcgggcggtttctgaactgtcaaacg ccatcggcatgcaaggattggttcagggtcagttcaaggatctgtctgaaggggataagccgcgcagcgctgaagctattttgatgacgaatcactttaaaa ccagcacgctgttttgtgcctccatgcagatggcctcgattgttgcgaatgcctccagcgaagcgcgtgattgcctgcatcgtttttcacttgatcttggtcagg 218 catttcaactgctggacgatttgaccgatggcatgaccgacaccggtaaggatagcaatcaggacgccggtaaatcgacgctggtcaatctgttaggcccg agggcggttgaagaacgtctgagacaacatcttcagcttgccagtgagcatctctctgcggcctgccaacacgggcacgccactcaacattttattcaggcc tggtttgacaaaaaactcgctgccgtcagttaaTCTAGAaggaggattacaaaatggcagttggctcgaaaagttttgcgacagcctcaaagttatttga tgcaaaaacccggcgcagcgtactgatgctctacgcctggtgccgccattgtgacgatgttattgacgatcagacgctgggctttcaggcccggcagcctg ccttacaaacgcccgaacaacgtctgatgcaacttgagatgaaaacgcgccaggcctatgcaggatcgcagatgcacgaaccggcgtttgcggcttttcag gaagtggctatggctcatgatatcgccccggcttacgcgtttgatcatctggaaggcttcgccatggatgtacgcgaagcgcaatacagccaactggatgat acgctgcgctattgctatcacgttgcaggcgttgtcggcttgatgatggcgcaaatcatgggcgtgcgggataacgccacgctggaccgcgcctgtgacctt gggctggcatttcagttgaccaatattgctcgcgatattgtggacgatgcgcatgcgggccgctgttatctgccggcaagctggctggagcatgaaggtctg aacaaagagaattatgcggcacctgaaaaccgtcaggcgctgagccgtatcgcccgtcgtttggtgcaggaagcagaaccttactatttgtctgccacagc cggcctggcagggttgcccctgcgttccgcctgggcaatcgctacggcgaagcaggtttaccggaaaataggtgtcaaagttgaacaggccggtcagca agcctgggatcagcggcagtcaacgaccacgcccgaaaaattaacgctgctgctggccgcctctggtcaggcccttacttcccggatgcgggctcatcct ccccgccctgcgcatctctggcagcgcccgctctagCTCGAGaggaggattacaaaatgaaaccaactacggtaattggtgcaggcttcggtggcct ggcactggcaattcgtctacaagctgcggggatccccgtcttactgcttgaacaacgtgataaacccggcggtcgggcttatgtctacgaggatcaggggtt tacctttgatgcaggcccgacggttatcaccgatcccagtgccattgaagaactgtttgcactggcaggaaaacagttaaaagagtatgtcgaactgctgcc ggttacgccgttttaccgcctgtgttgggagtcagggaaggtctttaattacgataacgatcaaacccggctcgaagcgcagattcagcagtttaatccccgc gatgtcgaaggttatcgtcagtttctggactattcacgcgcggtgtttaaagaaggctatctaaagctcggtactgtcccttttttatcgttcagagacatgcttcg cgccgcacctcaactggcgaaactgcaggcatggagaagcgtttacagtaaggttgccagttacatcgaagatgaacatctgcgccaggcgttttctttcca ctcgctgttggtgggcggcaatcccttcgccacctcatccatttatacgttgatacacgcgctggagcgtgagtggggcgtctggtttccgcgtggcggcac cggcgcattagttcaggggatgataaagctgtttcaggatctgggtggcgaagtcgtgttaaacgccagagtcagccatatggaaacgacaggaaacaag attgaagccgtgcatttagaggacggtcgcaggttcctgacgcaagccgtcgcgtcaaatgcagatgtggttcatacctatcgcgacctgttaagccagcac cctgccgcggttaagcagtccaacaaactgcagactaagcgcatgagtaactctctgtttgtgctctattttggtttgaatcaccatcatgatcagctcgcgcat cacacggtttgtttcggcccgcgttaccgcgagctgattgacgaaatttttaatcatgatggcctcgcagaggacttctcactttatctgcacgcgccctgtgtc acggattcgtcactggcgcctgaaggttgcggcagttactatgtgttggcgccggtgccAcatttaggcaccgcgaacctcgactggacggttgaggggc caaaactacgcgaccgtatttttgcgtaccttgagcagcattacatgcctggcttacggagtcagctggtcacgcaccggatgtttacgccgtttgattttcgcg accagcttaatgcctatcatggctcagccttttctgtggagcccgttcttacccagagcgcctggtttcggccgcataaccgcgataaaaccattactaatctct acctggtcggcgcaggcacgcatcccggcgcaggcattcctggcgtcatcggctcggcaaaagcgacagcaggtttgatgctggaggatctgatttgaG GGCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcat agttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgg gagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatgg tttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccct gataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcaccca gaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgc cccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatac actattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagt gataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgtt gggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaac tacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgct gataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggag tcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagat tgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagac cccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccg gatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaa gaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgat agttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacag cgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgaggga gcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctat ggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtatta ccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 219 Plasmid name pUC18m-crtE-crtM-crtI; 5781 bp Based on vector pUC18m Construction All 3 genes are on a single operon, regulated by a single lac promoter and operator. Just upstream of each gene is an optimized Shine-Dalgarno site (AGGAGG) followed by 8 spacer nucleotides. The gene crtE from Erwinia uredovora encoding a GGPP synthase is inserted between the EcoRI and XbaI sites. The gene crtM from Staphylococcus aureus encoding a C30 carotenoid synthase is inserted between the XbaI and XhoI sites. The gene crtI from Erwinia uredovora encoding a C40 carotenoid desaturase (4-step) is inserted between the XhoI and ApaI sites. Plasmid map pUC18m-crtE-crtM-crtI sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagt gagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagc ggataacaatttcacacaggaaacaCATATGGAATTCaggaggattacaaaatgacggtctgcgcaaaaaaacacgttcatctca ctcgcgatgctgcggagcagttactggctgatattgatcgacgccttgatcagttattgcccgtggagggagaacgggatgttgtgggtgccg cgatgcgtgaaggtgcgctggcaccgggaaaacgtattcgccccatgttgctgttgctgaccgcccgcgatctgggttgcgctgtcagccat gacggattactggatttggcctgtgcggtggaaatggtccacgcggcttcgctgatccttgacgatatgccctgcatggacgatgcgaagctg cggcgcggacgccctaccattcattctcattacggagagcatgtggcaatactggcggcggttgccttgctgagtaaagcctttggcgtaatt gccgatgcagatggcctcacgccgctggcaaaaaatcgggcggtttctgaactgtcaaacgccatcggcatgcaaggattggttcagggtc agttcaaggatctgtctgaaggggataagccgcgcagcgctgaagctattttgatgacgaatcactttaaaaccagcacgctgttttgtgcctc catgcagatggcctcgattgttgcgaatgcctccagcgaagcgcgtgattgcctgcatcgtttttcacttgatcttggtcaggcatttcaactgct ggacgatttgaccgatggcatgaccgacaccggtaaggatagcaatcaggacgccggtaaatcgacgctggtcaatctgttaggcccgag ggcggttgaagaacgtctgagacaacatcttcagcttgccagtgagcatctctctgcggcctgccaacacgggcacgccactcaacattttat 220 tcaggcctggtttgacaaaaaactcgctgccgtcagttaaTCTAGAaggaggattacaaaatgacaatgatgaatatgaattttaaatatt gtcataaaatcatgaagaaacattcaaaaagcttttcttacgcttttgacttgttaccagaagatcaaagaaaagcggtttgggcaatttatgctgt gtgtcgtaaaattgatgacagtatagatgtttatggcgatattcaatttttaaatcaaataaaagaagatatacaatctattgaaaaatacccatatg aacatcatcactttcaaagtgatcgtagaatcatgatggcgcttcagcatgttgcacaacataaaaatatcgcctttcaatctttttataatctcattg atactgtatataaagatcaacattttacaatgtttgaaacggacgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattg acgccgattttaagtgatcatgaaacacatcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgt cggtgaagattttgacaatgaacggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaa taatcattatattgacttatgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattgaagcac aaccaatcatagaattagcagcacgtatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtttttgtggata agaggaaaaaggcaaagttgtttcatgaaaataaatagtaaatatcatagaatatagCTCGAGaggaggattacaaaatgaaaccaact acggtaattggtgcaggcttcggtggcctggcactggcaattcgtctacaagctgcggggatccccgtcttactgcttgaacaacgtgataaa cccggcggtcgggcttatgtctacgaggatcaggggtttacctttgatgcaggcccgacggttatcaccgatcccagtgccattgaagaactg tttgcactggcaggaaaacagttaaaagagtatgtcgaactgctgccggttacgccgttttaccgcctgtgttgggagtcagggaaggtcttta attacgataacgatcaaacccggctcgaagcgcagattcagcagtttaatccccgcgatgtcgaaggttatcgtcagtttctggactattcacg cgcggtgtttaaagaaggctatctaaagctcggtactgtcccttttttatcgttcagagacatgcttcgcgccgcacctcaactggcgaaactgc aggcatggagaagcgtttacagtaaggttgccagttacatcgaagatgaacatctgcgccaggcgttttctttccactcgctgttggtgggcgg caatcccttcgccacctcatccatttatacgttgatacacgcgctggagcgtgagtggggcgtctggtttccgcgtggcggcaccggcgcatt agttcaggggatgataaagctgtttcaggatctgggtggcgaagtcgtgttaaacgccagagtcagccatatggaaacgacaggaaacaag attgaagccgtgcatttagaggacggtcgcaggttcctgacgcaagccgtcgcgtcaaatgcagatgtggttcatacctatcgcgacctgtta agccagcaccctgccgcggttaagcagtccaacaaactgcagactaagcgcatgagtaactctctgtttgtgctctattttggtttgaatcacca tcatgatcagctcgcgcatcacacggtttgtttcggcccgcgttaccgcgagctgattgacgaaatttttaatcatgatggcctcgcagaggact tctcactttatctgcacgcgccctgtgtcacggattcgtcactggcgcctgaaggttgcggcagttactatgtgttggcgccggtgccAcattt aggcaccgcgaacctcgactggacggttgaggggccaaaactacgcgaccgtatttttgcgtaccttgagcagcattacatgcctggcttac ggagtcagctggtcacgcaccggatgtttacgccgtttgattttcgcgaccagcttaatgcctatcatggctcagccttttctgtggagcccgttc ttacccagagcgcctggtttcggccgcataaccgcgataaaaccattactaatctctacctggtcggcgcaggcacgcatcccggcgcagg cattcctggcgtcatcggctcggcaaaagcgacagcaggtttgatgctggaggatctgatttgaGGGCCCGGCGCCtgatgcggt attttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccg acacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctg catgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataa tggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatga gacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcatttt gccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatct caacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatccc gtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatctta cggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggagga ccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaa cgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaac aattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagc cggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcag gcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatact ttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttcc actgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccg ctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtcc ttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgcc agtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgca cacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggaga aaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttata gtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcg gcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtg agctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 221 Plasmid name pUC18m-crtE-M8-crtI; 5781 bp Based on vector pUC18m Construction This plasmid is identical to pUC18m-crtE-crtM-crtI except in the place of wild-type crtM is M8, a mutant of the C30 carotenoid synthase crtM from Staphylococcus aureus that is capable of synthesizing C40 carotenoids. Plasmid map See pUC18m-crtE-crtM-crtI plasmid map. Mutations Point mutations in M8 (compared with wild-type crtM) are shown below in the plasmid sequence in bold, underlined capital letters and are summarized below (numbered according to their position in the crtM ORF; amino acid substitutions are listed in brackets). T78A (F26L) A345G (silent) pUC-crtE-M8-crtI sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacaCATATGGAATTCaggaggattacaaaatgacggtct gcgcaaaaaaacacgttcatctcactcgcgatgctgcggagcagttactggctgatattgatcgacgccttgatcagttattgccc gtggagggagaacgggatgttgtgggtgccgcgatgcgtgaaggtgcgctggcaccgggaaaacgtattcgccccatgttgct gttgctgaccgcccgcgatctgggttgcgctgtcagccatgacggattactggatttggcctgtgcggtggaaatggtccacgcg gcttcgctgatccttgacgatatgccctgcatggacgatgcgaagctgcggcgcggacgccctaccattcattctcattacggag agcatgtggcaatactggcggcggttgccttgctgagtaaagcctttggcgtaattgccgatgcagatggcctcacgccgctgg caaaaaatcgggcggtttctgaactgtcaaacgccatcggcatgcaaggattggttcagggtcagttcaaggatctgtctgaagg ggataagccgcgcagcgctgaagctattttgatgacgaatcactttaaaaccagcacgctgttttgtgcctccatgcagatggcct cgattgttgcgaatgcctccagcgaagcgcgtgattgcctgcatcgtttttcacttgatcttggtcaggcatttcaactgctggacga tttgaccgatggcatgaccgacaccggtaaggatagcaatcaggacgccggtaaatcgacgctggtcaatctgttaggcccga gggcggttgaagaacgtctgagacaacatcttcagcttgccagtgagcatctctctgcggcctgccaacacgggcacgccactc aacattttattcaggcctggtttgacaaaaaactcgctgccgtcagttaaTCTAGAaggaggattacaaaatgacaatgatga atatgaattttaaatattgtcataaaatcatgaagaaacattcaaaaagcttttcttacgctttAgacttgttaccagaagatcaaaga aaagcggtttgggcaatttatgctgtgtgtcgtaaaattgatgacagtatagatgtttatggcgatattcaatttttaaatcaaataaaa gaagatatacaatctattgaaaaatacccatatgaacatcatcactttcaaagtgatcgtagaatcatgatggcgcttcagcatgttg cacaacataaaaatatcgcctttcaatctttttataatctcattgatactgtatataaagatcaGcattttacaatgtttgaaacggacg ctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattgacgccgattttaagtgatcatgaaacacatcagaca tacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgtcggtgaagattttgacaatgaacggatat attttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaataatcattatattgacttatggg aatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattgaagcacaaccaatcataga attagcagcacgtatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtttttgtggataagag gaaaaaggcaaagttgtttcatgaaaataaatagtaaatatcatagaatatagCTCGAGaggaggattacaaaatgaaacca actacggtaattggtgcaggcttcggtggcctggcactggcaattcgtctacaagctgcggggatccccgtcttactgcttgaaca 222 acgtgataaacccggcggtcgggcttatgtctacgaggatcaggggtttacctttgatgcaggcccgacggttatcaccgatccc agtgccattgaagaactgtttgcactggcaggaaaacagttaaaagagtatgtcgaactgctgccggttacgccgttttaccgcct gtgttgggagtcagggaaggtctttaattacgataacgatcaaacccggctcgaagcgcagattcagcagtttaatccccgcgat gtcgaaggttatcgtcagtttctggactattcacgcgcggtgtttaaagaaggctatctaaagctcggtactgtcccttttttatcgttc agagacatgcttcgcgccgcacctcaactggcgaaactgcaggcatggagaagcgtttacagtaaggttgccagttacatcgaa gatgaacatctgcgccaggcgttttctttccactcgctgttggtgggcggcaatcccttcgccacctcatccatttatacgttgatac acgcgctggagcgtgagtggggcgtctggtttccgcgtggcggcaccggcgcattagttcaggggatgataaagctgtttcag gatctgggtggcgaagtcgtgttaaacgccagagtcagccatatggaaacgacaggaaacaagattgaagccgtgcatttaga ggacggtcgcaggttcctgacgcaagccgtcgcgtcaaatgcagatgtggttcatacctatcgcgacctgttaagccagcaccc tgccgcggttaagcagtccaacaaactgcagactaagcgcatgagtaactctctgtttgtgctctattttggtttgaatcaccatcat gatcagctcgcgcatcacacggtttgtttcggcccgcgttaccgcgagctgattgacgaaatttttaatcatgatggcctcgcaga ggacttctcactttatctgcacgcgccctgtgtcacggattcgtcactggcgcctgaaggttgcggcagttactatgtgttggcgcc ggtgccAcatttaggcaccgcgaacctcgactggacggttgaggggccaaaactacgcgaccgtatttttgcgtaccttgagca gcattacatgcctggcttacggagtcagctggtcacgcaccggatgtttacgccgtttgattttcgcgaccagcttaatgcctatcat ggctcagccttttctgtggagcccgttcttacccagagcgcctggtttcggccgcataaccgcgataaaaccattactaatctctac ctggtcggcgcaggcacgcatcccggcgcaggcattcctggcgtcatcggctcggcaaaagcgacagcaggtttgatgctgg aggatctgatttgaGGGCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatgg tgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacg ggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcac cgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtg gcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccct gataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgcct tcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactgg atctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgc ggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccag tcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggcca acttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgt tgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgca aactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccactt ctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcact ggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacaga tcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcattt ttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcaga ccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctacc agcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactg tccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagt ggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggct gaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgaga aagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagg gagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgt caggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttc tttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccga gcgcagcgagtcagtgagcgaggaagcggaaga 223 Plasmid name pUC18m-crtE-M9-crtI; 5781 bp Based on vector pUC18m Construction This plasmid is identical to pUC18m-crtE-crtM-crtI except in the place of wild-type crtM is M9, a mutant of the C30 carotenoid synthase crtM from Staphylococcus aureus that is capable of synthesizing C40 carotenoids. Plasmid map See pUC18m-crtE-crtM-crtI plasmid map. Mutations Point mutations in M9 (compared with wild-type crtM) are shown below in the plasmid sequence in bold, underlined capital letters and are summarized below (numbered according to their position in the crtM ORF; amino acid substitutions are listed in brackets). T77C (F26S) T119C (I40T) T135C (silent) T141C (silent) A850G (after stop codon) pUC-crtE-M9-crtI sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacaCATATGGAATTCaggaggattacaaaatgacggtct gcgcaaaaaaacacgttcatctcactcgcgatgctgcggagcagttactggctgatattgatcgacgccttgatcagttattgccc gtggagggagaacgggatgttgtgggtgccgcgatgcgtgaaggtgcgctggcaccgggaaaacgtattcgccccatgttgct gttgctgaccgcccgcgatctgggttgcgctgtcagccatgacggattactggatttggcctgtgcggtggaaatggtccacgcg gcttcgctgatccttgacgatatgccctgcatggacgatgcgaagctgcggcgcggacgccctaccattcattctcattacggag agcatgtggcaatactggcggcggttgccttgctgagtaaagcctttggcgtaattgccgatgcagatggcctcacgccgctgg caaaaaatcgggcggtttctgaactgtcaaacgccatcggcatgcaaggattggttcagggtcagttcaaggatctgtctgaagg ggataagccgcgcagcgctgaagctattttgatgacgaatcactttaaaaccagcacgctgttttgtgcctccatgcagatggcct cgattgttgcgaatgcctccagcgaagcgcgtgattgcctgcatcgtttttcacttgatcttggtcaggcatttcaactgctggacga tttgaccgatggcatgaccgacaccggtaaggatagcaatcaggacgccggtaaatcgacgctggtcaatctgttaggcccga gggcggttgaagaacgtctgagacaacatcttcagcttgccagtgagcatctctctgcggcctgccaacacgggcacgccactc aacattttattcaggcctggtttgacaaaaaactcgctgccgtcagttaaTCTAGAaggaggattacaaaatgacaatgatga atatgaattttaaatattgtcataaaatcatgaagaaacattcaaaaagcttttcttacgcttCtgacttgttaccagaagatcaaaga aaagcggtttgggcaaCttatgctgtgtgtcgCaaaatCgatgacagtatagatgtttatggcgatattcaatttttaaatcaaata aaagaagatatacaatctattgaaaaatacccatatgaacatcatcactttcaaagtgatcgtagaatcatgatggcgcttcagcat gttgcacaacataaaaatatcgcctttcaatctttttataatctcattgatactgtatataaagatcaacattttacaatgtttgaaacgga cgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattgacgccgattttaagtgatcatgaaacacatcag acatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgtcggtgaagattttgacaatgaacgg atatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaataatcattatattgacttat gggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattgaagcacaaccaatcat 224 agaattagcagcacgtatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtttttgtggataa gaggaaaaaggcaaagttgtttcatgaaaataaatagtaaGtatcatagaatatagCTCGAGaggaggattacaaaatgaa accaactacggtaattggtgcaggcttcggtggcctggcactggcaattcgtctacaagctgcggggatccccgtcttactgcttg aacaacgtgataaacccggcggtcgggcttatgtctacgaggatcaggggtttacctttgatgcaggcccgacggttatcaccg atcccagtgccattgaagaactgtttgcactggcaggaaaacagttaaaagagtatgtcgaactgctgccggttacgccgttttac cgcctgtgttgggagtcagggaaggtctttaattacgataacgatcaaacccggctcgaagcgcagattcagcagtttaatcccc gcgatgtcgaaggttatcgtcagtttctggactattcacgcgcggtgtttaaagaaggctatctaaagctcggtactgtccctttttta tcgttcagagacatgcttcgcgccgcacctcaactggcgaaactgcaggcatggagaagcgtttacagtaaggttgccagttac atcgaagatgaacatctgcgccaggcgttttctttccactcgctgttggtgggcggcaatcccttcgccacctcatccatttatacgt tgatacacgcgctggagcgtgagtggggcgtctggtttccgcgtggcggcaccggcgcattagttcaggggatgataaagctg tttcaggatctgggtggcgaagtcgtgttaaacgccagagtcagccatatggaaacgacaggaaacaagattgaagccgtgcat ttagaggacggtcgcaggttcctgacgcaagccgtcgcgtcaaatgcagatgtggttcatacctatcgcgacctgttaagccagc accctgccgcggttaagcagtccaacaaactgcagactaagcgcatgagtaactctctgtttgtgctctattttggtttgaatcacca tcatgatcagctcgcgcatcacacggtttgtttcggcccgcgttaccgcgagctgattgacgaaatttttaatcatgatggcctcgc agaggacttctcactttatctgcacgcgccctgtgtcacggattcgtcactggcgcctgaaggttgcggcagttactatgtgttggc gccggtgccAcatttaggcaccgcgaacctcgactggacggttgaggggccaaaactacgcgaccgtatttttgcgtaccttga gcagcattacatgcctggcttacggagtcagctggtcacgcaccggatgtttacgccgtttgattttcgcgaccagcttaatgccta tcatggctcagccttttctgtggagcccgttcttacccagagcgcctggtttcggccgcataaccgcgataaaaccattactaatct ctacctggtcggcgcaggcacgcatcccggcgcaggcattcctggcgtcatcggctcggcaaaagcgacagcaggtttgatg ctggaggatctgatttgaGGGCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatat atggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctg acgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcat caccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcag gtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataac cctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttg ccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaac tggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtgg cgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcac cagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcgg ccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgat cgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgc gcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggacc acttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcag cactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaataga cagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaactt catttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgt cagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgc taccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaat actgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttac cagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcg ggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctat gagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcac gagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatg ctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcaca tgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgac cgagcgcagcgagtcagtgagcgaggaagcggaaga 225 Plasmid name pUC18m-crtE-M10-crtI; 5781 bp Based on vector pUC18m Construction This plasmid is identical to pUC18m-crtE-crtM-crtI except in the place of wild-type crtM is M10, a mutant of the C30 carotenoid synthase crtM from Staphylococcus aureus that is capable of synthesizing C40 carotenoids. Plasmid map See pUC18m-crtE-crtM-crtI plasmid map. Mutations Point mutations in M10 (compared with wild-type crtM) are shown below in the plasmid sequence in bold, underlined capital letters and are summarized below (numbered according to their position in the crtM ORF; amino acid substitutions are listed in brackets). A10G (M4V) A35G (H12R) A39G (silent) T176C (F59S) A242G (Q81R) A539G (E180G) pUC-crtE-M10-crtI sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcggg cagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgga attgtgagcggataacaatttcacacaggaaacaCATATGGAATTCaggaggattacaaaatgacggtctgcgcaaaaaa acacgttcatctcactcgcgatgctgcggagcagttactggctgatattgatcgacgccttgatcagttattgcccgtggagggagaac gggatgttgtgggtgccgcgatgcgtgaaggtgcgctggcaccgggaaaacgtattcgccccatgttgctgttgctgaccgcccgcg atctgggttgcgctgtcagccatgacggattactggatttggcctgtgcggtggaaatggtccacgcggcttcgctgatccttgacgata tgccctgcatggacgatgcgaagctgcggcgcggacgccctaccattcattctcattacggagagcatgtggcaatactggcggcgg ttgccttgctgagtaaagcctttggcgtaattgccgatgcagatggcctcacgccgctggcaaaaaatcgggcggtttctgaactgtca aacgccatcggcatgcaaggattggttcagggtcagttcaaggatctgtctgaaggggataagccgcgcagcgctgaagctattttga tgacgaatcactttaaaaccagcacgctgttttgtgcctccatgcagatggcctcgattgttgcgaatgcctccagcgaagcgcgtgatt gcctgcatcgtttttcacttgatcttggtcaggcatttcaactgctggacgatttgaccgatggcatgaccgacaccggtaaggatagca atcaggacgccggtaaatcgacgctggtcaatctgttaggcccgagggcggttgaagaacgtctgagacaacatcttcagcttgcca gtgagcatctctctgcggcctgccaacacgggcacgccactcaacattttattcaggcctggtttgacaaaaaactcgctgccgtcagtt aaTCTAGAaggaggattacaaaatgacaatgGtgaatatgaattttaaatattgtcGtaaGatcatgaagaaacattcaaaaagc ttttcttacgcttttgacttgttaccagaagatcaaagaaaagcggtttgggcaatttatgctgtgtgtcgtaaaattgatgacagtatagatg tttatggcgatattcaatCtttaaatcaaataaaagaagatatacaatctattgaaaaatacccatatgaacatcatcactttcGaagtgat cgtagaatcatgatggcgcttcagcatgttgcacaacataaaaatatcgcctttcaatctttttataatctcattgatactgtatataaagatc aacattttacaatgtttgaaacggacgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattgacgccgattttaa gtgatcatgaaacacatcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgtcggtgaag attttgacaatgGacggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaataat cattatattgacttatgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattgaagca caaccaatcatagaattagcagcacgtatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtttttgt 226 ggataagaggaaaaaggcaaagttgtttcatgaaaataaatagtaaatatcatagaatatagCTCGAGaggaggattacaaaatg aaaccaactacggtaattggtgcaggcttcggtggcctggcactggcaattcgtctacaagctgcggggatccccgtcttactgcttga acaacgtgataaacccggcggtcgggcttatgtctacgaggatcaggggtttacctttgatgcaggcccgacggttatcaccgatccc agtgccattgaagaactgtttgcactggcaggaaaacagttaaaagagtatgtcgaactgctgccggttacgccgttttaccgcctgtgt tgggagtcagggaaggtctttaattacgataacgatcaaacccggctcgaagcgcagattcagcagtttaatccccgcgatgtcgaag gttatcgtcagtttctggactattcacgcgcggtgtttaaagaaggctatctaaagctcggtactgtcccttttttatcgttcagagacatgct tcgcgccgcacctcaactggcgaaactgcaggcatggagaagcgtttacagtaaggttgccagttacatcgaagatgaacatctgcg ccaggcgttttctttccactcgctgttggtgggcggcaatcccttcgccacctcatccatttatacgttgatacacgcgctggagcgtgag tggggcgtctggtttccgcgtggcggcaccggcgcattagttcaggggatgataaagctgtttcaggatctgggtggcgaagtcgtgtt aaacgccagagtcagccatatggaaacgacaggaaacaagattgaagccgtgcatttagaggacggtcgcaggttcctgacgcaag ccgtcgcgtcaaatgcagatgtggttcatacctatcgcgacctgttaagccagcaccctgccgcggttaagcagtccaacaaactgca gactaagcgcatgagtaactctctgtttgtgctctattttggtttgaatcaccatcatgatcagctcgcgcatcacacggtttgtttcggccc gcgttaccgcgagctgattgacgaaatttttaatcatgatggcctcgcagaggacttctcactttatctgcacgcgccctgtgtcacggat tcgtcactggcgcctgaaggttgcggcagttactatgtgttggcgccggtgccAcatttaggcaccgcgaacctcgactggacggttg aggggccaaaactacgcgaccgtatttttgcgtaccttgagcagcattacatgcctggcttacggagtcagctggtcacgcaccggat gtttacgccgtttgattttcgcgaccagcttaatgcctatcatggctcagccttttctgtggagcccgttcttacccagagcgcctggtttcg gccgcataaccgcgataaaaccattactaatctctacctggtcggcgcaggcacgcatcccggcgcaggcattcctggcgtcatcgg ctcggcaaaagcgacagcaggtttgatgctggaggatctgatttgaGGGCCCGGCGCCtgatgcggtattttctccttacgca tctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgcca acacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtc agaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggt ttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatg agacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcg gcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcg aactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtgg cgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccag tcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaactta cttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaacc ggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactgg cgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttc cggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagcc ctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactg attaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatc ctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttg agatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctacca actctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaaga actctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttgg actcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgac ctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggta agcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgcca cctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcct ggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgatacc gctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 227 Plasmid name pUC18m-crtM-crtN; 4901 bp Based on vector pUC18m Construction crtM, encoding the C30 carotenoid synthase from Staphylococcus aureus is inserted between the XbaI and XhoI sites. crtN, also from S. aureus, encoding a C30 carotenoid desaturase, is inserted between the XhoI and ApaI sites. Just upstream of each ORF is an optimized Shine-Dalgarno site (AGGAGG) followed by 8 spacer nucleotides. A single lac operator/promoter site regulates the entire operon, as shown in the plasmid map. Plasmid map pUC18m-crtM-crtN sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcggg cagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgga attgtgagcggataacaatttcacacaggaaacaCATATGGAATTCTCTAGAaggaggattacaaaatgacaatgat gAatatgaattttaaatattgtcataaaatcatgaagaaacattcaaaaagcttttcttacgcttttgacttgttaccagaagatcaaagaaa agcggtttgggcaatttatgctgtgtgtcgtaaaattgatgacagtatagatgtttatggcgatattcaatttttaaAtcaaataaaagaaga tatacaatctattgaaaaatacccatatgaacatcatcactttcaaagtgatcgtagaatcatgatggcgcttcagcatgttgcacaacata aaaatatcgcctttcaatctttttataatctcattgatactgtatataaagatcaacattttacaatgtttgaaacggacgctgaattattcggat 228 attgttatggtgttgctggtacagtaggtgaagtattgacgccgattttaagtgatcatgaaacacatcagacatacgatgtcgcaagaag acttggtgaatcgttgcaattgattaatatattaagagatgtcggtgaagattttgacaatgaacggatatattttagtaagcaacgattaaa gcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaataatcattatattgacttatgggaatattatgcagctatcgcagaaaa agattttcaagatgttatggatcaaatcaaagtatttagtattgaagcacaaccaatcatagaattagcagcacgtatatatattgaaatact ggacgaagtgagacaggctaactatacattacatgaacgtgtttttgtggataagaggaaaaaggcaaagttgtttcatgaaaAtaaat agtaaatatcatagaatatagCTCGAGaggaggattacaaaatgaagattgcagtaattggtgcaggtgtcacaggattagcagc ggcagcccgtattgcttctcaaggtcatgaagtgacgatatttgaaaaaaataataatgtaggcgggcgtatgaatcaattaaagaaag acggctttacatttgatatgggtcccacaattgtcatgatgccagatgtttataaagatgtttttacagcgtgtggtaaaaattatgaagatta tattgaattgagacaattacgttatatttacgatgtgtattttgaccacgatgatcgtataacggtgcctacagatttagctgaattacagcaa atgctagaaagtatagaacctggttcaacgcatggttttatgtcctttttaacggatgtttataaaaaatatgaaattgcacgtcgctatttctt agaaagaacgtatcgcaaaccgagtgacttttataatatgacgtcacttgtgcaaggtgctaagttaaaaacgttaaatcatgcagatca gctaattgaacattatattgataacgaaaagatacaaaagcttttagcgtttcaaacgttatacataggaattgatccaaaacgaggcccg tcactatattcaattattcctatgattgaaatgatgtttggtgtgcattttattaaaggcggtatgtatggcatggctcaagggctagcgcaat taaataaagacttaggcgttaatattgaactaaatgctgaaattgagcaaattattattgatcctaaattcaaacgggccgatgcgataaaa gtgaatggtgacataagaaaatttgataaaattttatgtacggctgatttccctagtgttgcggaatcattaatgccagattttgcacctatta aaaagtatccaccacataaaattgcagacttagattactcttgttcagcatttttaatgtatatcggtatagatattgatgtgacagatcaagt gagacttcataatgttattttttcagatgactttagaggcaatattgaagaaatatttgagggacgtttatcatatgatccttctatttatgtgtat gtaccagcggtcgctgataaatcacttgcgccagaaggcaaaactggtatttatgtgctaatgccgacgccggaacttaaaacaggta gcggaatcgattggtcagatgaagctttgacgcaacaaataaaggaaattatttatcgtaaattagcaacgattgaagtatttgaagatat aaaatcgcatattgtttcagaaacaatctttacgccaaatgattttgagcaaacgtatcatgcgaaatttggttcggcattcggtttaatgcc aactttagcgcaaagtaattattatcgtccacaaaatgtatcgcgagattataaagatttatattttgcaggtgcaagtacgcatccaggtg caggcgttcctattgtcttaacgagtgcgaaaataactgtagatgaaatgattaaagatattgagcggggcgtataagggagtagtctaa GGGCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatc tgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatcc gcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggc ctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacc cctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaaga gtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagta aaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccga agaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcg ccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatg cagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgc acaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacg atgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatg gaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtg ggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactat ggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttag attgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttcc actgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaacc accgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaa atactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttacca gtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctga acggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcg ccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttcca gggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcgg agcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccct gattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagc gaggaagcggaaga 229 Plasmid name pUC18m-M8-crtN; 4901 bp Based on vector pUC18m Construction This plasmid is identical to pUC18m-crtM-crtN except in the place of wild-type crtM is M8, a mutant of the C30 carotenoid synthase crtM from Staphylococcus aureus that is capable of synthesizing C40 carotenoids. Plasmid Map See pUC18m-crtM-crtN plasmid map. Mutations Point mutations in M8 (compared with wild-type crtM) are shown below in the plasmid sequence in bold, underlined capital letters and are summarized below (numbered according to their position in the crtM ORF; amino acid substitutions are listed in brackets). T78A (F26L) A345G (silent) pUC18m-M8-crtN sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacacatatgGAATTCTCTAGAaggaggattacaaaatga caatgatgaatatgaattttaaatattgtcataaaatcatgaagaaacattcaaaaagcttttcttacgctttAgacttgttaccagaag atcaaagaaaagcggtttgggcaatttatgctgtgtgtcgtaaaattgatgacagtatagatgtttatggcgatattcaatttttaaatc aaataaaagaagatatacaatctattgaaaaatacccatatgaacatcatcactttcaaagtgatcgtagaatcatgatggcgcttca gcatgttgcacaacataaaaatatcgcctttcaatctttttataatctcattgatactgtatataaagatcaGcattttacaatgtttgaa acggacgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattgacgccgattttaagtgatcatgaaacac atcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgtcggtgaagattttgacaatga acggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaataatcattatattga cttatgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattgaagcacaacca atcatagaattagcagcacgtatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtttttgtgg ataagaggaaaaaggcaaagttgtttcatgaaaataaatagtaaatatcatagaatatagCTCGAGaggaggattacaaaat gaagattgcagtaattggtgcaggtgtcacaggattagcagcggcagcccgtattgcttctcaaggtcatgaagtgacgatatttg aaaaaaataataatgtaggcgggcgtatgaatcaattaaagaaagacggctttacatttgatatgggtcccacaattgtcatgatgc cagatgtttataaagatgtttttacagcgtgtggtaaaaattatgaagattatattgaattgagacaattacgttatatttacgatgtgtat tttgaccacgatgatcgtataacggtgcctacagatttagctgaattacagcaaatgctagaaagtatagaacctggttcaacgcat ggttttatgtcctttttaacggatgtttataaaaaatatgaaattgcacgtcgctatttcttagaaagaacgtatcgcaaaccgagtgac ttttataatatgacgtcacttgtgcaaggtgctaagttaaaaacgttaaatcatgcagatcagctaattgaacattatattgataacga aaagatacaaaagcttttagcgtttcaaacgttatacataggaattgatccaaaacgaggcccgtcactatattcaattattcctatga ttgaaatgatgtttggtgtgcattttattaaaggcggtatgtatggcatggctcaagggctagcgcaattaaataaagacttaggcgt taatattgaactaaatgctgaaattgagcaaattattattgatcctaaattcaaacgggccgatgcgataaaagtgaatggtgacata agaaaatttgataaaattttatgtacggctgatttccctagtgttgcggaatcattaatgccagattttgcacctattaaaaagtatcca ccacataaaattgcagacttagattactcttgttcagcatttttaatgtatatcggtatagatattgatgtgacagatcaagtgagactt cataatgttattttttcagatgactttagaggcaatattgaagaaatatttgagggacgtttatcatatgatccttctatttatgtgtatgta 230 ccagcggtcgctgataaatcacttgcgccagaaggcaaaactggtatttatgtgctaatgccgacgccggaacttaaaacaggta gcggaatcgattggtcagatgaagctttgacgcaacaaataaaggaaattatttatcgtaaattagcaacgattgaagtatttgaag atataaaatcgcatattgtttcagaaacaatctttacgccaaatgattttgagcaaacgtatcatgcgaaatttggttcggcattcggtt taatgccaactttagcgcaaagtaattattatcgtccacaaaatgtatcgcgagattataaagatttatattttgcaggtgcaagtacg catccaggtgcaggcgttcctattgtcttaacgagtgcgaaaataactgtagatgaaatgattaaagatattgagcggggcgtata agggagtagtctaaGGGCCCggcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtg cactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacggg cttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccg aaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggc acttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctga taaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttc ctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggat ctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcg gtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagt cacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaa cttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgtt gggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgca aactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccactt ctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcact ggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacaga tcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcattt ttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcaga ccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctacc agcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactg tccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagt ggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggct gaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgaga aagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagg gagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgt caggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttc tttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccga gcgcagcgagtcagtgagcgaggaagcggaaga 231 Plasmid name pUC18m-M9-crtN; 4901 bp Based on vector pUC18m Construction This plasmid is identical to pUC18m-crtM-crtN except in the place of wild-type crtM is M9, a mutant of the C30 carotenoid synthase crtM from Staphylococcus aureus that is capable of synthesizing C40 carotenoids. Plasmid Map See pUC18m-crtM-crtN plasmid map. Mutations Point mutations in M9 (compared with wild-type crtM) are shown below in the plasmid sequence in bold, underlined capital letters and are summarized below (numbered according to their position in the crtM ORF; amino acid substitutions are listed in brackets). T77C (F26S) T119C (I40T) T135C (silent) T141C (silent) A850G (after stop codon) pUC18m-M9-crtN sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacacatatgGAATTCTCTAGAaggaggattacaaaatga caatgatgaatatgaattttaaatattgtcataaaatcatgaagaaacattcaaaaagcttttcttacgcttCtgacttgttaccagaag atcaaagaaaagcggtttgggcaaCttatgctgtgtgtcgCaaaatCgatgacagtatagatgtttatggcgatattcaatttttaa atcaaataaaagaagatatacaatctattgaaaaatacccatatgaacatcatcactttcaaagtgatcgtagaatcatgatggcgct tcagcatgttgcacaacataaaaatatcgcctttcaatctttttataatctcattgatactgtatataaagatcaacattttacaatgtttg aaacggacgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattgacgccgattttaagtgatcatgaaac acatcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgtcggtgaagattttgacaat gaacggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaataatcattatatt gacttatgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattgaagcacaac caatcatagaattagcagcacgtatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtttttgt ggataagaggaaaaaggcaaagttgtttcatgaaaataaatagtaaGtatcatagaatatagCTCGAGaggaggattacaa aatgaagattgcagtaattggtgcaggtgtcacaggattagcagcggcagcccgtattgcttctcaaggtcatgaagtgacgatat ttgaaaaaaataataatgtaggcgggcgtatgaatcaattaaagaaagacggctttacatttgatatgggtcccacaattgtcatga tgccagatgtttataaagatgtttttacagcgtgtggtaaaaattatgaagattatattgaattgagacaattacgttatatttacgatgt gtattttgaccacgatgatcgtataacggtgcctacagatttagctgaattacagcaaatgctagaaagtatagaacctggttcaac gcatggttttatgtcctttttaacggatgtttataaaaaatatgaaattgcacgtcgctatttcttagaaagaacgtatcgcaaaccgag tgacttttataatatgacgtcacttgtgcaaggtgctaagttaaaaacgttaaatcatgcagatcagctaattgaacattatattgataa cgaaaagatacaaaagcttttagcgtttcaaacgttatacataggaattgatccaaaacgaggcccgtcactatattcaattattcct atgattgaaatgatgtttggtgtgcattttattaaaggcggtatgtatggcatggctcaagggctagcgcaattaaataaagacttag gcgttaatattgaactaaatgctgaaattgagcaaattattattgatcctaaattcaaacgggccgatgcgataaaagtgaatggtg 232 acataagaaaatttgataaaattttatgtacggctgatttccctagtgttgcggaatcattaatgccagattttgcacctattaaaaagt atccaccacataaaattgcagacttagattactcttgttcagcatttttaatgtatatcggtatagatattgatgtgacagatcaagtga gacttcataatgttattttttcagatgactttagaggcaatattgaagaaatatttgagggacgtttatcatatgatccttctatttatgtgt atgtaccagcggtcgctgataaatcacttgcgccagaaggcaaaactggtatttatgtgctaatgccgacgccggaacttaaaac aggtagcggaatcgattggtcagatgaagctttgacgcaacaaataaaggaaattatttatcgtaaattagcaacgattgaagtatt tgaagatataaaatcgcatattgtttcagaaacaatctttacgccaaatgattttgagcaaacgtatcatgcgaaatttggttcggcat tcggtttaatgccaactttagcgcaaagtaattattatcgtccacaaaatgtatcgcgagattataaagatttatattttgcaggtgcaa gtacgcatccaggtgcaggcgttcctattgtcttaacgagtgcgaaaataactgtagatgaaatgattaaagatattgagcggggc gtataagggagtagtctaaGGGCCCggcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatat ggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctga cgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatc accgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcagg tggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataacc ctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgc cttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaact ggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggc gcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcacc agtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggc caacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatc gttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcg caaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggacca cttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagc actggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagac agatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttc atttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtc agaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgct accagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaata ctgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttacc agtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgg gctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatg agaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacg agggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgct cgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacat gttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgac cgagcgcagcgagtcagtgagcgaggaagcggaaga 233 Plasmid name pUC18m-M10-crtN; 4901 bp Based on vector pUC18m Construction This plasmid is identical to pUC18m-crtM-crtN except in the place of wild-type crtM is M10, a mutant of the C30 carotenoid synthase crtM from Staphylococcus aureus that is capable of synthesizing C40 carotenoids. Plasmid Map See pUC18m-crtM-crtN plasmid map. Mutations Point mutations in M10 (compared with wild-type crtM) are shown below in the plasmid sequence in bold, underlined capital letters and are summarized below (numbered according to their position in the crtM ORF; amino acid substitutions are listed in brackets). A10G (M4V) A35G (H12R) A39G (silent) T176C (F59S) A242G (Q81R) A539G (E180G) pUC18m-M10-crtN sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacacatatgGAATTCTCTAGAaggaggattacaaaatga caatgGtgaatatgaattttaaatattgtcGtaaGatcatgaagaaacattcaaaaagcttttcttacgcttttgacttgttaccaga agatcaaagaaaagcggtttgggcaatttatgctgtgtgtcgtaaaattgatgacagtatagatgtttatggcgatattcaatCttta aatcaaataaaagaagatatacaatctattgaaaaatacccatatgaacatcatcactttcGaagtgatcgtagaatcatgatggc gcttcagcatgttgcacaacataaaaatatcgcctttcaatctttttataatctcattgatactgtatataaagatcaacattttacaatgt ttgaaacggacgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattgacgccgattttaagtgatcatgaa acacatcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgtcggtgaagattttgac aatgGacggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaataatcatt atattgacttatgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattgaagca caaccaatcatagaattagcagcacgtatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtt tttgtggataagaggaaaaaggcaaagttgtttcatgaaaataaatagtaaatatcatagaatatagCTCGAGaggaggatta caaaatgaagattgcagtaattggtgcaggtgtcacaggattagcagcggcagcccgtattgcttctcaaggtcatgaagtgacg atatttgaaaaaaataataatgtaggcgggcgtatgaatcaattaaagaaagacggctttacatttgatatgggtcccacaattgtca tgatgccagatgtttataaagatgtttttacagcgtgtggtaaaaattatgaagattatattgaattgagacaattacgttatatttacga tgtgtattttgaccacgatgatcgtataacggtgcctacagatttagctgaattacagcaaatgctagaaagtatagaacctggttca acgcatggttttatgtcctttttaacggatgtttataaaaaatatgaaattgcacgtcgctatttcttagaaagaacgtatcgcaaaccg agtgacttttataatatgacgtcacttgtgcaaggtgctaagttaaaaacgttaaatcatgcagatcagctaattgaacattatattgat aacgaaaagatacaaaagcttttagcgtttcaaacgttatacataggaattgatccaaaacgaggcccgtcactatattcaattattc ctatgattgaaatgatgtttggtgtgcattttattaaaggcggtatgtatggcatggctcaagggctagcgcaattaaataaagactt 234 aggcgttaatattgaactaaatgctgaaattgagcaaattattattgatcctaaattcaaacgggccgatgcgataaaagtgaatgg tgacataagaaaatttgataaaattttatgtacggctgatttccctagtgttgcggaatcattaatgccagattttgcacctattaaaaa gtatccaccacataaaattgcagacttagattactcttgttcagcatttttaatgtatatcggtatagatattgatgtgacagatcaagt gagacttcataatgttattttttcagatgactttagaggcaatattgaagaaatatttgagggacgtttatcatatgatccttctatttatgt gtatgtaccagcggtcgctgataaatcacttgcgccagaaggcaaaactggtatttatgtgctaatgccgacgccggaacttaaa acaggtagcggaatcgattggtcagatgaagctttgacgcaacaaataaaggaaattatttatcgtaaattagcaacgattgaagt atttgaagatataaaatcgcatattgtttcagaaacaatctttacgccaaatgattttgagcaaacgtatcatgcgaaatttggttcgg cattcggtttaatgccaactttagcgcaaagtaattattatcgtccacaaaatgtatcgcgagattataaagatttatattttgcaggtg caagtacgcatccaggtgcaggcgttcctattgtcttaacgagtgcgaaaataactgtagatgaaatgattaaagatattgagcgg ggcgtataagggagtagtctaaGGGCCCggcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcat atatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccc tgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtc atcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtc aggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaat aaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcat tttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcg aactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatg tggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtact caccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactg cggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgcct tgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacg ttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcagg accacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattg cagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaat agacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaa acttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactga gcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaacca ccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagatacc aaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctg ttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcgg tcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagc tatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgc acgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtga tgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctca catgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacg accgagcgcagcgagtcagtgagcgaggaagcggaaga 235 Plasmid name pUC18m-crtB-crtN; 4950 bp Based on vector pUC18m Construction The gene crtB from Erwinia uredovora (C40 carotenoid synthase) is inserted between the XbaI and XhoI sites. The gene crtN from Staphylococcus aureus (C30 carotenoid desaturase) is inserted between the XhoI and ApaI sites. Just upstream of each ORF is an optimized Shine-Dalgarno site (AGGAGG) followed by 8 spacer nucleotides. A single lac operator/promoter site regulates the entire operon, as shown in the plasmid map. E. coli carrying this plasmid synthesize NO carotenoids, as CrtB accepts only GGPP as a substrate, and this is present only at low levels in E. coli that do not express an additional GGPP synthase. Plasmid map pUC18m-crtB-crtN sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcggg cagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgga attgtgagcggataacaatttcacacaggaaacaCATATGGAATTCTCTAGAaggaggattacaaaatggcagttgg ctcgaaaagttttgcgacagcctcaaagttatttgatgcaaaaacccggcgcagcgtactgatgctctacgcctggtgccgccattgtg acgatgttattgacgatcagacgctgggctttcaggcccggcagcctgccttacaaacgcccgaacaacgtctgatgcaacttgagat gaaaacgcgccaggcctatgcaggatcgcagatgcacgaaccggcgtttgcggcttttcaggaagtggctatggctcatgatatcgc cccggcttacgcgtttgatcatctggaaggcttcgccatggatgtacgcgaagcgcaatacagccaactggatgatacgctgcgctatt gctatcacgttgcaggcgttgtcggcttgatgatggcgcaaatcatgggcgtgcgggataacgccacgctggaccgcgcctgtgacc ttgggctggcatttcagttgaccaatattgctcgcgatattgtggacgatgcgcatgcgggccgctgttatctgccggcaagctggctgg agcatgaaggtctgaacaaagagaattatgcggcacctgaaaaccgtcaggcgctgagccgtatcgcccgtcgtttggtgcaggaag 236 cagaaccttactatttgtctgccacagccggcctggcagggttgcccctgcgttccgcctgggcaatcgctacggcgaagcaggttta ccggaaaataggtgtcaaagttgaacaggccggtcagcaagcctgggatcagcggcagtcaacgaccacgcccgaaaaattaacg ctgctgctggccgcctctggtcaggcccttacttcccggatgcgggctcatcctccccgccctgcgcatctctggcagcgcccgctcta gCTCGAGaggaggattacaaaatgaagattgcagtaattggtgcaggtgtcacaggattagcagcggcagcccgtattgcttctc aaggtcatgaagtgacgatatttgaaaaaaataataatgtaggcgggcgtatgaatcaattaaagaaagacggctttacatttgatatgg gtcccacaattgtcatgatgccagatgtttataaagatgtttttacagcgtgtggtaaaaattatgaagattatattgaattgagacaattacg ttatatttacgatgtgtattttgaccacgatgatcgtataacggtgcctacagatttagctgaattacagcaaatgctagaaagtatagaacc tggttcaacgcatggttttatgtcctttttaacggatgtttataaaaaatatgaaattgcacgtcgctatttcttagaaagaacgtatcgcaaa ccgagtgacttttataatatgacgtcacttgtgcaaggtgctaagttaaaaacgttaaatcatgcagatcagctaattgaacattatattgat aacgaaaagatacaaaagcttttagcgtttcaaacgttatacataggaattgatccaaaacgaggcccgtcactatattcaattattcctat gattgaaatgatgtttggtgtgcattttattaaaggcggtatgtatggcatggctcaagggctagcgcaattaaataaagacttaggcgtta atattgaactaaatgctgaaattgagcaaattattattgatcctaaattcaaacgggccgatgcgataaaagtgaatggtgacataagaaa atttgataaaattttatgtacggctgatttccctagtgttgcggaatcattaatgccagattttgcacctattaaaaagtatccaccacataaa attgcagacttagattactcttgttcagcatttttaatgtatatcggtatagatattgatgtgacagatcaagtgagacttcataatgttatttttt cagatgactttagaggcaatattgaagaaatatttgagggacgtttatcatatgatccttctatttatgtgtatgtaccagcggtcgctgata aatcacttgcgccagaaggcaaaactggtatttatgtgctaatgccgacgccggaacttaaaacaggtagcggaatcgattggtcagat gaagctttgacgcaacaaataaaggaaattatttatcgtaaattagcaacgattgaagtatttgaagatataaaatcgcatattgtttcaga aacaatctttacgccaaatgattttgagcaaacgtatcatgcgaaatttggttcggcattcggtttaatgccaactttagcgcaaagtaatta ttatcgtccacaaaatgtatcgcgagattataaagatttatattttgcaggtgcaagtacgcatccaggtgcagcgcttcctattgtcttaac gagtgcgaaaataactgtagatgaaatgattaaagatattgagcgggcgtataagggagtagtctaagagaaagatgtgagaaaagta taaGGGCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtaca atctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggca tccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaag ggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcgg aacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaagga agagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaa gtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccc cgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcgg tcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaatt atgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttt tgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacacca cgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactgga tggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgt gggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaacta tggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatacttta gattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgtt ccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaa ccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagatacc aaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttac cagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggct gaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaag cgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttc cagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggc ggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatccc ctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtga gcgaggaagcggaaga 237 Plasmid name pUC18m-crtE-crtB; 4314 bp Based on vector pUC18m Construction Both genes are on a single operon, regulated by a single lac promoter and operator. Just upstream of each gene is an optimized Shine-Dalgarno site (AGGAGG) followed by 8 spacer nucleotides. The gene crtE from Erwinia uredovora (GGPP synthase) is inserted between the EcoRI and XbaI sites. The gene crtB from Erwinia uredovora (C40 carotenoid synthase) is inserted between the XbaI and XhoI sites. Plasmid map pUC18m-crtE-crtB sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcggg cagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgga attgtgagcggataacaatttcacacaggaaacaCATATGGAATTCaggaggattacaaaatgacggtctgcgcaaaaaa acacgttcatctcactcgcgatgctgcggagcagttactggctgatattgatcgacgccttgatcagttattgcccgtggagggagaac 238 gggatgttgtgggtgccgcgatgcgtgaaggtgcgctggcaccgggaaaacgtattcgccccatgttgctgttgctgaccgcccgcg atctgggttgcgctgtcagccatgacggattactggatttggcctgtgcggtggaaatggtccacgcggcttcgctgatccttgacgata tgccctgcatggacgatgcgaagctgcggcgcggacgccctaccattcattctcattacggagagcatgtggcaatactggcggcgg ttgccttgctgagtaaagcctttggcgtaattgccgatgcagatggcctcacgccgctggcaaaaaatcgggcggtttctgaactgtca aacgccatcggcatgcaaggattggttcagggtcagttcaaggatctgtctgaaggggataagccgcgcagcgctgaagctattttga tgacgaatcactttaaaaccagcacgctgttttgtgcctccatgcagatggcctcgattgttgcgaatgcctccagcgaagcgcgtgatt gcctgcatcgtttttcacttgatcttggtcaggcatttcaactgctggacgatttgaccgatggcatgaccgacaccggtaaggatagca atcaggacgccggtaaatcgacgctggtcaatctgttaggcccgagggcggttgaagaacgtctgagacaacatcttcagcttgcca gtgagcatctctctgcggcctgccaacacgggcacgccactcaacattttattcaggcctggtttgacaaaaaactcgctgccgtcagtt aaTCTAGAaggaggattacaaaatggcagttggctcgaaaagttttgcgacagcctcaaagttatttgatgcaaaaacccggcgc agcgtactgatgctctacgcctggtgccgccattgtgacgatgttattgacgatcagacgctgggctttcaggcccggcagcctgcctt acaaacgcccgaacaacgtctgatgcaacttgagatgaaaacgcgccaggcctatgcaggatcgcagatgcacgaaccggcgtttg cggcttttcaggaagtggctatggctcatgatatcgccccggcttacgcgtttgatcatctggaaggcttcgccatggatgtacgcgaag cgcaatacagccaactggatgatacgctgcgctattgctatcacgttgcaggcgttgtcggcttgatgatggcgcaaatcatgggcgtg cgggataacgccacgctggaccgcgcctgtgaccttgggctggcatttcagttgaccaatattgctcgcgatattgtggacgatgcgc atgcgggccgctgttatctgccggcaagctggctggagcatgaaggtctgaacaaagagaattatgcggcacctgaaaaccgtcag gcgctgagccgtatcgcccgtcgtttggtgcaggaagcagaaccttactatttgtctgccacagccggcctggcagggttgcccctgc gttccgcctgggcaatcgctacggcgaagcaggtttaccggaaaataggtgtcaaagttgaacaggccggtcagcaagcctgggat cagcggcagtcaacgaccacgcccgaaaaattaacgctgctgctggccgcctctggtcaggcccttacttcccggatgcgggctcat cctccccgccctgcgcatctctggcagcgcccgctctagCTCGAGGGGCCCGGCGCCtgatgcggtattttctccttac gcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccg ccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatg tgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataa tggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctc atgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttg cggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacat cgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgt ggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcacc agtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaac ttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaa ccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaact ggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggccct tccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagc cctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcact gattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagat cctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttctt gagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctacc aactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaag aactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttg gactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacga cctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggt aagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgcc acctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttc ctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgatac cgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 239 Plasmid name pUC18m-crtE; 3409 bp Based on vector pUC18m Construction Identical to pUC18m-crtE-crtB but without the crtB gene. pUC18m-crtE sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcggg cagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgga attgtgagcggataacaatttcacacaggaaacaCATATGGAATTCaggaggattacaaaatgacggtctgcgcaaaaaa acacgttcatctcactcgcgatgctgcggagcagttactggctgatattgatcgacgccttgatcagttattgcccgtggagggagaac gggatgttgtgggtgccgcgatgcgtgaaggtgcgctggcaccgggaaaacgtattcgccccatgttgctgttgctgaccgcccgcg atctgggttgcgctgtcagccatgacggattactggatttggcctgtgcggtggaaatggtccacgcggcttcgctgatccttgacgata tgccctgcatggacgatgcgaagctgcggcgcggacgccctaccattcattctcattacggagagcatgtggcaatactggcggcgg ttgccttgctgagtaaagcctttggcgtaattgccgatgcagatggcctcacgccgctggcaaaaaatcgggcggtttctgaactgtca aacgccatcggcatgcaaggattggttcagggtcagttcaaggatctgtctgaaggggataagccgcgcagcgctgaagctattttga tgacgaatcactttaaaaccagcacgctgttttgtgcctccatgcagatggcctcgattgttgcgaatgcctccagcgaagcgcgtgatt gcctgcatcgtttttcacttgatcttggtcaggcatttcaactgctggacgatttgaccgatggcatgaccgacaccggtaaggatagca atcaggacgccggtaaatcgacgctggtcaatctgttaggcccgagggcggttgaagaacgtctgagacaacatcttcagcttgcca gtgagcatctctctgcggcctgccaacacgggcacgccactcaacattttattcaggcctggtttgacaaaaaactcgctgccgtcagtt aaTCTAGACTCGAGGGGCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatat atggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacg ggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccga aacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcactttt cggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgctt caataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcac ccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaag atccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgcc gggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatg gcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggacc gaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccatacca aacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttccc ggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgat aaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctaca cgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcag accaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaa aatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaat ctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactgg cttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacata cctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccgga taaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagataccta cagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacagg agagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgattttt gtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctc acatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgac cgagcgcagcgagtcagtgagcgaggaagcggaaga 240 Plasmid name pUC18m-crtMF26A,W38A; 3365 bp Based on vector pUC18m Construction The gene encoding the F26A, W38A double mutant of CrtM is inserted between the XbaI and XhoI sites of pUC18m. The codon mutations encoding the F26A and W38A amino acid substitutions are shown in bold, underlined capital letters in the sequence below. pUC18m-crtMF26A,W38A sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagt gagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagc ggataacaatttcacacaggaaacaCATATGGAATTCTCTAGAaggaggattacaaaatgacaatgatgaatatgaattttaa atattgtcataaaatcatgaagaaacattcaaaaagcttttcttacgctGCAgacttgttaccagaagatcaaagaaaagcggttGCAgca atttatgctgtgtgtcgtaaaattgatgacagtatagatgtttatggcgatattcaatttttaaAtcaaataaaagaagatatacaatctattgaaaa atacccatatgaacatcatcactttcaaagtgatcgtagaatcatgatggcgcttcagcatgttgcacaacataaaaatatcgcctttcaatcttttt ataatctcattgatactgtatataaagatcaacattttacaatgtttgaaacggacgctgaattattcggatattgttatggtgttgctggtacagtag gtgaagtattgacgccgattttaagtgatcatgaaacacatcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatat taagagatgtcggtgaagattttgacaatgaacggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaa atggtgttaataatcattatattgacttatgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagta ttgaagcacaaccaatcatagaattagcagcacgtatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtt tttgtggataagaggaaaaaggcaaagttgtttcatgaaaAtaaatagtaaatatcatagaatatagCTCGAGGGGCCCGGCG CCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcatagtta agccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtc tccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatg tcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgt atccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattccctt ttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacat cgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcg cggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacag aaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaa cgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaa gccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagc ttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgat aaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgac ggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagttt actcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgt gagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaa aaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagatac caaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccag tggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggg gggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcc cgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcct ggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgcc agcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattacc gcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 241 Plasmid name pUC18m-bstFPSY81A; 3394 bp Based on vector pUC18m Construction The farnesyl diphosphate synthase gene from Bacillus stearothermophilus (with a codon mutation resulting in the amino acid substitution Y81A) is inserted in the XbaI and XhoI sites of the vector. This ORF is named bstFPSY81A for short. Just upstream of the ORF is an optimized Shine-Dalgarno site (AGGAGG) followed by an 8-nucleotide spacer. Plasmid map pUC18m-bstFPSY81A sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacaCATATGGAATTCTCTAGAaggaggagtaagc gatggcgcagctttcagttgaacagtttctcaacgagcaaaaacaggcggtggaaacagcgctctcccgttatatagagcgctta gaagggccggcgaagctgaaaaaggcgatggcgtactcattggaggccggcggcaaacgaatccgtccgttgctgcttctgt ccaccgttcgggcgctcggcaaagacccggcggtcggattgcccgtcgcctgcgcgattgaaatgatccatacggcatctttga tccatgatgatttgccgagcatggacaacgatgatttgcggcgcggcaagccgacgaaccataaagtgttcggcgaggcgatg gccatcttggcgggggacgggttgttgacgtacgcgtttcaattgatcaccgaaatcgacgatgagcgcatccctccttccgtcc ggcttcggctcatcgaacggctggcgaaagcggccggtccggaagggatggtcgccggtcaggcagccgatatggaagga gaggggaaaacgctgacgctttcggagctcgaatacattcatcggcataaaaccgggaaaatgctgcaatacagcgtgcacgc cggcgccttgatcggcggcgctgatgcccggcaaacgcgggagcttgacgaattcgccgcccatctaggccttgcctttcaaat 242 tcgcgatgatattctcgatattgaaggggcagaagaaaaaatcggcaagccggtcggcagcgaccaaagcaacaacaaagcg acgtatccagcgttgctgtcgcttgccggcgcgaaggaaaagttggcgttccatatcgaggcggcgcagcgccatttacggaa cgctgacgttgacggcgccgcgctcgcctatatttgcgaactggtcgccgcccgcgaccattaaCTCGAGGGGCCC GGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctg atgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgct tacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaaggg cctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcg gaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaa aaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacg ctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttg agagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgg gcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggat ggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggag gaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaag ccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactactta ctctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctgg ctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcc cgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactg attaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaa gatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaagg atcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatc aagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttag gccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataag tcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacaca gcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaaggg agaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcct ggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatgga aaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgt ggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgag gaagcggaaga 243 Plasmid name pUC18m-bstFPSY81A-idi; 3957 bp Based on vector pUC18m Construction Identical to pUC18m-bstFPSY81A but with the addition of the idi gene encoding E. coli isopentenyl diphosphate isomerase between XhoI and ApaI sites. Plasmid map pUC18m-bstFPSY81A-idi sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacaCATATGGAATTCTCTAGAaggaggagtaagc gatggcgcagctttcagttgaacagtttctcaacgagcaaaaacaggcggtggaaacagcgctctcccgttatatagagcgctta gaagggccggcgaagctgaaaaaggcgatggcgtactcattggaggccggcggcaaacgaatccgtccgttgctgcttctgt ccaccgttcgggcgctcggcaaagacccggcggtcggattgcccgtcgcctgcgcgattgaaatgatccatacggcatctttga tccatgatgatttgccgagcatggacaacgatgatttgcggcgcggcaagccgacgaaccataaagtgttcggcgaggcgatg gccatcttggcgggggacgggttgttgacgtacgcgtttcaattgatcaccgaaatcgacgatgagcgcatccctccttccgtcc ggcttcggctcatcgaacggctggcgaaagcggccggtccggaagggatggtcgccggtcaggcagccgatatggaagga gaggggaaaacgctgacgctttcggagctcgaatacattcatcggcataaaaccgggaaaatgctgcaatacagcgtgcacgc cggcgccttgatcggcggcgctgatgcccggcaaacgcgggagcttgacgaattcgccgcccatctaggccttgcctttcaaat tcgcgatgatattctcgatattgaaggggcagaagaaaaaatcggcaagccggtcggcagcgaccaaagcaacaacaaagcg acgtatccagcgttgctgtcgcttgccggcgcgaaggaaaagttggcgttccatatcgaggcggcgcagcgccatttacggaa 244 cgctgacgttgacggcgccgcgctcgcctatatttgcgaactggtcgccgcccgcgaccattaaCTCGAGaggaggatta caaaatgcaaacggaacacgtcattttattgaatgcacagggagttcccacgggtacgctggaaaagtatgccgcacacacgg cagacacccgcttacatctcgcgttctccagttggctgtttaatgccaaaggacaattattagttacccgccgcgcactgagcaaa aaagcatggcctggcgtgtggactaactcggtttgtgggcacccacaactgggagaaagcaacgaagacgcagtgatccgcc gttgccgttatgagcttggcgtggaaattacgcctcctgaatctatctatcctgactttcgctaccgcgccaccgatccgagtggca ttgtggaaaatgaagtgtgtccggtatttgccgcacgcaccactagtgcgttacagatcaatgatgatgaagtgatggattatcaat ggtgtgatttagcagatgtattacacggtattgatgccacgccgtgggcgttcagtccgtggatggtgatgcaggcgacaaatcg cgaagccagaaaacgattatctgcatttacccagcttaaataaGGGCCCGGCGCCtgatgcggtattttctccttacgca tctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacaccc gccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagct gcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtc atgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattca aatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtg tcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagt tgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatg atgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacacta ttctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctg ccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaa catgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacga tgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactgg atggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtg agcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtc aggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagttta ctcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatccc ttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatct gctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaact ggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgc ctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgat agttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccg aactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcg gcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccac ctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggtt cctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagct gataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 245 Plasmid name pUC18m-apFGS; 3456 bp Based on vector pUC18m Construction The gene encoding farnesylgeranyl diphosphate (C25PP) synthase from Aeropyrum pernix is inserted between the NdeI and EcoRI sites of pUC18m. Plasmid map pUC18m-apFGS sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacaCATATGaggaggatactcgatgctcatagaccactatata atggattttatgagcataactcctgacaggcttagcggggcatcgctacacctcattaaggccggcgggaagaggctcagaccc ctgataacactcttgacggcgaggatgctggggggtctagaggctgaggcccgtgcaatccctcttgcagcatctatagagacg gcccacacgttttcgcttatacacgatgacatcatggatagggatgaggtgaggaggggcgtccccacaacccatgtagtctac ggcgatgactgggctatactggctggcgacacgctgcacgcggcggccttcaagatgatagccgattctagggagtggggga tgagccatgaacaggcctaccgggccttcaaagttctttctgaggctgctatacagatatccaggggtcaggcgtacgacatgct cttcgaggagacctgggatgttgatgtagccgactacctcaacatggtcaggctcaagactggcgctctcatagaggcggcgg cgcgcataggagccgtcgctgcgggggctggcagcgagattgagaagatgatgggtgaggtgggtatgaacgctggcatcg ccttccagataagggatgacatactgggcgttataggtgatccaaaggttactggcaagcctgtttacaacgacttgaggagggg gaagaagacgctgctggtgatatacgctgtcaagaaggcgggtcggagggagatcgtcgaccttattgggcccaaggcgagt 246 gaggatgatttgaagagggcggcatcgataatagtggactcgggtgccctcgactacgcggagtccagggctaggttctatgtt gaaagggctagggacatactatccagggtgccggcagttgacgcggagtcgaaggagcttctcaaccttcttctagactatattg tggagagggtgaagtagGAATTCTCTAGACTCGAGGGGCCCGGCGCCtgatgcggtattttctcctt acgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccga cacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgg gagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggtta atgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatac attcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttc cgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagat cagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttcc aatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatac actattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagt gctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgc acaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacacc acgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaataga ctggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagcc ggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacgggg agtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaa gtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaa atcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgt aatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaagg taactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagca ccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaag acgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgaccta caccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggt aagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttc gccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggccttttt acggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagt gagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 247 Plasmid name pUC18m-apFGS-crtMF26A,W38A; 4335 bp Based on vector pUC18m Construction Identical to pUC18m-apFGS but with the gene encoding the F26A, W38A double mutant of CrtM is inserted between the XbaI and XhoI sites. The codon mutations encoding the F26A and W38A amino acid substitutions are shown in bold, underlined capital letters in the sequence below. pUC18m-apFGS-crtMF26A,W38A sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacaCATATGaggaggatactcgatgctcatagaccactatata atggattttatgagcataactcctgacaggcttagcggggcatcgctacacctcattaaggccggcgggaagaggctcagaccc ctgataacactcttgacggcgaggatgctggggggtctagaggctgaggcccgtgcaatccctcttgcagcatctatagagacg gcccacacgttttcgcttatacacgatgacatcatggatagggatgaggtgaggaggggcgtccccacaacccatgtagtctac ggcgatgactgggctatactggctggcgacacgctgcacgcggcggccttcaagatgatagccgattctagggagtggggga tgagccatgaacaggcctaccgggccttcaaagttctttctgaggctgctatacagatatccaggggtcaggcgtacgacatgct cttcgaggagacctgggatgttgatgtagccgactacctcaacatggtcaggctcaagactggcgctctcatagaggcggcgg cgcgcataggagccgtcgctgcgggggctggcagcgagattgagaagatgatgggtgaggtgggtatgaacgctggcatcg ccttccagataagggatgacatactgggcgttataggtgatccaaaggttactggcaagcctgtttacaacgacttgaggagggg gaagaagacgctgctggtgatatacgctgtcaagaaggcgggtcggagggagatcgtcgaccttattgggcccaaggcgagt gaggatgatttgaagagggcggcatcgataatagtggactcgggtgccctcgactacgcggagtccagggctaggttctatgtt gaaagggctagggacatactatccagggtgccggcagttgacgcggagtcgaaggagcttctcaaccttcttctagactatattg tggagagggtgaagtagGAATTCTCTAGAaggaggattacaaaatgacaatgatgaatatgaattttaaatattgtcat aaaatcatgaagaaacattcaaaaagcttttcttacgctGCAgacttgttaccagaagatcaaagaaaagcggttGCAgcaa tttatgctgtgtgtcgtaaaattgatgacagtatagatgtttatggcgatattcaatttttaaAtcaaataaaagaagatatacaatctat tgaaaaatacccatatgaacatcatcactttcaaagtgatcgtagaatcatgatggcgcttcagcatgttgcacaacataaaaatat cgcctttcaatctttttataatctcattgatactgtatataaagatcaacattttacaatgtttgaaacggacgctgaattattcggatatt gttatggtgttgctggtacagtaggtgaagtattgacgccgattttaagtgatcatgaaacacatcagacatacgatgtcgcaagaa gacttggtgaatcgttgcaattgattaatatattaagagatgtcggtgaagattttgacaatgaacggatatattttagtaagcaacga ttaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaataatcattatattgacttatgggaatattatgcagctatc gcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattgaagcacaaccaatcatagaattagcagcacgtatat atattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtttttgtggataagaggaaaaaggcaaagttg tttcatgaaaAtaaatagtaaatatcatagaatatagCTCGAGGGGCCCGGCGCCtgatgcggtattttctccttac gcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgaca cccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccggga gctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaat gtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacatt caaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccg tgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatca gttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaa tgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacac tattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgct gccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcaca 248 acatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacg atgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactg gatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggt gagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagt caggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagttt actcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcc cttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatc tgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaac tggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgc ctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgat agttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccg aactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcg gcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccac ctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggtt cctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagct gataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 249 Plasmid name pUC18m-hexPS; 4629 bp Based on vector pUC18m Construction The operon from Micrococcus luteus strain B-P 26 encoding the two polypeptide components of hexaprenyl diphosphate (C30PP) synthase (hexPS) is inserted between the EcoRI and XbaI sites of pUC18m. pUC18m-hexPS sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacaCATATGGAATTCaggaggTAGATCAatgcgt tatttacataaaattgaactagaattaaaccgacttacaagtcgatatccatttttcaaaaaaattgcatttgatgctgaaatcataaag ctcgttgatgacctaaatgtcgatgaaaatgtaaaatgtgcgattgttgccattgacacgagtatgcgtatgcaggattttatcaatg aagataataaagacagttttgtactatcaacggatgttttgagtgctttattttataagtatttatcacagccattttatcagcatgatttttt agtactgacggattgtgtaagtcgtatcaatgaattaaaatcaataagagcaacgattacagacgaaattgctttgcataatattaat aaacaaattcattatatgttcatacaaccttatatgaacaatgagaaagtggtgtcttatgagtaaacagttaaatggacaggaaaaa agtgagcttgtacataatgtattccagaatgtatcgacaaagtatgaccgcctcaacgatatcataagttttaatcagcataaatcct ggcgtaaatatacgatgaaacagatgaatgttaaaaaagggtcgaaagcacttgatgtatgctgcggtacaggcgactggacaa ttcagatggcacaggctgtcggtaaaaatggtcatgttattggtcttgatttcagtgagaatatgttaagtgttgcacaaggaaaaac gaatcatatacaaaatattgaattaattcatggtaatgcgatggaattaccatttgaagataatatatttgattatacaacgattggtttt ggtttacgtaacttaccggattataaaaaaggattagaagaaatgtatcgtgtattaaaacctggcggcatgattgttgttttagaaa cgagccatccaacaatgccagtatttaaacaaggttacaaattatatttcaaatacgttatgcccctgtttgggaaagtatttgctaag tctatgaaggaatatagctggttacagcaaagtgcttttgaatttcctgataagtacacgttagcacttttaatggctgaaactggattt acacacattaaatttaaaggttttactggtggcgtgagtgcgatgcatcttgcatacaagccgaaagaaaaatagaatggatgatt gctttgagttataaagcgtttttaaacccatatatcattgaagttgaaaaaaggttatatgagtgtattcagagtgattctgaaacgata aacaaggcggcacaccatattttaagttcaggaggaaagcgcgtacgtccgatgtttgtattattaagtggttttctgaatgatacac aaaaggatgacttgattcgtacagcagtatctctggagctcgttcatatggcaagtctcgttcatgatgattacatcgataatagtga tatgcgtcgtggtaatacttcggttcatatagcttttgataaagacacagcaattcgcacaggacattttttattagcacgtgcgttac aaaatattgcaactatcaataattcgaaattccatcaaatttttagtaaaacgatacttgaagtttgttttggtgaatttgaccagatgg cagatcgatttaattatcctgtatcctttactgcatatttaagacgtattaatcgtaaaacagcgatactgatagaagcaagctgtcatt taggggctctcagctcacagcttgatgaacaatctacatatcatataaaacaatttgggcattgtattggaatgagttatcaaattatt gatgatattctcgattacacgagtgacgaagcaacactcggtaaacctgtcggtagcgatataagaaacggtcatattacgtatcc gcttatggccgctatcgctaatttgaaagagcaagatgacgataaacttgaagcagttgttaaacatttaacatcaacatcagatga tgaagtgtatcaatatattgtttcgcaagttaaacaatatggaattgaacctgcagaattgctgagcagaaaatatggtgataaagc gaaatatcacttgagtcaattacaggatagtaatattaaagattatttagaagaaatccacgaaaaaatgttaaaacgtgtttattaaT CTAGACTCGAGGGGCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatat atggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctg acgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcat caccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcag gtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataac cctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttg ccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaac tggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtgg cgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcac 250 cagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcgg ccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgat cgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgc gcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggacc acttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcag cactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaataga cagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaactt catttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgt cagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgc taccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaat actgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttac cagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcg ggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctat gagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcac gagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatg ctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcaca tgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgac cgagcgcagcgagtcagtgagcgaggaagcggaaga 251 Plasmid name pUC18m-hexPS-crtM-crtN; 7044 bp Based on vector pUC18m Construction Identical to plasmid pUC18m-crtM-crtN but with the additional operon from Micrococcus luteus strain B-P 26 encoding the two polypeptide components of hexaprenyl diphosphate (C30PP) synthase (hexPS) inserted between the EcoRI and XbaI sites. pUC18m-hexPS-crtM-crtN sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcggg cagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgga attgtgagcggataacaatttcacacaggaaacaCATATGGAATTCaggaggtagatcaatgcgttatttacataaaattgaa ctagaattaaaccgacttacaagtcgatatccatttttcaaaaaaattgcatttgatgctgaaatcataaagctcgttgatgacctaaatgtc gatgaaaatgtaaaatgtgcgattgttgccattgacacgagtatgcgtatgcaggattttatcaatgaagataataaagacagttttgtact atcaacggatgttttgagtgctttattttataagtatttatcacagccattttatcagcatgattttttagtactgacggattgtgtaagtcgtatc aatgaattaaaatcaataagagcaacgattacagacgaaattgctttgcataatattaataaacaaattcattatatgttcatacaaccttata tgaacaatgagaaagtggtgtcttatgagtaaacagttaaatggacaggaaaaaagtgagcttgtacataatgtattccagaatgtatcg acaaagtatgaccgcctcaacgatatcataagttttaatcagcataaatcctggcgtaaatatacgatgaaacagatgaatgttaaaaaa gggtcgaaagcacttgatgtatgctgcggtacaggcgactggacaattcagatggcacaggctgtcggtaaaaatggtcatgttattgg tcttgatttcagtgagaatatgttaagtgttgcacaaggaaaaacgaatcatatacaaaatattgaattaattcatggtaatgcgatggaatt accatttgaagataatatatttgattatacaacgattggttttggtttacgtaacttaccggattataaaaaaggattagaagaaatgtatcgt gtattaaaacctggcggcatgattgttgttttagaaacgagccatccaacaatgccagtatttaaacaaggttacaaattatatttcaaatac gttatgcccctgtttgggaaagtatttgctaagtctatgaaggaatatagctggttacagcaaagtgcttttgaatttcctgataagtacacg ttagcacttttaatggctgaaactggatttacacacattaaatttaaaggttttactggtggcgtgagtgcgatgcatcttgcatacaagccg aaagaaaaatagaatggatgattgctttgagttataaagcgtttttaaacccatatatcattgaagttgaaaaaaggttatatgagtgtattc agagtgattctgaaacgataaacaaggcggcacaccatattttaagttcaggaggaaagcgcgtacgtccgatgtttgtattattaagtg gttttctgaatgatacacaaaaggatgacttgattcgtacagcagtatctctggagctcgttcatatggcaagtctcgttcatgatgattaca tcgataatagtgatatgcgtcgtggtaatacttcggttcatatagcttttgataaagacacagcaattcgcacaggacattttttattagcac gtgcgttacaaaatattgcaactatcaataattcgaaattccatcaaatttttagtaaaacgatacttgaagtttgttttggtgaatttgaccag atggcagatcgatttaattatcctgtatcctttactgcatatttaagacgtattaatcgtaaaacagcgatactgatagaagcaagctgtcatt taggggctctcagctcacagcttgatgaacaatctacatatcatataaaacaatttgggcattgtattggaatgagttatcaaattattgatg atattctcgattacacgagtgacgaagcaacactcggtaaacctgtcggtagcgatataagaaacggtcatattacgtatccgcttatgg ccgctatcgctaatttgaaagagcaagatgacgataaacttgaagcagttgttaaacatttaacatcaacatcagatgatgaagtgtatca atatattgtttcgcaagttaaacaatatggaattgaacctgcagaattgctgagcagaaaatatggtgataaagcgaaatatcacttgagt caattacaggatagtaatattaaagattatttagaagaaatccacgaaaaaatgttaaaacgtgtttattaaTCTAGAaggaggatta caaaatgacaatgatgaatatgaattttaaatattgtcataaaatcatgaagaaacattcaaaaagcttttcttacgcttttgacttgttacca gaagatcaaagaaaagcggtttgggcaatttatgctgtgtgtcgtaaaattgatgacagtatagatgtttatggcgatattcaatttttaaAt caaataaaagaagatatacaatctattgaaaaatacccatatgaacatcatcactttcaaagtgatcgtagaatcatgatggcgcttcagc atgttgcacaacataaaaatatcgcctttcaatctttttataatctcattgatactgtatataaagatcaacattttacaatgtttgaaacggac gctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattgacgccgattttaagtgatcatgaaacacatcagacata cgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgtcggtgaagattttgacaatgaacggatatatttta gtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaataatcattatattgacttatgggaatattatg cagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattgaagcacaaccaatcatagaattagcagcacg tatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtttttgtggataagaggaaaaaggcaaagttg tttcatgaaaAtaaatagtaaatatcatagaatatagCTCGAGaggaggattacaaaatgaagattgcagtaattggtgcaggtgt 252 cacaggattagcagcggcagcccgtattgcttctcaaggtcatgaagtgacgatatttgaaaaaaataataatgtaggcgggcgtatga atcaattaaagaaagacggctttacatttgatatgggtcccacaattgtcatgatgccagatgtttataaagatgtttttacagcgtgtggta aaaattatgaagattatattgaattgagacaattacgttatatttacgatgtgtattttgaccacgatgatcgtataacggtgcctacagattta gctgaattacagcaaatgctagaaagtatagaacctggttcaacgcatggttttatgtcctttttaacggatgtttataaaaaatatgaaatt gcacgtcgctatttcttagaaagaacgtatcgcaaaccgagtgacttttataatatgacgtcacttgtgcaaggtgctaagttaaaaacgtt aaatcatgcagatcagctaattgaacattatattgataacgaaaagatacaaaagcttttagcgtttcaaacgttatacataggaattgatc caaaacgaggcccgtcactatattcaattattcctatgattgaaatgatgtttggtgtgcattttattaaaggcggtatgtatggcatggctc aagggctagcgcaattaaataaagacttaggcgttaatattgaactaaatgctgaaattgagcaaattattattgatcctaaattcaaacgg gccgatgcgataaaagtgaatggtgacataagaaaatttgataaaattttatgtacggctgatttccctagtgttgcggaatcattaatgcc agattttgcacctattaaaaagtatccaccacataaaattgcagacttagattactcttgttcagcatttttaatgtatatcggtatagatattg atgtgacagatcaagtgagacttcataatgttattttttcagatgactttagaggcaatattgaagaaatatttgagggacgtttatcatatga tccttctatttatgtgtatgtaccagcggtcgctgataaatcacttgcgccagaaggcaaaactggtatttatgtgctaatgccgacgccg gaacttaaaacaggtagcggaatcgattggtcagatgaagctttgacgcaacaaataaaggaaattatttatcgtaaattagcaacgatt gaagtatttgaagatataaaatcgcatattgtttcagaaacaatctttacgccaaatgattttgagcaaacgtatcatgcgaaatttggttcg gcattcggtttaatgccaactttagcgcaaagtaattattatcgtccacaaaatgtatcgcgagattataaagatttatattttgcaggtgca agtacgcatccaggtgcaggcgttcctattgtcttaacgagtgcgaaaataactgtagatgaaatgattaaagatattgagcggggcgt ataagggagtagtctaaGGGCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatgg tgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggctt gtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgc gcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgggg aaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataa tattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccaga aacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatcctt gagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggc aagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatg acagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaagg agctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgac gagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaac aattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctg gagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacgg ggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagt ttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatccctt aacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgct tgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagca gagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctc tgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcg cagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtg agctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgc acgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgct cgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttct ttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgc agcgagtcagtgagcgaggaagcggaaga 253 Plasmid name pUC18m-hexPS-crtB-crtI; 7027 bp Based on vector pUC18m Construction Identical to plasmid pUC18m-crtE-crtB-crtI but with the operon from Micrococcus luteus strain B-P 26 encoding the two polypeptide components of hexaprenyl diphosphate (C30PP) synthase (hexPS) in place of crtE between the EcoRI and XbaI sites. pUC18m-hexPS-crtB-crtI sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcggg cagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgga attgtgagcggataacaatttcacacaggaaacaCATATGGAATTCaggaggtagatcaatgcgttatttacataaaattgaa ctagaattaaaccgacttacaagtcgatatccatttttcaaaaaaattgcatttgatgctgaaatcataaagctcgttgatgacctaaatgtc gatgaaaatgtaaaatgtgcgattgttgccattgacacgagtatgcgtatgcaggattttatcaatgaagataataaagacagttttgtact atcaacggatgttttgagtgctttattttataagtatttatcacagccattttatcagcatgattttttagtactgacggattgtgtaagtcgtatc aatgaattaaaatcaataagagcaacgattacagacgaaattgctttgcataatattaataaacaaattcattatatgttcatacaaccttata tgaacaatgagaaagtggtgtcttatgagtaaacagttaaatggacaggaaaaaagtgagcttgtacataatgtattccagaatgtatcg acaaagtatgaccgcctcaacgatatcataagttttaatcagcataaatcctggcgtaaatatacgatgaaacagatgaatgttaaaaaa gggtcgaaagcacttgatgtatgctgcggtacaggcgactggacaattcagatggcacaggctgtcggtaaaaatggtcatgttattgg tcttgatttcagtgagaatatgttaagtgttgcacaaggaaaaacgaatcatatacaaaatattgaattaattcatggtaatgcgatggaatt accatttgaagataatatatttgattatacaacgattggttttggtttacgtaacttaccggattataaaaaaggattagaagaaatgtatcgt gtattaaaacctggcggcatgattgttgttttagaaacgagccatccaacaatgccagtatttaaacaaggttacaaattatatttcaaatac gttatgcccctgtttgggaaagtatttgctaagtctatgaaggaatatagctggttacagcaaagtgcttttgaatttcctgataagtacacg ttagcacttttaatggctgaaactggatttacacacattaaatttaaaggttttactggtggcgtgagtgcgatgcatcttgcatacaagccg aaagaaaaatagaatggatgattgctttgagttataaagcgtttttaaacccatatatcattgaagttgaaaaaaggttatatgagtgtattc agagtgattctgaaacgataaacaaggcggcacaccatattttaagttcaggaggaaagcgcgtacgtccgatgtttgtattattaagtg gttttctgaatgatacacaaaaggatgacttgattcgtacagcagtatctctggagctcgttcatatggcaagtctcgttcatgatgattaca tcgataatagtgatatgcgtcgtggtaatacttcggttcatatagcttttgataaagacacagcaattcgcacaggacattttttattagcac gtgcgttacaaaatattgcaactatcaataattcgaaattccatcaaatttttagtaaaacgatacttgaagtttgttttggtgaatttgaccag atggcagatcgatttaattatcctgtatcctttactgcatatttaagacgtattaatcgtaaaacagcgatactgatagaagcaagctgtcatt taggggctctcagctcacagcttgatgaacaatctacatatcatataaaacaatttgggcattgtattggaatgagttatcaaattattgatg atattctcgattacacgagtgacgaagcaacactcggtaaacctgtcggtagcgatataagaaacggtcatattacgtatccgcttatgg ccgctatcgctaatttgaaagagcaagatgacgataaacttgaagcagttgttaaacatttaacatcaacatcagatgatgaagtgtatca atatattgtttcgcaagttaaacaatatggaattgaacctgcagaattgctgagcagaaaatatggtgataaagcgaaatatcacttgagt caattacaggatagtaatattaaagattatttagaagaaatccacgaaaaaatgttaaaacgtgtttattaaTCTAGAaggaggatta caaaatggcagttggctcgaaaagttttgcgacagcctcaaagttatttgatgcaaaaacccggcgcagcgtactgatgctctacgcct ggtgccgccattgtgacgatgttattgacgatcagacgctgggctttcaggcccggcagcctgccttacaaacgcccgaacaacgtct gatgcaacttgagatgaaaacgcgccaggcctatgcaggatcgcagatgcacgaaccggcgtttgcggcttttcaggaagtggctat ggctcatgatatcgccccggcttacgcgtttgatcatctggaaggcttcgccatggatgtacgcgaagcgcaatacagccaactggat gatacgctgcgctattgctatcacgttgcaggcgttgtcggcttgatgatggcgcaaatcatgggcgtgcgggataacgccacgctgg accgcgcctgtgaccttgggctggcatttcagttgaccaatattgctcgcgatattgtggacgatgcgcatgcgggccgctgttatctgc cggcaagctggctggagcatgaaggtctgaacaaagagaattatgcggcacctgaaaaccgtcaggcgctgagccgtatcgcccgt cgtttggtgcaggaagcagaaccttactatttgtctgccacagccggcctggcagggttgcccctgcgttccgcctgggcaatcgctac ggcgaagcaggtttaccggaaaataggtgtcaaagttgaacaggccggtcagcaagcctgggatcagcggcagtcaacgaccacg cccgaaaaattaacgctgctgctggccgcctctggtcaggcccttacttcccggatgcgggctcatcctccccgccctgcgcatctctg gcagcgcccgctctagCTCGAGaggaggattacaaaatgaaaccaactacggtaattggtgcaggcttcggtggcctggcact 254 ggcaattcgtctacaagctgcggggatccccgtcttactgcttgaacaacgtgataaacccggcggtcgggcttatgtctacgaggatc aggggtttacctttgatgcaggcccgacggttatcaccgatcccagtgccattgaagaactgtttgcactggcaggaaaacagttaaaa gagtatgtcgaactgctgccggttacgccgttttaccgcctgtgttgggagtcagggaaggtctttaattacgataacgatcaaacccgg ctcgaagcgcagattcagcagtttaatccccgcgatgtcgaaggttatcgtcagtttctggactattcacgcgcggtgtttaaagaaggc tatctaaagctcggtactgtcccttttttatcgttcagagacatgcttcgcgccgcacctcaactggcgaaactgcaggcatggagaagc gtttacagtaaggttgccagttacatcgaagatgaacatctgcgccaggcgttttctttccactcgctgttggtgggcggcaatcccttcg ccacctcatccatttatacgttgatacacgcgctggagcgtgagtggggcgtctggtttccgcgtggcggcaccggcgcattagttcag gggatgataaagctgtttcaggatctgggtggcgaagtcgtgttaaacgccagagtcagccatatggaaacgacaggaaacaagatt gaagccgtgcatttagaggacggtcgcaggttcctgacgcaagccgtcgcgtcaaatgcagatgtggttcatacctatcgcgacctgtt aagccagcaccctgccgcggttaagcagtccaacaaactgcagactaagcgcatgagtaactctctgtttgtgctctattttggtttgaat caccatcatgatcagctcgcgcatcacacggtttgtttcggcccgcgttaccgcgagctgattgacgaaatttttaatcatgatggcctcg cagaggacttctcactttatctgcacgcgccctgtgtcacggattcgtcactggcgcctgaaggttgcggcagttactatgtgttggcgc cggtgccgcatttaggcaccgcgaacctcgactggacggttgaggggccaaaactacgcgaccgtatttttgcgtaccttgagcagc attacatgcctggcttacggagtcagctggtcacgcaccggatgtttacgccgtttgattttcgcgaccagcttaatgcctatcatggctc agccttttctgtggagcccgttcttacccagagcgcctggtttcggccgcataaccgcgataaaaccattactaatctctacctggtcgg cgcaggcacgcatcccggcgcaggcattcctggcgtcatcggctcggcaaaagcgacagcaggtttgatgctggaggatctgatttg aGGGCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaat ctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatc cgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaaggg cctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaac ccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaaga gtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagta aaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccga agaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcg ccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatg cagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgc acaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacg atgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatg gaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtg ggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactat ggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttag attgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttcc actgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaacc accgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaa atactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttacca gtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctga acggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcg ccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttcca gggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcgg agcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccct gattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagc gaggaagcggaaga 255 Plasmid name pUC18m-hexPS-crtB; 5534 bp Based on vector pUC18m Construction Identical to plasmid pUC18m-hexPS-crtB-crtI but lacking crtI. pUC18m-hexPS-crtB sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacaCATATGGAATTCaggaggtagatcaatgcgttattta cataaaattgaactagaattaaaccgacttacaagtcgatatccatttttcaaaaaaattgcatttgatgctgaaatcataaagctcgtt gatgacctaaatgtcgatgaaaatgtaaaatgtgcgattgttgccattgacacgagtatgcgtatgcaggattttatcaatgaagata ataaagacagttttgtactatcaacggatgttttgagtgctttattttataagtatttatcacagccattttatcagcatgattttttagtact gacggattgtgtaagtcgtatcaatgaattaaaatcaataagagcaacgattacagacgaaattgctttgcataatattaataaacaa attcattatatgttcatacaaccttatatgaacaatgagaaagtggtgtcttatgagtaaacagttaaatggacaggaaaaaagtgag cttgtacataatgtattccagaatgtatcgacaaagtatgaccgcctcaacgatatcataagttttaatcagcataaatcctggcgta aatatacgatgaaacagatgaatgttaaaaaagggtcgaaagcacttgatgtatgctgcggtacaggcgactggacaattcagat ggcacaggctgtcggtaaaaatggtcatgttattggtcttgatttcagtgagaatatgttaagtgttgcacaaggaaaaacgaatca tatacaaaatattgaattaattcatggtaatgcgatggaattaccatttgaagataatatatttgattatacaacgattggttttggtttac gtaacttaccggattataaaaaaggattagaagaaatgtatcgtgtattaaaacctggcggcatgattgttgttttagaaacgagcc atccaacaatgccagtatttaaacaaggttacaaattatatttcaaatacgttatgcccctgtttgggaaagtatttgctaagtctatga aggaatatagctggttacagcaaagtgcttttgaatttcctgataagtacacgttagcacttttaatggctgaaactggatttacacac attaaatttaaaggttttactggtggcgtgagtgcgatgcatcttgcatacaagccgaaagaaaaatagaatggatgattgctttga gttataaagcgtttttaaacccatatatcattgaagttgaaaaaaggttatatgagtgtattcagagtgattctgaaacgataaacaag gcggcacaccatattttaagttcaggaggaaagcgcgtacgtccgatgtttgtattattaagtggttttctgaatgatacacaaaag gatgacttgattcgtacagcagtatctctggagctcgttcatatggcaagtctcgttcatgatgattacatcgataatagtgatatgcg tcgtggtaatacttcggttcatatagcttttgataaagacacagcaattcgcacaggacattttttattagcacgtgcgttacaaaatat tgcaactatcaataattcgaaattccatcaaatttttagtaaaacgatacttgaagtttgttttggtgaatttgaccagatggcagatcg atttaattatcctgtatcctttactgcatatttaagacgtattaatcgtaaaacagcgatactgatagaagcaagctgtcatttaggggc tctcagctcacagcttgatgaacaatctacatatcatataaaacaatttgggcattgtattggaatgagttatcaaattattgatgatatt ctcgattacacgagtgacgaagcaacactcggtaaacctgtcggtagcgatataagaaacggtcatattacgtatccgcttatgg ccgctatcgctaatttgaaagagcaagatgacgataaacttgaagcagttgttaaacatttaacatcaacatcagatgatgaagtgt atcaatatattgtttcgcaagttaaacaatatggaattgaacctgcagaattgctgagcagaaaatatggtgataaagcgaaatatc acttgagtcaattacaggatagtaatattaaagattatttagaagaaatccacgaaaaaatgttaaaacgtgtttattaaTCTAG Aaggaggattacaaaatggcagttggctcgaaaagttttgcgacagcctcaaagttatttgatgcaaaaacccggcgcagcgta ctgatgctctacgcctggtgccgccattgtgacgatgttattgacgatcagacgctgggctttcaggcccggcagcctgccttaca aacgcccgaacaacgtctgatgcaacttgagatgaaaacgcgccaggcctatgcaggatcgcagatgcacgaaccggcgttt gcggcttttcaggaagtggctatggctcatgatatcgccccggcttacgcgtttgatcatctggaaggcttcgccatggatgtacg cgaagcgcaatacagccaactggatgatacgctgcgctattgctatcacgttgcaggcgttgtcggcttgatgatggcgcaaatc atgggcgtgcgggataacgccacgctggaccgcgcctgtgaccttgggctggcatttcagttgaccaatattgctcgcgatattg tggacgatgcgcatgcgggccgctgttatctgccggcaagctggctggagcatgaaggtctgaacaaagagaattatgcggca cctgaaaaccgtcaggcgctgagccgtatcgcccgtcgtttggtgcaggaagcagaaccttactatttgtctgccacagccggc ctggcagggttgcccctgcgttccgcctgggcaatcgctacggcgaagcaggtttaccggaaaataggtgtcaaagttgaaca ggccggtcagcaagcctgggatcagcggcagtcaacgaccacgcccgaaaaattaacgctgctgctggccgcctctggtcag gcccttacttcccggatgcgggctcatcctccccgccctgcgcatctctggcagcgcccgctctagCTCGAGGGGCC 256 CGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctc tgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccg cttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaag ggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcg cggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattga aaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaa cgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatcc ttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgcc gggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacgg atggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcgg aggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatga agccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactac ttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggct ggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccct cccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcac tgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtg aagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaag gatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggat caagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagtta ggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataa gtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacac agcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagg gagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgc ctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatgg aaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattct gtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcg aggaagcggaaga 257 Plasmid name pUC18m-hexPS-crtMF26L; 5508 bp Based on vector pUC18m Construction Identical to plasmid pUC18m-hexPS-crtB but with the gene crtMF26L encoding the F26L mutant of the C30 carotenoid synthase CrtM from Staphylococcus aureus in place of crtB between the XbaI and XhoI sites. The codon mutation encoding the F26L amino acid substitution in crtMF26L is shown in bold, underlined capital letters in the sequence below. pUC18m-hexPS-crtMF26L sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacaCATATGGAATTCaggaggtagatcaatgcgttattta cataaaattgaactagaattaaaccgacttacaagtcgatatccatttttcaaaaaaattgcatttgatgctgaaatcataaagctcgtt gatgacctaaatgtcgatgaaaatgtaaaatgtgcgattgttgccattgacacgagtatgcgtatgcaggattttatcaatgaagata ataaagacagttttgtactatcaacggatgttttgagtgctttattttataagtatttatcacagccattttatcagcatgattttttagtact gacggattgtgtaagtcgtatcaatgaattaaaatcaataagagcaacgattacagacgaaattgctttgcataatattaataaacaa attcattatatgttcatacaaccttatatgaacaatgagaaagtggtgtcttatgagtaaacagttaaatggacaggaaaaaagtgag cttgtacataatgtattccagaatgtatcgacaaagtatgaccgcctcaacgatatcataagttttaatcagcataaatcctggcgta aatatacgatgaaacagatgaatgttaaaaaagggtcgaaagcacttgatgtatgctgcggtacaggcgactggacaattcagat ggcacaggctgtcggtaaaaatggtcatgttattggtcttgatttcagtgagaatatgttaagtgttgcacaaggaaaaacgaatca tatacaaaatattgaattaattcatggtaatgcgatggaattaccatttgaagataatatatttgattatacaacgattggttttggtttac gtaacttaccggattataaaaaaggattagaagaaatgtatcgtgtattaaaacctggcggcatgattgttgttttagaaacgagcc atccaacaatgccagtatttaaacaaggttacaaattatatttcaaatacgttatgcccctgtttgggaaagtatttgctaagtctatga aggaatatagctggttacagcaaagtgcttttgaatttcctgataagtacacgttagcacttttaatggctgaaactggatttacacac attaaatttaaaggttttactggtggcgtgagtgcgatgcatcttgcatacaagccgaaagaaaaatagaatggatgattgctttga gttataaagcgtttttaaacccatatatcattgaagttgaaaaaaggttatatgagtgtattcagagtgattctgaaacgataaacaag gcggcacaccatattttaagttcaggaggaaagcgcgtacgtccgatgtttgtattattaagtggttttctgaatgatacacaaaag gatgacttgattcgtacagcagtatctctggagctcgttcatatggcaagtctcgttcatgatgattacatcgataatagtgatatgcg tcgtggtaatacttcggttcatatagcttttgataaagacacagcaattcgcacaggacattttttattagcacgtgcgttacaaaatat tgcaactatcaataattcgaaattccatcaaatttttagtaaaacgatacttgaagtttgttttggtgaatttgaccagatggcagatcg atttaattatcctgtatcctttactgcatatttaagacgtattaatcgtaaaacagcgatactgatagaagcaagctgtcatttaggggc tctcagctcacagcttgatgaacaatctacatatcatataaaacaatttgggcattgtattggaatgagttatcaaattattgatgatatt ctcgattacacgagtgacgaagcaacactcggtaaacctgtcggtagcgatataagaaacggtcatattacgtatccgcttatgg ccgctatcgctaatttgaaagagcaagatgacgataaacttgaagcagttgttaaacatttaacatcaacatcagatgatgaagtgt atcaatatattgtttcgcaagttaaacaatatggaattgaacctgcagaattgctgagcagaaaatatggtgataaagcgaaatatc acttgagtcaattacaggatagtaatattaaagattatttagaagaaatccacgaaaaaatgttaaaacgtgtttattaaTCTAG Aaggaggattacaaaatgacaatgatgaatatgaattttaaatattgtcataaaatcatgaagaaacattcaaaaagcttttcttacg ctCTCgacttgttaccagaagatcaaagaaaagcggtttgggcaatttatgctgtgtgtcgtaaaattgatgacagtatagatgtt tatggcgatattcaatttttaaatcaaataaaagaagatatacaatctattgaaaaatacccatatgaacatcatcactttcaaagtgat cgtagaatcatgatggcgcttcagcatgttgcacaacataaaaatatcgcctttcaatctttttataatctcattgatactgtatataaa gatcaacattttacaatgtttgaaacggacgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattgacgcc gattttaagtgatcatgaaacacatcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagat gtcggtgaagattttgacaatgaacggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaa atggtgttaataatcattatattgacttatgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaag 258 tatttagtattgaagcacaaccaatcatagaattagcagcacgtatatatattgaaatactggacgaagtgagacaggctaactata cattacatgaacgtgtttttgtggataagaggaaaaaggcaaagttgtttcatgaaaataaatagtaaatatcatagaatatagCT CGAGGGGCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactc tcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtc tgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacg cgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttc ggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatg cttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgttttt gctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaac agcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattat cccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacaga aaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttc tgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaacc ggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaa ctggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctc ggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggcca gatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgag ataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaa aaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgta gaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtg gtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttcta gtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgct gccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggg gggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgcc acgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttc cagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcagggg ggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgc gttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagc gagtcagtgagcgaggaagcggaaga 259 Plasmid name pUC18m-hexPS-crtMF26A,W38A; 5508 bp Based on vector pUC18m Construction Identical to plasmid pUC18m-hexPS-crtB but with the gene crtMF26A,W38A encoding the F26A, W38A mutant of the C30 carotenoid synthase CrtM from Staphylococcus aureus in place of crtB between the XbaI and XhoI sites. The codon mutations encoding the F26A and W38A amino acid substitutions in crtMF26A,W38A are shown in bold, underlined capital letters in the sequence below. pUC18m-hexPS-crtMF26A,W38A sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaatttcacacaggaaacaCATATGGAATTCaggaggtagatcaatgcgttattta cataaaattgaactagaattaaaccgacttacaagtcgatatccatttttcaaaaaaattgcatttgatgctgaaatcataaagctcgtt gatgacctaaatgtcgatgaaaatgtaaaatgtgcgattgttgccattgacacgagtatgcgtatgcaggattttatcaatgaagata ataaagacagttttgtactatcaacggatgttttgagtgctttattttataagtatttatcacagccattttatcagcatgattttttagtact gacggattgtgtaagtcgtatcaatgaattaaaatcaataagagcaacgattacagacgaaattgctttgcataatattaataaacaa attcattatatgttcatacaaccttatatgaacaatgagaaagtggtgtcttatgagtaaacagttaaatggacaggaaaaaagtgag cttgtacataatgtattccagaatgtatcgacaaagtatgaccgcctcaacgatatcataagttttaatcagcataaatcctggcgta aatatacgatgaaacagatgaatgttaaaaaagggtcgaaagcacttgatgtatgctgcggtacaggcgactggacaattcagat ggcacaggctgtcggtaaaaatggtcatgttattggtcttgatttcagtgagaatatgttaagtgttgcacaaggaaaaacgaatca tatacaaaatattgaattaattcatggtaatgcgatggaattaccatttgaagataatatatttgattatacaacgattggttttggtttac gtaacttaccggattataaaaaaggattagaagaaatgtatcgtgtattaaaacctggcggcatgattgttgttttagaaacgagcc atccaacaatgccagtatttaaacaaggttacaaattatatttcaaatacgttatgcccctgtttgggaaagtatttgctaagtctatga aggaatatagctggttacagcaaagtgcttttgaatttcctgataagtacacgttagcacttttaatggctgaaactggatttacacac attaaatttaaaggttttactggtggcgtgagtgcgatgcatcttgcatacaagccgaaagaaaaatagaatggatgattgctttga gttataaagcgtttttaaacccatatatcattgaagttgaaaaaaggttatatgagtgtattcagagtgattctgaaacgataaacaag gcggcacaccatattttaagttcaggaggaaagcgcgtacgtccgatgtttgtattattaagtggttttctgaatgatacacaaaag gatgacttgattcgtacagcagtatctctggagctcgttcatatggcaagtctcgttcatgatgattacatcgataatagtgatatgcg tcgtggtaatacttcggttcatatagcttttgataaagacacagcaattcgcacaggacattttttattagcacgtgcgttacaaaatat tgcaactatcaataattcgaaattccatcaaatttttagtaaaacgatacttgaagtttgttttggtgaatttgaccagatggcagatcg atttaattatcctgtatcctttactgcatatttaagacgtattaatcgtaaaacagcgatactgatagaagcaagctgtcatttaggggc tctcagctcacagcttgatgaacaatctacatatcatataaaacaatttgggcattgtattggaatgagttatcaaattattgatgatatt ctcgattacacgagtgacgaagcaacactcggtaaacctgtcggtagcgatataagaaacggtcatattacgtatccgcttatgg ccgctatcgctaatttgaaagagcaagatgacgataaacttgaagcagttgttaaacatttaacatcaacatcagatgatgaagtgt atcaatatattgtttcgcaagttaaacaatatggaattgaacctgcagaattgctgagcagaaaatatggtgataaagcgaaatatc acttgagtcaattacaggatagtaatattaaagattatttagaagaaatccacgaaaaaatgttaaaacgtgtttattaaTCTAG Aaggaggattacaaaatgacaatgatgaatatgaattttaaatattgtcataaaatcatgaagaaacattcaaaaagcttttcttacg ctGCAgacttgttaccagaagatcaaagaaaagcggttGCAgcaatttatgctgtgtgtcgtaaaattgatgacagtatagat gtttatggcgatattcaatttttaaAtcaaataaaagaagatatacaatctattgaaaaatacccatatgaacatcatcactttcaaagt gatcgtagaatcatgatggcgcttcagcatgttgcacaacataaaaatatcgcctttcaatctttttataatctcattgatactgtatata aagatcaacattttacaatgtttgaaacggacgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattgacg ccgattttaagtgatcatgaaacacatcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagag atgtcggtgaagattttgacaatgaacggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtacca 260 aaatggtgttaataatcattatattgacttatgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaa agtatttagtattgaagcacaaccaatcatagaattagcagcacgtatatatattgaaatactggacgaagtgagacaggctaacta tacattacatgaacgtgtttttgtggataagaggaaaaaggcaaagttgtttcatgaaaAtaaatagtaaatatcatagaatatagC TCGAGGGGCCCGGCGCCtgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcact ctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgt ctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaac gcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttt tcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaa tgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtt tttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctca acagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtatt atcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcaca gaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttac ttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttggga accggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaacta ttaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcg ctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactgggg ccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgct gagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatt taaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagacccc gtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcg gtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtcctt ctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggct gctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaac ggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagc gccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagc ttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcagg ggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcct gcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgca gcgagtcagtgagcgaggaagcggaaga 261 Plasmid name pAC-crtMF26A,W38A; 5356 bp Based on vector pACmod Construction A fragment containing a lac promoter/operator followed by an optimized Shine-Dalgarno sequence, 8 spacer nucleotides, and then crtMF26A,W38A (encoding the F26A, W38A variant of the C30 carotenoid synthase CrtM from S. aureus) was inserted in the SalI site of pACmod (disrupting the tetracycline resistance gene on the plasmid backbone). The resulting plasmid was sequenced to confirm the direction of the insertion, which is as shown on the plasmid map. crtMF26A,W38A is directly flanked by unique XbaI and XhoI restriction sites. The codon mutations encoding the F26A and W38A amino acid substitutions are shown in bold, underlined capital letters in the sequence below. Note that the sequence shows the reverse strand of crtMF26A,W38A. Plasmid map pAC-crtMF26A,W38A sequence gaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccg taatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacgg tggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatgg tgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggattta tttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttactgatttagtgtatgatggtgttt ttgaggtgctccagtggcttctgtttctatcagctgtccctcctgttcagctactgacggggtggtgcgtaacggcaaaagcaccgccggacat cagcgctagcggagtgtatactggcttactatgttggcactgatgagggtgtcagtgaagtgcttcatgtggcaggagaaaaaaggctgcac cggtgcgtcagcagaatatgtgatacaggatatattccgcttcctcgctcactgactcgctacgctcggtcgttcgactgcggcgagcggaaa tggcttacgaacggggcggagatttcctggaagatgccaggaagatacttaacagggaagtgagagggccgcggcaaagccgtttttccat 262 aggctccgcccccctgacaagcatcacgaaatctgacgctcaaatcagtggtggcgaaacccgacaggactataaagataccaggcgtttc cccctggcggctccctcgtgcgctctcctgttcctgcctttcggtttaccggtgtcattccgctgttatggccgcgtttgtctcattccacgcct gacactcagttccgggtaggcagttcgctccaagctggactgtatgcacgaaccccccgttcagtccgaccgctgcgccttatccggtaact atcgtcttgagtccaacccggaaagacatgcaaaagcaccactggcagcagccactggtaattgatttagaggagttagtcttgaagtcatgc gccggttaaggctaaactgaaaggacaagttttggtgactgcgctcctccaagccagttacctcggttcaaagagttggtagctcagagaacc ttcgaaaaaccgccctgcaaggcggttttttcgttttcagagcaagagattacgcgcagaccaaaacgatctcaagaagatcatcttattaatca gataaaatatttcaagatttcagtgcaatttatctcttcaaatgtagcacctgaagtcagccccatacgatataagttgtaattctcatgtttgacag cttatcATCGATaagctttaatgcggtagtttatcacagttaaattgctaacgcagtcaggcaccgtgtatgaaatctaacaatgcgctcat cgtcatcctcggcaccgtcaccctggatgctgtaggcataggcttggttatgccggtactgccgggcctcttgcgggatatcgtccattccga cagcatcgccagtcactatggcgtgctgctagcgctatatgcgttgatgcaatttctatgcgcacccgttctcggagcactgtccgaccgctttg gccgccgcccagtcctgctcgcttcgctacttggagccactatcgactacgcgatcatggcgaccacacccgtcctgtGGATCCtctac gccggacgcatcgtggccggcatcaccggcgccacaggtgcggttgctggcgcctatatcgccgacatcaccgatggggaagatcgggc tcgccacttcgggctcatgagcgcttgtttcggcgtgggtatggtggcaggccccgtggccgggggactgttgggcgccatctccttgcatg caccattccttgcggcggcggtgctcaacggcctcaacctactactgggctgcttcctaatgcaggagtcgcataagggagagcGTCG ACgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccGGGCCCCTCGAGctatattctatgatatttactat ttattttcatgaaacaactttgcctttttcctcttatccacaaaaacacgttcatgtaatgtatagttagcctgtctcacttcgtccagtatttcaatatat atacgtgctgctaattctatgattggttgtgcttcaatactaaatactttgatttgatccataacatcttgaaaatctttttctgcgatagctgcataata ttcccataagtcaatataatgattattaacaccattttggtacacttcagcaatatcaacttcatattgctttaatcgttgcttactaaaatatatccgtt cattgtcaaaatcttcaccgacatctcttaatatattaatcaattgcaacgattcaccaagtcttcttgcgacatcgtatgtctgatgtgtttcatgatc acttaaaatcggcgtcaatacttcacctactgtaccagcaacaccataacaatatccgaataattcagcgtccgtttcaaacattgtaaaatgttg atctttatatacagtatcaatgagattataaaaagattgaaaggcgatatttttatgttgtgcaacatgctgaagcgccatcatgattctacgatcac tttgaaagtgatgatgttcatatgggtatttttcaatagattgtatatcttcttttatttgatttaaaaattgaatatcgccataaacatctatactgtcatc aattttacgacacacagcataaattgcTGCaaccgcttttctttgatcttctggtaacaagtcTGCagcgtaagaaaagctttttgaatgtttc ttcatgattttatgacaatatttaaaattcatattcatcattgtcattttgtaatcctcctTCTAGAGAATTCCATATGtgtttcctgtgt gaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacat taattgcgttgcgctcactgcccgctttccagtcgggaaacctGTCGACcgatgcccttgagagccttcaacccagtcagctccttccgg tgggcgcggggcatgactatcgtcgccgcacttatgactgtcttctttatcatgcaactcgtaggacaggtgccggcagcgctctgggtcattt tcggcgaggaccgctttcgctggagcgcgacgatgatcggcctgtcgcttgcggtattcggaatcttgcacgccctcgctcaagccttcgtca ctggtcccgccaccaaacgtttcggcgagaagcaggccattatcgccggcatggcggccgacgcgctgggctacgtcttgctggcgttcg cgacgcgaggctggatggccttccccattatgattcttctcgcttccggcggcatcgggatgcccgcgttgcaggccatgctgtccaggcag gtagatgacgaccatcagggacagcttcaaggatcgctcgcggctcttaccagcctaacttcgatcactggaccgctgatcgtcacggcgat ttatgccgcctcggcgagcacatggaacgggttggcatggattgtaggcgccgccctataccttgtctgcctccccgcgttgcgtcgcggtg catggagccgggccacctcgacctgaatggaagccggcggcacctcgctaacggattcaccactccaagaattggagccaatcaattcttg cggagaactgtgaatgcgcaaaccaacccttggcagaacatatccatcgcgtccgccatctccagcagccgcacgcggcgcatctcgggc agcgttgggtcctggccacgggtgcgcatgatcgtgctcctgtcgttgaggacccggctaggctggcggggttgccttactggttagcagaa tgaatcaccgatacgcgagcgaacgtgaagcgactgctgctgcaaaacgtctgcgacctgagcaacaacatgaatggtcttcggtttccgtg tttcgtaaagtctggaaacgcggaagtcccctacgtgctgctgaagttgcccgcaacagagagtggaaccaaccggtgataccacgatacta tgactgagagtcaacgccatgagcggcctcatttcttattctgagttacaacagtccgcaccgctgtccggtagctccttccggtgggcgcgg ggcatgactatcgtcgccgcacttatgactgtcttctttatcatgcaactcgtaggacaggtgccggcagcgcccaacagtcccccggccac ggggcctgccaccatacccacgccgaaacaagcgccctgcaccattatgttccggatctgcatcgcaggatgctgctggctaccctgtgga acacctacatctgtattaacgaagcgctaaccgtttttatcaggctctgggaggcagaataaatgatcatatcgtcaattattacctccacgggg agagcctgagcaaactggcctcaggcatttgagaagcacacggtcacactgcttccggtagtcaataaaccggtaaaccagcaatagacat aagcggctatttaacgaccctgccctgaaccgacgaccgggtcgaatttgctttcgaatttctgccattcatccgcttattatcacttattcaggc gtagcaccaggcgtttaagggcaccaataactgccttaaaaaaattacgccccgccctgccactcatcgcAGTACTgttgtaattcatta agcattctgccgacatggaagccatcacagacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttg cccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacga aaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaa atcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagc tcaccgtctttcattgccatacg 263 Plasmid name pAC-crtMF26A,W38A-crtI; 6849 bp Based on vector pACmod Construction Derived from pAC-crtMF26A,W38A but with the crtI gene (C40 carotenoid desaturase) from Erwinia uredovora inserted after the mutant allele of crtM. crtI is flanked by unique XhoI and ApaI restriction sites, which were used to insert it into pAC-crtMF26A,W38A with known orientation (see plasmid map). Each gene is preceded by a Shine-Dalgarno ribosomal binding sequence (AGGAGG) followed by 8 spacer nucleotides. The codon mutations encoding the F26A and W38A amino acid substitutions in crtMF26A,W38A are shown in bold, underlined capital letters in the sequence below. Note that the sequence shows the reverse strand of crtMF26A,W38A and crtI. Plasmid map pAC-crtMF26A,W38A-crtI sequence gaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaa aaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccat tgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgc ccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccaggg cttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcg ggtgatgctgccaacttactgatttagtgtatgatggtgtttttgaggtgctccagtggcttctgtttctatcagctgtccctcctgttca gctactgacggggtggtgcgtaacggcaaaagcaccgccggacatcagcgctagcggagtgtatactggcttactatgttggc actgatgagggtgtcagtgaagtgcttcatgtggcaggagaaaaaaggctgcaccggtgcgtcagcagaatatgtgatacagg 264 atatattccgcttcctcgctcactgactcgctacgctcggtcgttcgactgcggcgagcggaaatggcttacgaacggggcgga gatttcctggaagatgccaggaagatacttaacagggaagtgagagggccgcggcaaagccgtttttccataggctccgcccc cctgacaagcatcacgaaatctgacgctcaaatcagtggtggcgaaacccgacaggactataaagataccaggcgtttccccct ggcggctccctcgtgcgctctcctgttcctgcctttcggtttaccggtgtcattccgctgttatggccgcgtttgtctcattccacgcc tgacactcagttccgggtaggcagttcgctccaagctggactgtatgcacgaaccccccgttcagtccgaccgctgcgccttatc cggtaactatcgtcttgagtccaacccggaaagacatgcaaaagcaccactggcagcagccactggtaattgatttagaggagtt agtcttgaagtcatgcgccggttaaggctaaactgaaaggacaagttttggtgactgcgctcctccaagccagttacctcggttca aagagttggtagctcagagaaccttcgaaaaaccgccctgcaaggcggttttttcgttttcagagcaagagattacgcgcagacc aaaacgatctcaagaagatcatcttattaatcagataaaatatttcaagatttcagtgcaatttatctcttcaaatgtagcacctgaagt cagccccatacgatataagttgtaattctcatgtttgacagcttatcATCGATaagctttaatgcggtagtttatcacagttaaatt gctaacgcagtcaggcaccgtgtatgaaatctaacaatgcgctcatcgtcatcctcggcaccgtcaccctggatgctgtaggcat aggcttggttatgccggtactgccgggcctcttgcgggatatcgtccattccgacagcatcgccagtcactatggcgtgctgcta gcgctatatgcgttgatgcaatttctatgcgcacccgttctcggagcactgtccgaccgctttggccgccgcccagtcctgctcgc ttcgctacttggagccactatcgactacgcgatcatggcgaccacacccgtcctgtggatcctctacgccggacgcatcgtggcc ggcatcaccggcgccacaggtgcggttgctggcgcctatatcgccgacatcaccgatggggaagatcgggctcgccacttcg ggctcatgagcgcttgtttcggcgtgggtatggtggcaggccccgtggccgggggactgttgggcgccatctccttgcatgcac cattccttgcggcggcggtgctcaacggcctcaacctactactgggctgcttcctaatgcaggagtcgcataagggagagcGT CGACgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccGGGCCCtcaaatcagatcctccagc atcaaacctgctgtcgcttttgccgagccgatgacgccaggaatgcctgcgccgggatgcgtgcctgcgccgaccaggtagag attagtaatggttttatcgcggttatgcggccgaaaccaggcgctctgggtaagaacgggctccacagaaaaggctgagccatg ataggcattaagctggtcgcgaaaatcaaacggcgtaaacatccggtgcgtgaccagctgactccgtaagccaggcatgtaatg ctgctcaaggtacgcaaaaatacggtcgcgtagttttggcccctcaaccgtccagtcgaggttcgcggtgcctaaatgtggcacc ggcgccaacacatagtaactgccgcaaccttcaggcgccagtgacgaatccgtgacacagggcgcgtgcagataaagtgaga agtcctctgcgaggccatcatgattaaaaatttcgtcaatcagctcgcggtaacgcgggccgaaacaaaccgtgtgatgcgcga gctgatcatgatggtgattcaaaccaaaatagagcacaaacagagagttactcatgcgcttagtctgcagtttgttggactgcttaa ccgcggcagggtgctggcttaacaggtcgcgataggtatgaaccacatctgcatttgacgcgacggcttgcgtcaggaacctg cgaccgtcctctaaatgcacggcttcaatcttgtttcctgtcgtttccatatggctgactctggcgtttaacacgacttcgccaccca gatcctgaaacagctttatcatcccctgaactaatgcgccggtgccgccacgcggaaaccagacgccccactcacgctccagc gcgtgtatcaacgtataaatggatgaggtggcgaagggattgccgcccaccaacagcgagtggaaagaaaacgcctggcgca gatgttcatcttcgatgtaactggcaaccttactgtaaacgcttctccatgcctgcagtttcgccagttgaggtgcggcgcgaagca tgtctctgaacgataaaaaagggacagtaccgagctttagatagccttctttaaacaccgcgcgtgaatagtccagaaactgacg ataaccttcgacatcgcggggattaaactgctgaatctgcgcttcgagccgggtttgatcgttatcgtaattaaagaccttccctga ctcccaacacaggcggtaaaacggcgtaaccggcagcagttcgacatactcttttaactgttttcctgccagtgcaaacagttcttc aatggcactgggatcggtgataaccgtcgggcctgcatcaaaggtaaacccctgatcctcgtagacataagcccgaccgccgg gtttatcacgttgttcaagcagtaagacggggatccccgcagcttgtagacgaattgccagtgccaggccaccgaagcctgcac caattaccgtagttggtttcattttgtaatcctcctCTCGAGctatattctatgatatttactatttattttcatgaaacaactttgccttt ttcctcttatccacaaaaacacgttcatgtaatgtatagttagcctgtctcacttcgtccagtatttcaatatatatacgtgctgctaattc tatgattggttgtgcttcaatactaaatactttgatttgatccataacatcttgaaaatctttttctgcgatagctgcataatattcccataa gtcaatataatgattattaacaccattttggtacacttcagcaatatcaacttcatattgctttaatcgttgcttactaaaatatatccgttc attgtcaaaatcttcaccgacatctcttaatatattaatcaattgcaacgattcaccaagtcttcttgcgacatcgtatgtctgatgtgttt catgatcacttaaaatcggcgtcaatacttcacctactgtaccagcaacaccataacaatatccgaataattcagcgtccgtttcaa acattgtaaaatgttgatctttatatacagtatcaatgagattataaaaagattgaaaggcgatatttttatgttgtgcaacatgctgaa gcgccatcatgattctacgatcactttgaaagtgatgatgttcatatgggtatttttcaatagattgtatatcttcttttatttgatttaaaaa ttgaatatcgccataaacatctatactgtcatcaattttacgacacacagcataaattgcTGCaaccgcttttctttgatcttctggta acaagtcTGCagcgtaagaaaagctttttgaatgtttcttcatgattttatgacaatatttaaaattcatattcatcattgtcattttgta atcctcctTCTAGAgaattccatatgtgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaag 265 cataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaa acctGTCGACcgatgcccttgagagccttcaacccagtcagctccttccggtgggcgcggggcatgactatcgtcgccgc acttatgactgtcttctttatcatgcaactcgtaggacaggtgccggcagcgctctgggtcattttcggcgaggaccgctttcgctg gagcgcgacgatgatcggcctgtcgcttgcggtattcggaatcttgcacgccctcgctcaagccttcgtcactggtcccgccacc aaacgtttcggcgagaagcaggccattatcgccggcatggcggccgacgcgctgggctacgtcttgctggcgttcgcgacgc gaggctggatggccttccccattatgattcttctcgcttccggcggcatcgggatgcccgcgttgcaggccatgctgtccaggca ggtagatgacgaccatcagggacagcttcaaggatcgctcgcggctcttaccagcctaacttcgatcactggaccgctgatcgt cacggcgatttatgccgcctcggcgagcacatggaacgggttggcatggattgtaggcgccgccctataccttgtctgcctccc cgcgttgcgtcgcggtgcatggagccgggccacctcgacctgaatggaagccggcggcacctcgctaacggattcaccactc caagaattggagccaatcaattcttgcggagaactgtgaatgcgcaaaccaacccttggcagaacatatccatcgcgtccgccat ctccagcagccgcacgcggcgcatctcgggcagcgttgggtcctggccacgggtgcgcatgatcgtgctcctgtcgttgagga cccggctaggctggcggggttgccttactggttagcagaatgaatcaccgatacgcgagcgaacgtgaagcgactgctgctgc aaaacgtctgcgacctgagcaacaacatgaatggtcttcggtttccgtgtttcgtaaagtctggaaacgcggaagtcccctacgtg ctgctgaagttgcccgcaacagagagtggaaccaaccggtgataccacgatactatgactgagagtcaacgccatgagcggc ctcatttcttattctgagttacaacagtccgcaccgctgtccggtagctccttccggtgggcgcggggcatgactatcgtcgccgc acttatgactgtcttctttatcatgcaactcgtaggacaggtgccggcagcgcccaacagtcccccggccacggggcctgccac catacccacgccgaaacaagcgccctgcaccattatgttccggatctgcatcgcaggatgctgctggctaccctgtggaacacc tacatctgtattaacgaagcgctaaccgtttttatcaggctctgggaggcagaataaatgatcatatcgtcaattattacctccacgg ggagagcctgagcaaactggcctcaggcatttgagaagcacacggtcacactgcttccggtagtcaataaaccggtaaaccag caatagacataagcggctatttaacgaccctgccctgaaccgacgaccgggtcgaatttgctttcgaatttctgccattcatccgct tattatcacttattcaggcgtagcaccaggcgtttaagggcaccaataactgccttaaaaaaattacgccccgccctgccactcatc gcAGTACTgttgtaattcattaagcattctgccgacatggaagccatcacagacggcatgatgaacctgaatcgccagcgg catcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatc aaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttca ccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttc agtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacg 266 Plasmid name pUCmodII-crtMF26L-bstFPSY81A; 4240 bp Based on vector pUCmodII Construction The gene encoding the F26L mutant of the C30 carotenoid synthase CrtM from Staphylococcus aureus (crtMF26L) is cloned between XbaI and XhoI sites. The gene encoding the Y81A mutant of the farnesyl diphosphate synthase from Bacillus stearothermophilus (bstFPSY81A) is cloned between EcoRI and NcoI sites. The genes are part of a single operon under the control of a single lac promoter (no operator). Each gene is preceded by a Shine-Dalgarno ribosomal binding sequence (AGGAGG) followed by 8 spacer nucleotides. The codon mutation encoding the F26L amino acid substitution in crtMF26L is shown in bold, underlined capital letters in the sequence below. Plasmid map pUCmodII-crtMF26L-bstFPSY81A sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcggg cagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgga attgtgagcgTCTAGAaggaggattacaaaatgacaatgatgaatatgaattttaaatattgtcataaaatcatgaagaaacattcaa aaagcttttcttacgctCTCgacttgttaccagaagatcaaagaaaagcggtttgggcaatttatgctgtgtgtcgtaaaattgatgaca 267 gtatagatgtttatggcgatattcaatttttaaAtcaaataaaagaagatatacaatctattgaaaaatacccatatgaacatcatcactttca aagtgatcgtagaatcatgatggcgcttcagcatgttgcacaacataaaaatatcgcctttcaatctttttataatctcattgatactgtatata aagatcaacattttacaatgtttgaaacggacgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattgacgccg attttaagtgatcatgaaacacatcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgtcgg tgaagattttgacaatgaacggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgtta ataatcattatattgacttatgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattga agcacaaccaatcatagaattagcagcacgtatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgt ttttgtggataagaggaaaaaggcaaagttgtttcatgaaaAtaaatagtaaatatcatagaatatagCTCGAGGAATTCag gaggagtaagcgatggcgcagctttcagttgaacagtttctcaacgagcaaaaacaggcggtggaaacagcgctctcccgttatatag agcgcttagaagggccggcgaagctgaaaaaggcgatggcgtactcattggaggccggcggcaaacgaatccgtccgttgctgctt ctgtccaccgttcgggcgctcggcaaagacccggcggtcggattgcccgtcgcctgcgcgattgaaatgatccatacggcatctttga tccatgatgatttgccgagcatggacaacgatgatttgcggcgcggcaagccgacgaaccataaagtgttcggcgaggcgatggcc atcttggcgggggacgggttgttgacgtacgcgtttcaattgatcaccgaaatcgacgatgagcgcatccctccttccgtccggcttcg gctcatcgaacggctggcgaaagcggccggtccggaagggatggtcgccggtcaggcagccgatatggaaggagaggggaaaa cgctgacgctttcggagctcgaatacattcatcggcataaaaccgggaaaatgctgcaatacagcgtgcacgccggcgccttgatcg gcggcgctgatgcccggcaaacgcgggagcttgacgagtttgccgcccatctaggccttgcctttcaaattcgcgatgatattctcgat attgaaggggcagaagaaaaaatcggcaagccggtcggcagcgaccaaagcaacaacaaagcgacgtatccagcgttgctgtcgc ttgccggcgcgaaggaaaagttggcgttccatatcgaggcggcgcagcgccatttacggaacgctgacgttgacggcgccgcgctc gcctatatttgcgaactggtcgccgcccgcgaccattaaCCATGGGCGGCCGCtgcggtattttctccttacgcatctgtgc ggtatttcacaccgcatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgc tgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggtttt caccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagac gtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaata accctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgc cttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggat ctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtatt atcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaa agcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgaca acgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctga atgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactac ttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggc tggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtat cgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcat tggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgata atctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttt tttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttc cgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgta gcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaaga cgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccg aactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcag ggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgactt gagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttg ctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccg cagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 268 Plasmid name pUCmodII-crtMF26A,W38A-bstFPSY81A; 4240 bp Based on vector pUCmodII Construction The gene encoding the F26A, W38A double mutant of the C30 carotenoid synthase CrtM from Staphylococcus aureus (crtMF26A,W38A) is cloned between XbaI and XhoI sites. The gene encoding the Y81A mutant of the farnesyl diphosphate synthase from Bacillus stearothermophilus (bstFPSY81A) is cloned between EcoRI and NcoI sites. The genes are part of a single operon under the control of a single lac promoter (no operator). Each gene is preceded by a Shine-Dalgarno ribosomal binding sequence (AGGAGG) followed by 8 spacer nucleotides. The codon mutations encoding the F26A and W38A amino acid substitutions in crtMF26A,W38A are shown in bold, underlined capital letters in the sequence below. Plasmid map pUCmodII-crtMF26A,W38A-bstFPSY81A sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcggg cagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgga 269 attgtgagcgTCTAGAaggaggattacaaaatgacaatgatgaatatgaattttaaatattgtcataaaatcatgaagaaacattcaa aaagcttttcttacgctGCAgacttgttaccagaagatcaaagaaaagcggttGCAgcaatttatgctgtgtgtcgtaaaattgatg acagtatagatgtttatggcgatattcaatttttaaAtcaaataaaagaagatatacaatctattgaaaaatacccatatgaacatcatcact ttcaaagtgatcgtagaatcatgatggcgcttcagcatgttgcacaacataaaaatatcgcctttcaatctttttataatctcattgatactgta tataaagatcaacattttacaatgtttgaaacggacgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtattgacg ccgattttaagtgatcatgaaacacatcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgt cggtgaagattttgacaatgaacggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggt gttaataatcattatattgacttatgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtat tgaagcacaaccaatcatagaattagcagcacgtatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaac gtgtttttgtggataagaggaaaaaggcaaagttgtttcatgaaaAtaaatagtaaatatcatagaatatagCTCGAGGAATT Caggaggagtaagcgatggcgcagctttcagttgaacagtttctcaacgagcaaaaacaggcggtggaaacagcgctctcccgttat atagagcgcttagaagggccggcgaagctgaaaaaggcgatggcgtactcattggaggccggcggcaaacgaatccgtccgttgc tgcttctgtccaccgttcgggcgctcggcaaagacccggcggtcggattgcccgtcgcctgcgcgattgaaatgatccatacggcatc tttgatccatgatgatttgccgagcatggacaacgatgatttgcggcgcggcaagccgacgaaccataaagtgttcggcgaggcgatg gccatcttggcgggggacgggttgttgacgtacgcgtttcaattgatcaccgaaatcgacgatgagcgcatccctccttccgtccggct tcggctcatcgaacggctggcgaaagcggccggtccggaagggatggtcgccggtcaggcagccgatatggaaggagagggga aaacgctgacgctttcggagctcgaatacattcatcggcataaaaccgggaaaatgctgcaatacagcgtgcacgccggcgccttgat cggcggcgctgatgcccggcaaacgcgggagcttgacgagtttgccgcccatctaggccttgcctttcaaattcgcgatgatattctcg atattgaaggggcagaagaaaaaatcggcaagccggtcggcagcgaccaaagcaacaacaaagcgacgtatccagcgttgctgtc gcttgccggcgcgaaggaaaagttggcgttccatatcgaggcggcgcagcgccatttacggaacgctgacgttgacggcgccgcg ctcgcctatatttgcgaactggtcgccgcccgcgaccattaaCCATGGGCGGCCGCtgcggtattttctccttacgcatctgt gcggtatttcacaccgcatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacaccc gctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggt tttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttag acgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaa taaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttg ccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactgg atctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggt attatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacag aaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctg acaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggag ctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaa ctacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggc tggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctccc gtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaa gcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatccttttt gataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatc ctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctt tttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactct gtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactca agacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctaca ccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcgg cagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctg acttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggcct tttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgc cgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 270 Plasmid name pUCmodII-crtMF26L-crtI-bstFPSY81A; 5733 bp Based on vector pUCmodII Construction The gene encoding the F26L mutant of the C30 carotenoid synthase CrtM from Staphylococcus aureus (crtMF26L) is cloned between XbaI and XhoI sites. The gene encoding the C40 carotenoid desaturase CrtI from Erwinia uredovora (crtI) is cloned between XhoI and EcoRI sites. The gene encoding the Y81A mutant of the farnesyl diphosphate synthase from Bacillus stearothermophilus (bstFPSY81A) is cloned between EcoRI and NcoI sites. The genes are part of a single operon under the control of a single lac promoter (no operator). Each gene is preceded by a Shine-Dalgarno ribosomal binding sequence (AGGAGG) followed by 8 spacer nucleotides. The codon mutation encoding the F26L amino acid substitution in crtMF26L is shown in bold, underlined capital letters in the sequence below. Plasmid map pUCmodII-crtMF26L-crtI-bstFPSY81A sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaa cgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcgTCTAGAaggagg attacaaaatgacaatgatgaatatgaattttaaatattgtcataaaatcatgaagaaacattcaaaaagcttttcttacgctCTCgacttgttaccagaagatc aaagaaaagcggtttgggcaatttatgctgtgtgtcgtaaaattgatgacagtatagatgtttatggcgatattcaatttttaaatcaaataaaagaagatatacaa tctattgaaaaatacccatatgaacatcatcactttcaaagtgatcgtagaatcatgatggcgcttcagcatgttgcacaacataaaaatatcgcctttcaatctttt tataatctcattgatactgtatataaagatcaacattttacaatgtttgaaacggacgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagtat 271 tgacgccgattttaagtgatcatgaaacacatcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgtcggtgaa gattttgacaatgaacggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaataatcattatattgactta tgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattgaagcacaaccaatcatagaattagcagcacgt atatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtttttgtggataagaggaaaaaggcaaagttgtttcatgaaaataaa tagtaaatatcatagaatatagCTCGAGaggaggattacaaaatgaaaccaactacggtaattggtgcaggcttcggtggcctggcactggcaattcgt ctacaagctgcggggatccccgtcttactgcttgaacaacgtgataaacccggcggtcgggcttatgtctacgaggatcaggggtttacctttgatgcaggc ccgacggttatcaccgatcccagtgccattgaagaactgtttgcactggcaggaaaacagttaaaagagtatgtcgaactgctgccggttacgccgttttacc gcctgtgttgggagtcagggaaggtctttaattacgataacgatcaaacccggctcgaagcgcagattcagcagtttaatccccgcgatgtcgaaggttatc gtcagtttctggactattcacgcgcggtgtttaaagaaggctatctaaagctcggtactgtcccttttttatcgttcagagacatgcttcgcgccgcacctcaact ggcgaaactgcaggcatggagaagcgtttacagtaaggttgccagttacatcgaagatgaacatctgcgccaggcgttttctttccactcgctgttggtgggc ggcaatcccttcgccacctcatccatttatacgttgatacacgcgctggagcgtgagtggggcgtctggtttccgcgtggcggcaccggcgcattagttcag gggatgataaagctgtttcaggatctgggtggcgaagtcgtgttaaacgccagagtcagccatatggaaacgacaggaaacaagattgaagccgtgcattt agaggacggtcgcaggttcctgacgcaagccgtcgcgtcaaatgcagatgtggttcatacctatcgcgacctgttaagccagcaccctgccgcggttaagc agtccaacaaactgcagactaagcgcatgagtaactctctgtttgtgctctattttggtttgaatcaccatcatgatcagctcgcgcatcacacggtttgtttcgg cccgcgttaccgcgagctgattgacgaaatttttaatcatgatggcctcgcagaggacttctcactttatctgcacgcgccctgtgtcacggattcgtcactgg cgcctgaaggttgcggcagttactatgtgttggcgccggtgccgcatttaggcaccgcgaacctcgactggacggttgaggggccaaaactacgcgaccg tatttttgcgtaccttgagcagcattacatgcctggcttacggagtcagctggtcacgcaccggatgtttacgccgtttgattttcgcgaccagcttaatgcctat catggctcagccttttctgtggagcccgttcttacccagagcgcctggtttcggccgcataaccgcgataaaaccattactaatctctacctggtcggcgcag gcacgcatcccggcgcaggcattcctggcgtcatcggctcggcaaaagcgacagcaggtttgatgctggaggatctgatttgaGAATTCaggagga gtaagcgatggcgcagctttcagttgaacagtttctcaacgagcaaaaacaggcggtggaaacagcgctctcccgttatatagagcgcttagaagggccg gcgaagctgaaaaaggcgatggcgtactcattggaggccggcggcaaacgaatccgtccgttgctgcttctgtccaccgttcgggcgctcggcaaagac ccggcggtcggattgcccgtcgcctgcgcgattgaaatgatccatacggcatctttgatccatgatgatttgccgagcatggacaacgatgatttgcggcgc ggcaagccgacgaaccataaagtgttcggcgaggcgatggccatcttggcgggggacgggttgttgacgtacgcgtttcaattgatcaccgaaatcgacg atgagcgcatccctccttccgtccggcttcggctcatcgaacggctggcgaaagcggccggtccggaagggatggtcgccggtcaggcagccgatatgg aaggagaggggaaaacgctgacgctttcggagctcgaatacattcatcggcataaaaccgggaaaatgctgcaatacagcgtgcacgccggcgccttga tcggcggcgctgatgcccggcaaacgcgggagcttgacgagtttgccgcccatctaggccttgcctttcaaattcgcgatgatattctcgatattgaagggg cagaagaaaaaatcggcaagccggtcggcagcgaccaaagcaacaacaaagcgacgtatccagcgttgctgtcgcttgccggcgcgaaggaaaagttg gcgttccatatcgaggcggcgcagcgccatttacggaacgctgacgttgacggcgccgcgctcgcctatatttgcgaactggtcgccgcccgcgaccatt aaCCATGGGCGGCCGCtgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatggtgcactctcagtacaatctgctctgatgccg catagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctc cgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataata atggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataa ccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctca cccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttt tcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgc atacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccat gagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttga tcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggc gaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggttta ttgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacgg ggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactt tagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtc agaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgttt gccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccac ttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaag acgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacc tacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacga gggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggag cctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataacc gtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 272 Plasmid name pUCmodII-crtMF26A,W38A-crtI-bstFPSY81A; 5733 bp Based on vector pUCmodII Construction The gene encoding the F26A, W38A double mutant of the C30 carotenoid synthase CrtM from Staphylococcus aureus (crtMF26A,W38A) is cloned between XbaI and XhoI sites. The gene encoding the C40 carotenoid desaturase CrtI from Erwinia uredovora (crtI) is cloned between XhoI and EcoRI sites. The gene encoding the Y81A mutant of the farnesyl diphosphate synthase from Bacillus stearothermophilus (bstFPSY81A) is cloned between EcoRI and NcoI sites. The genes are part of a single operon under the control of a single lac promoter (no operator). Each gene is preceded by a Shine-Dalgarno ribosomal binding sequence (AGGAGG) followed by 8 spacer nucleotides. The codon mutations encoding the F26A and W38A amino acid substitutions in crtMF26A,W38A are shown in bold, underlined capital letters in the sequence below. Plasmid map pUCmodII-crtMF26A,W38A-crtI-bstFPSY81A sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaa cgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcgTCTAGAaggagg attacaaaatgacaatgatgaatatgaattttaaatattgtcataaaatcatgaagaaacattcaaaaagcttttcttacgctGCAgacttgttaccagaagatc aaagaaaagcggttGCAgcaatttatgctgtgtgtcgtaaaattgatgacagtatagatgtttatggcgatattcaatttttaaatcaaataaaagaagatatac aatctattgaaaaatacccatatgaacatcatcactttcaaagtgatcgtagaatcatgatggcgcttcagcatgttgcacaacataaaaatatcgcctttcaatct 273 ttttataatctcattgatactgtatataaagatcaacattttacaatgtttgaaacggacgctgaattattcggatattgttatggtgttgctggtacagtaggtgaagt attgacgccgattttaagtgatcatgaaacacatcagacatacgatgtcgcaagaagacttggtgaatcgttgcaattgattaatatattaagagatgtcggtga agattttgacaatgaacggatatattttagtaagcaacgattaaagcaatatgaagttgatattgctgaagtgtaccaaaatggtgttaataatcattatattgactt atgggaatattatgcagctatcgcagaaaaagattttcaagatgttatggatcaaatcaaagtatttagtattgaagcacaaccaatcatagaattagcagcacg tatatatattgaaatactggacgaagtgagacaggctaactatacattacatgaacgtgtttttgtggataagaggaaaaaggcaaagttgtttcatgaaaataa atagtaaatatcatagaatatagCTCGAGaggaggattacaaaatgaaaccaactacggtaattggtgcaggcttcggtggcctggcactggcaattcg tctacaagctgcggggatccccgtcttactgcttgaacaacgtgataaacccggcggtcgggcttatgtctacgaggatcaggggtttacctttgatgcaggc ccgacggttatcaccgatcccagtgccattgaagaactgtttgcactggcaggaaaacagttaaaagagtatgtcgaactgctgccggttacgccgttttacc gcctgtgttgggagtcagggaaggtctttaattacgataacgatcaaacccggctcgaagcgcagattcagcagtttaatccccgcgatgtcgaaggttatc gtcagtttctggactattcacgcgcggtgtttaaagaaggctatctaaagctcggtactgtcccttttttatcgttcagagacatgcttcgcgccgcacctcaact ggcgaaactgcaggcatggagaagcgtttacagtaaggttgccagttacatcgaagatgaacatctgcgccaggcgttttctttccactcgctgttggtgggc ggcaatcccttcgccacctcatccatttatacgttgatacacgcgctggagcgtgagtggggcgtctggtttccgcgtggcggcaccggcgcattagttcag gggatgataaagctgtttcaggatctgggtggcgaagtcgtgttaaacgccagagtcagccatatggaaacgacaggaaacaagattgaagccgtgcattt agaggacggtcgcaggttcctgacgcaagccgtcgcgtcaaatgcagatgtggttcatacctatcgcgacctgttaagccagcaccctgccgcggttaagc agtccaacaaactgcagactaagcgcatgagtaactctctgtttgtgctctattttggtttgaatcaccatcatgatcagctcgcgcatcacacggtttgtttcgg cccgcgttaccgcgagctgattgacgaaatttttaatcatgatggcctcgcagaggacttctcactttatctgcacgcgccctgtgtcacggattcgtcactgg cgcctgaaggttgcggcagttactatgtgttggcgccggtgccgcatttaggcaccgcgaacctcgactggacggttgaggggccaaaactacgcgaccg tatttttgcgtaccttgagcagcattacatgcctggcttacggagtcagctggtcacgcaccggatgtttacgccgtttgattttcgcgaccagcttaatgcctat catggctcagccttttctgtggagcccgttcttacccagagcgcctggtttcggccgcataaccgcgataaaaccattactaatctctacctggtcggcgcag gcacgcatcccggcgcaggcattcctggcgtcatcggctcggcaaaagcgacagcaggtttgatgctggaggatctgatttgaGAATTCaggagga gtaagcgatggcgcagctttcagttgaacagtttctcaacgagcaaaaacaggcggtggaaacagcgctctcccgttatatagagcgcttagaagggccg gcgaagctgaaaaaggcgatggcgtactcattggaggccggcggcaaacgaatccgtccgttgctgcttctgtccaccgttcgggcgctcggcaaagac ccggcggtcggattgcccgtcgcctgcgcgattgaaatgatccatacggcatctttgatccatgatgatttgccgagcatggacaacgatgatttgcggcgc ggcaagccgacgaaccataaagtgttcggcgaggcgatggccatcttggcgggggacgggttgttgacgtacgcgtttcaattgatcaccgaaatcgacg atgagcgcatccctccttccgtccggcttcggctcatcgaacggctggcgaaagcggccggtccggaagggatggtcgccggtcaggcagccgatatgg aaggagaggggaaaacgctgacgctttcggagctcgaatacattcatcggcataaaaccgggaaaatgctgcaatacagcgtgcacgccggcgccttga tcggcggcgctgatgcccggcaaacgcgggagcttgacgagtttgccgcccatctaggccttgcctttcaaattcgcgatgatattctcgatattgaagggg cagaagaaaaaatcggcaagccggtcggcagcgaccaaagcaacaacaaagcgacgtatccagcgttgctgtcgcttgccggcgcgaaggaaaagttg gcgttccatatcgaggcggcgcagcgccatttacggaacgctgacgttgacggcgccgcgctcgcctatatttgcgaactggtcgccgcccgcgaccatt aaCCATGGGCGGCCGCtgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatggtgcactctcagtacaatctgctctgatgccg catagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctc cgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataata atggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataa ccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctca cccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttt tcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgc atacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccat gagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttga tcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggc gaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggttta ttgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacgg ggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactt tagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtc agaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgttt gccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccac ttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaag acgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacc tacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacga gggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggag cctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataacc gtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga 274 Plasmid name pUCmodII-crtI; 3949 bp Based on vector pUCmodII Construction The gene encoding the C40 carotenoid desaturase CrtI from Erwinia uredovora (crtI) is cloned between the EcoRI and NcoI restriction sites of pUCmodII. The gene is preceded by a Shine-Dalgarno ribosomal binding sequence (AGGAGG) followed by 8 spacer nucleotides. Plasmid map pUCmodII-crtI sequence gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcgTCTAGAgcgCCCGGGGAATTCaggaggattacaaaatgaaaccaactacggtaatt ggtgcaggcttcggtggcctggcactggcaattcgtctacaagctgcggggatccccgtcttactgcttgaacaacgtgataaac ccggcggtcgggcttatgtctacgaggatcaggggtttacctttgatgcaggcccgacggttatcaccgatcccagtgccattga agaactgtttgcactggcaggaaaacagttaaaagagtatgtcgaactgctgccggttacgccgttttaccgcctgtgttgggagt cagggaaggtctttaattacgataacgatcaaacccggctcgaagcgcagattcagcagtttaatccccgcgatgtcgaaggtta tcgtcagtttctggactattcacgcgcggtgtttaaagaaggctatctaaagctcggtactgtcccttttttatcgttcagagacatgct tcgcgccgcacctcaactggcgaaactgcaggcatggagaagcgtttacagtaaggttgccagttacatcgaagatgaacatct gcgccaggcgttttctttccactcgctgttggtgggcggcaatcccttcgccacctcatccatttatacgttgatacacgcgctgga 275 gcgtgagtggggcgtctggtttccgcgtggcggcaccggcgcattagttcaggggatgataaagctgtttcaggatctgggtgg cgaagtcgtgttaaacgccagagtcagccatatggaaacgacaggaaacaagattgaagccgtgcatttagaggacggtcgca ggttcctgacgcaagccgtcgcgtcaaatgcagatgtggttcatacctatcgcgacctgttaagccagcaccctgccgcggttaa gcagtccaacaaactgcagactaagcgcatgagtaactctctgtttgtgctctattttggtttgaatcaccatcatgatcagctcgcg catcacacggtttgtttcggcccgcgttaccgcgagctgattgacgaaatttttaatcatgatggcctcgcagaggacttctcacttt atctgcacgcgccctgtgtcacggattcgtcactggcgcctgaaggttgcggcagttactatgtgttggcgccggtgccgcattta ggcaccgcgaacctcgactggacggttgaggggccaaaactacgcgaccgtatttttgcgtaccttgagcagcattacatgcct ggcttacggagtcagctggtcacgcaccggatgtttacgccgtttgattttcgcgaccagcttaatgcctatcatggctcagcctttt ctgtggagcccgttcttacccagagcgcctggtttcggccgcataaccgcgataaaaccattactaatctctacctggtcggcgc aggcacgcatcccggcgcaggcattcctggcgtcatcggctcggcaaaagcgacagcaggtttgatgctggaggatctgattt gaCCATGGGCGGCCGCtgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatggtgcactctcagta caatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcc cggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcga gacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcgggg aaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttca ataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctc acccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagc ggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatccc gtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaa gcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctga caacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccgg agctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaact ggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcgg cccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccaga tggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagat aggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaa ggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtaga aaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtt tgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtg tagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgcc agtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggg gttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccac gcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttcca gggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcagggggg cggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgtt atcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcga gtcagtgagcgaggaagcggaaga